Macaca_mulatta Locus Poly:12:SNORD81
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:12:SNORD81
Macaca_mulatta
Poly:12:SNORD81
1
SNORD74, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1080, 2292..2373, 2636..2703, 2982..3042, 3297..3362, 3785..3859, 4774..4850, 4998..5074
6074
GAACTAAGAAGGGGGCGGCGCCCGGGGACCGGCTCCAGGCGGCGGCGGGCGGGGAGCCG
CCGCGAGGTGGGTGTGCGTATCTGGGTGTGTCCCGTCTGCGGTGGGGGAGGGGGCCACCC
ATCCCGGGGTCCTGAGGGAGGGGCCCCGCGAGGGGGCGGGTCCGGCAAATCAGCCCGGCC
GGGGGCCAAGGGGGTGGAAGGTCGCCCGGTGCCTGGAGGCGGGATGAAGGAAAGTAGCTG
AGCGCCCCAGGAGCGCGCTGCGGCGGAGGGCGGGCGAGGTGACCCCGGTGCAGGGAAGTG
GCACTGGGGTGTGGGGCCCGAGTCCAGTCAAGGAGCAGCACCTACCTCCGGGGGTGGAAA
TGGGCCGGAATGGGCCGGAACACCGTCCCGGAAGTGAAACCCCCCACCCCCTCCCACGGA
GCGGGCGACGTGCCGGAAGGAAATCACTCAGCCTTACACCGCCCCCCTTCCCCCACCCCC
AGAGCTTTCCTTGCCTCGCGCCCCCTCCCCTCTCTGCTCTTCCTCCTCAGTCGGGAGGAG
GACGGGAGCACGGCGTCACGTGGGCGTCATGTCTCCGCCCAAAATGGCGAGGAAGGGCGG
GGAAAAGGGGCGGGTTTAGGGGGCGGGAAGAAGGTGGTGCTGGAGGAGGGAAAGATTGAG
GGGGGTTAGGGGGAGGAGCCGAAGCGGACGCCGCCGGGAGCGTGCGTCGTGACGTCATCA
CAAGAACTCTTATATGCGGGAGCCCAGGCACCATATTGTCTTTTCGAGGTGGGAGCCGAC
TGTTGTGAGGTATGTTTTATCTTTGCGAATGTTGCGGGTTTTGGGGCCCTCCATCCTTTG
TCAACTAAGGTCACCCTGAACTGACTGGGCCTTCTAAGCCAGTCGTGCGCCTTTGCAGGG
CGTACAAGTTGAGGATGGTGGGGGATTGCACGTTTGGTGCATCCGTGACCTAAGCTGCGA
CTATGTTGTTCGGGTAGAACTGCGGAGAAGCCTCGGCTCTCGTGCCCTGCCTGTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGAGTAATGATGAATGCCAACCGCTCTGATGGTGGCA
CATGCCGAGTCACCCTAGTAAGCTATTGTTAAGGGCCGTGACCCGAGCCTCCATCAGCCG
CCCGCCCTCAGGAAAGGCTGGCGGTGGGAGTCCACGTGCTTCTCTAAGTGCCTGCATTCC
GCGCTGCCACCAATATTTCCATTAGTGTTTCTTTTTCCTTTTTTTTTTTTTTGAGACCGA
GCCTCATTCTGTCACCCAGGCGGGAATGCAGTGGCGCCATCTCGGTTCATAGCAACCTCG
GCGTCCTAGTTCAAGTAGTTCTGCCCCAGCCTCCCAAGTAACTGGGACTACAGGCGCGCG
CCCCCAGGCTAGGCTTTTATATTTCTAGTAGGTCTCATCATGTTGGCCAGACTGGTCTTG
AACTCCTGACTTGGAGTGATCCACCAGCCGTGGTCTCCCAAAGTGCTGGAATTACTAGGC
GTGAGCCACTGCGCCTGGCCATTAGTGGTTCTTAACTGCGGGGGCAGTGCTCCTTTGTAA
CATTAAGTGTATTCTATACCTGTCGCTAGATAATGATATGTTACCTGCATCATTGATTTA
AAAACGACATAAAGAAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATTGATATTTAGCGT
GACTGCAGTAAGGTTCATTCTCACTGTTCTGCTTGCATCTTTTTGTTTTCTAGTTGTGTC
CCAAAGGAGGGATGACAATAGCTACTGAAGTAAGTTGAAAATTTCTTCAAAAAGATTTAA
AGTCACTGGATGTGCCACAATGATGACAGTTTATTTGCTACTCTTGACTGCTAGAATGAT
GAGGAGCTTAACCACCATTATCTTAACTGAGGCACCCAAAATGGTGATTTGGGGAACATA
GAGAGTACACCTAAGTTCACATGAAGTTTCTTCCCAGGTCCTAAAGAGCAAGCCTAACTC
AAGCCATTGGCATACAGGTGAGAAACCTCTATATTGTACTTCTCACTTTTTGAGGGATTA
GAAAATAGCCAAATGAATGATTTTATATATATTAGTGTTTTTCTCCCCACTTTTCAAATG
AGAGTTTTGCTCTCATATTGATACTAAATTTAATACTGAGGAAAACGTGAAACCAGATAC
TATGATGGTTGCATAGTTCAGCAGATTGAATCATGAAGAAATGTACTGTGTGTCTGATGT
GTCTGGGGTGGTTGCGGTTTGCTGTTACTAGTTAAGCAGTGTACCACCAATCTACCATTA
AAATATTCTTTACTGACAATTTTGTATTAAAATTACAGGCATTAGACAGAAAATTAGAAG
TTGAAATGGTAAGTAAAATTATATCCAAGTAAACAGGTAACTGGGCAAACTGCCTACGGC
ACAAATGGCTTTTTAGAGTTACCTCCTACCAGTGCTAAATGCATTAAATAAATGGCGGGT
TCTTGTCCTGTTAATGATTAATAAGAAAGTTTGTAAATGCAGCCTAGATGATGATAAGCA
AATACTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGATTAAAGGCATTTGTTAGTT
TTGGCAGGTGGGGGGAAACTCATCTGTGGCTATTCTAAGACCACTCTTAATTTTTAGGTG
GAGTGCAACTTGTCTGGACCAGCTTTATTTTTCTGGTAAGTATTAATGAAAATGCTGATA
GTGATATGCTTACTGCTGAGCTAATGGTTTAAGGCTTGGCTGATGAATACTGACTGTTTT
CCTTGAACATGTTTGGAACAGTGTGTATTTTCCTTGAGCATGTTTGGAACGGGGTTTGTG
TAATGATGTTGATCAAATGTCTGACCTGAAATGAGCGTGTAGACAGAAGGTAACACTGAA
GAACCCTGTGACAGACAACTTTGAAAAGAGTTTAATGATGTTTAGCATTTTAATAGAAGG
CCTCATTTGTATTCCACCTCCCGGTAACATTTTTATCTGTGGATGGCTTGCTTGGGTAAG
GACATGAAGATAGTTCCTCTAGCTTGTTTGTTTCTGAAATGTGGTCTTACTAATTGATGA
CTGTTACACAGAGTCGTTTTGTTAGAAAATTTTGAAAAGTAGGCAGTATGAAAGTACTGT
ATTAAAGCAGTTATTTAAAAGCATTAGATAAGATATTTGAAAGTAAATATTTGAATATTG
TTTACTTTGAAAAGTAAATGATATTCAGTGTAGGAAATGGTGTGAAACTTTTTCAGGTGC
CGATGTTTGGAGACCTTTTAAAGGTATGTTTTATTGATGTTAACATGTTTATTGAGTGAG
CTACTGTTAGTGATGATTTTAAAATTAAAGCAGATGGGAATCTCTCTGAAAGAAAATGGA
GATTAATCTTAAACTGAAACAGTAGTTGGGAAATCTTTTAGAAATCCACCTATTACTTCT
ACCTGTTGGTAAAGGAGATTAAATTTCTGCAGGTATGGAGAGTCGACTTGACTACACCGT
GTGGAGCAAGTTTTAAAGAAGCAAAGGTACAGCAGTCCCAAGTTGTTGTTTTTTTTTTTT
TAATTGAGGCCAGAGTCTAGCTCTTGCTGGGAATGGAGTGCAGTGGCACTATCAGCTCAC
TGCAACCTCTGCCTCCCGGGTTCTAGGGATTCTCCTGCCTCATCCTCCTGAGTAGCTGGG
ATTACAGCCATGTGCCACCACGCCTGGCTAATTTTTGTACCGCCATGTTGTTCAGGCTGG
TCTCCAACTCTTGACCTCAAGTGATCTGTGCGCATTGACCTCCCAAAGTGCTGGGATTAC
AGGCGTGAGCCACCGGGTCCCACCTCAAGTCTGGTTTTTAAAGTGTTGTAAAGCCGATAC
AATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGTCTTTCGCTCC
TATCTGATGTATCTGGCTGTAACATTCTAGTTTATGCCCTGAAAAGGGGAATATAGTCAT
TCTACAGTGTTTGGAGATTTTGGGTTACCCTTAATTGTATGCAAGTTGTCTTACTGTGTA
TTGTCCCTTAATTTCAGGACTCAGAATTCATGCTTGAAGAAATGCAGGTTAGTTTAAACT
TTTAAGGAAATTTTTAAGGTGGCAAAAGGTTTTAGTGGCATATACACCTTAATCTGTAGA
TGGGAGTGATTAGCTGTTTGAAAGTTGAAATGTGACTGAAAAGGAAATTGAGTAGGGAAA
TTTTAAATGGGATTATTTTTCATCTTCAAACAGGCAGACCTGTTATCCTAAACTAGGTGA
GTCAGCTTTTGGTACATGTGATAATTTTCAATGTAACCAATGATGTAATGATTCTGCCAA
ATGAAATATAATGATATCACTATAAAACCGTTCCATTTTGATTCTGAGGTTACTCTACTA
ACAAGCATCACACGTTTGTTTTTTGCCGTGATTAATATGTTGTCTTTGCTTTCAGGGTTT
TTAATGACCACAGCAAGCAAGCATGTAGCTTTACCGCTTGAAAGGTGAGGATTGGAAATA
TTGGGACTATTATAATTGCAGAATACATGATGATCTCAGTCCAGCTTGAACTCTCTCACT
GATTACCTGATGACAATAAAAGATCTGATATTCTGCATTCCCATGTAGCATTTTAATTGA
AGTCTGGAAATGTGGCTAAAAGTCTGTCTTATTTTTTGAGACAGGGTCTTGCCTCATCCA
AGCTGGAGTGCAGTGGCCCTTTGAGGCTTACTACAGCCTCAGACTTCTGGGCTCAAGTGA
TCCTCAGCCTCCCAATGGTCTTTGTAGACAGCCTGATGGAGTCTCATGGCACAAGAAGAT
TAAAACAGTGTCTCCAATTTTAATAAATTTTTGCAATCCATTTGGAGTGTATAGTATTTA
CTTTAAAAAGCACAGTGCTTTTCATCTGTTCATTCGTTGTAAGCATAAATCACATTCAAA
GGCTATTATAACTCCATGGCATTTAACACTGCAGCCAGTTAAAATTTTATGGGTGTGGGG
AAAAGAGATCAGACTGTTACTGTGTCTATGTAGAAAGAAGTGGACAGAGACTCCATTTTG
TTTTGTTCTAAGAAAAATTCTTCTGCCTTGAGATGCTGTTAATCTGTAACCGTACCCCCA
ACCCTGTCCTTACGGAGACTTGCTGTGTCAACTCAAGGTTTAATGGATTTGGGGCTGTGC
AGTATGTGCTTTGTGAAACAAGTGCCTGAAGGCAGTATGCTTGCTACAGTCATCGCCATA
CTCTAATCTCAAGTACCCAGGGACACAAACACTGCAGAAGACTGCAGGGACCTCTGCCTA
GGCAAGCTAGGTATTGTCCAAGGTTTCTCCCCATGTGATAGTCTGAAATATGGCCTCGTT
AGGAAGGGAAAGACCTGATCATCCCCCAGCCCAACACCCATAAAGGGTCTGTGCCTGTGC
TGAGGAGGATTAGTGAAAGGAAGGCAGGCCTCTGTCTCCTGCCCGTCCCTGGGCAATGGA
ATGTAAAACCCAATCGTATGTTGAGGTGGGACGTGCTAGCAGCAATGCTGCTCTTTATGC
ACTGAAAATGTTTATGGAGGTGTTTGTATATATGCACATCAAAGCACAGCACTTTTCCTT
ACTCATGACACAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved