Macaca_mulatta Locus Mono:47:SNORA63
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:47:SNORA63
Macaca_mulatta
Mono:47:SNORA63
7
SNORA63
1001..1123
2123
GGGTTTGGCCATGTTCCCCACAACCTCTGGTCTTTGTCACAACTAAAGATCGGACCCTG
GCAAAAGTCCACAATACTGCCCCTGGGAGCAAAGCAGTGGATTTACAATTCTAGGTAGCC
TTCCTTCATGGAGGCTATTTTTATTTTGATGGAGAAGTTCTGTGCTAACTAAGTCTTCCT
TCCACTCAAGATTTATTGAGTCCCTACTGTGTGCCATGTAAATCTGGGCCCTGGGAATAA
AGCAGTGAATAAAACAGCACTTTGCCCTCATGGCACATACATTCTAGAGGGAGACAAATA
TATGTGTAGAATAGAGTCAGATGGAACAAGCACTCCAAGACAAAGGCAGAAGAACAAGAG
AGCCCATGGGCTACGTTATGCAGATAGAGAGTCAGGGGTCAGGGTCAGCCTTGTCCAGGA
GGTGACATTGGAACAGTGAAGGAGGAAGCCAAGCAGGCACCTGGCAGAGTGGACCCTCAT
CAGCAGGGGGAAGCACGCGCAAAGATGAGGAGGTGGGACTTTGTTGCAGATTTTGAAGAA
CAACCAGAAGCTCATGTCGTTTTAACAGAGAGGGGACTTTGGAGTAGATGGGTCCCCTGG
AAAGGCAAGGATAGGCCTCTGGTAGGAAGCTTTGGAGCAGTTAGGGCAATGGGACCATTT
GTTCACACAAACATCCCTGAGTCTCTAATGTGTTTCTGAGTTTCCTAGCAGAAACTCAGG
CTGGATGGATGGTGAGGCAGCAGATGGTGCAGTCAGCCTCAAAGATCTTGATGAGACTCC
CACTTACACTGCACACTGACGTGAGACCACCCTGGGCAAGTAGCTGGGACTGACGTGGGG
TCTCAAGAAACTTATTCAATTGTTGCAGAGAACTAATTTGCTCATCTGTAAAATGGGCAT
GAGACAAAGCTATTTTCTAGACTCTAGGGTCATCATGAGGACTAAGTGAGAGAGCATAAT
GGTTTACAATGAAGGCGCATGTATATAAGATAAAAAATAGGATGCACGTACTGCTACAGT
ATGACTAAAGTGATTTGTTGTCATTTCCCCTGCTTAAAGCACTTGATACATAACTATCTC
TGTCTAACTCCATTCCACAGTAAGAGATGCTTGGTTTCATTTTTCCTTGAGGCCAGACCT
GTAATACCAGCACTTTAGGAGGACAAGGTGAGAGGATCAGTTGAGGCCAGGAGTTCATGG
CCAGCCTGGGCAACATAGCAAGACCTTTTTCTAAAATGAAAAAGGCAACCGGGCGCAGTG
GCCACGCCTCTAATCCCAGCACTTTGGGAGGCCGAGGTGGGTGGATCATGAGGTCAGGAG
ATTGAGACCATCCTGGCTAACACAGTGAAAACCCATCTATACTACAAATACAAAAAATTA
GCCAGGCGTGGTGGTGGGCACCTGTAGTCCCAGCTACTCGGGAGGTTGAGGCGGGAGAAT
GGCANNNNNNNNNNNNNNNNNNNNTTTTTGAGACGGAGTCTCGCTCTGTTGCCCAGGCTG
GAGTGCAGTGGCCGGATCTCAGCTCACTGCAAGCTCCGCCTCCCGGGTTTACGCCATTCT
CCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCGCCCCCCACCTCGCCCGGCTAGTT
TTTTGTATTTTTTAGTAGAGACGGGGTTTCACCATGTTAGCCAGGATGGTCTTGATCTCC
TGACCTCATGATCCGCCCGTCTCGGCCTCCCAAAGTGCTGGGATTACAGGCTTGAGCCAC
CGCGCCCGGCCGACAGTGTTCTATTTCTTGTTCCGGTTGCTGGGTTGAGTGAGTGTGGAT
TGAGTGAGTTGAATGAGAGTGCTTACAGTGTGAAGATTCACTGGCTCTGCACTCATGGTT
TACGCATTTTTCGATGTCTATGTTCTACTTCAATAAAAAAGTTTTAAAAAATGAGGGTGT
TACAGCCAGATTTCCTTGGTTCAAATTCCAGCTTACTAGCTATGTGACCTTAATCAAATG
ATCTAACTTGTCCTGCTGTTAGGAAGGTCAGATGAGTTAAATCCTTAGAATAGTGTGTGG
AATAACATAGTGACCAGGATTAGCTATTAATTTGATGATGATGATGGTGGTGCTGGTGGT
GGTGCTGGTGGTGGTGGTGGTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved