Macaca_mulatta Locus Mono:322:SNORA75
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:322:SNORA75
Macaca_mulatta
Mono:322:SNORA75
5
SNORA75
1001..1135
2135
ATTGACACTTTTCTTATTATAAAATTTCACTCTTTATCTCTAGCAATATTTTTTGTTTT
AAAATCAATTGTGTCTGATATTACTGTAGTCACTGTAGCTGTCTTGTGGTTGCTCTTTGC
ATGACATCTTTTTCCATCCTTTTACTTTCAATATATTTGTATCTTTGAATCTAAAGTGTG
TCTCTTGTAGAGAACATAAAGTTGGATCTTAATTTTTAAAATCCAGTCTGACAATCTATG
CATTTTGATAGGATTATTTAATCCATTTACATATAATGTCATTATGGCTATAGTTGGGTT
TACATCTGTCATTTTAATTTTTGTTTTCAGTTTTGTACTGTTTTTGCTCCTCTATTTCAC
CTTTACTATGTTGTTTGCATTAAATGAATATTTTCTTATGTAGCATACTATTTTTAAATG
ATTTTTTACTACACATACTGAGTTATTTCCCCAGTGTTTGTTCTATATATATCTTAATTT
ATTTGAATTAGCTTCAGATTTACATTAACTTAATTTCAATATGATCTAGAAATGTTATTC
TTGTAGCACAATTTTCTTTCCTCTTTTGTAATACTATTGTTATACATATTTCATTCTATA
AATGTCTCAAGTTCAACATTTCATGAGTATAATTATTATGCAATACAATTTAAGCATTTT
AAAGAAGTCATTAAAGGAGAGGAGAGCAAGTATATATTTATAACTTTTGTTATACTAGTC
TTTTTATTTATCATTTCTGGATCTATTTGTTTTTGTAGATTTGAGTTACCATATGGAGTC
ATTTTCATAGCCTAATTGAGCTGTGTTTCCACCCACTTCTTTTGTGCTGTTATTGGCAAA
TGTATTACATTCCTATATTCATTGTATACATTTTATTTTGTTTCATCCAGTTGCCTTTTA
AATCAGTTAAGAGAGTAAATATGTGTTTATACTCTTGTGATCACATAATTACCTTTTCAG
GTACTCTTTGTTTATCTGTGTGGATTCAAAAAATGAGGTCAGACTTCTCACTGAGCTTCT
TTCTGTCTGTTGGTGGAAGCTTATAGATTCATGTGAGCAGAGAAAATTCATAGAACTAGC
ATTACTTTTGCCTTCTGTCTTTACAGGAGTATATTTGGCTGTTTTGGGAGATATTGTGGT
AAAAAAAAAAAATAGAAATCAAAGAAAAGAAAAATGAGGTCATTTGCTTTTAGCCTAAAA
AATTTTCCTAGGTGTTTCTTGTAAGGTAGGTCTACTAACAACAAATCAGTCCACTTTTTG
TTTATCTTTTCATGTCATTTTCCTATTTCAATTTGATAGTTTTGCTGTACATAGGATTCT
TGGTTGAAAGTGTAATGCCCAGACCGTTTGTTCCCCAAAGAAGACCACCAGAGTCCAGAG
TCAAAGCCAAGCGGCAAGGATCTTTTACTGCAAGTTCGAACTTGGTCCCTCCATTCCACA
GCATACAAGAGGGCCCCGAACAATGCGAGTGCTTGCCTTTTATAGCCCGATGTAAATAGG
ATACGTAAAGTTACAGAGGAACAAGGGAATTCTTTTGGTTACAGCACTACAATTGGTTAA
CATTTTAAGTTATACATTTAGCAGTTTTCTATTGGTTCCCGCGCTTTCAGTAAAACCACG
AACGGGTGTGTCCTTATCGGAGACTTTCCAGGTGGTGTTTTTCTAAAGTTGAGATATATG
GTAGTCTCTGAGTTGAGAAATGTGTTTGTACTGGGCTCAGGAAGTTAAGAGATATATGGT
GGGATGTGTTTGTACTGGGCTCAGGAAGTTAAGAGATATATGGTGGGATGTGTTTGTACT
GGGCTCAGGAAGTTAAGAGATATATGGTGGGATGCGTTTGTACTGGGCCTGTTTGTGTTG
AGTCCGGGGTTGAGGAATGTGCCTGTTTTCTTTCAAAAGCTTTCTTTTTTCCTTTGAGTG
CTTTGATTGTGTTATCCATCCCTTCTTTACCTCCCTTCCCATCTGTGGCCTCCATTGTTT
CTGATGAGAATTTACCTTTAATCTTCTTGAAGTTCCCTTTTAAATAATGAGTCATTTTTC
TCTTGGTGCTTTCAAGATTTTTGTCCTTACCTTTGGCTTTCAGCATTTTCACTATGACTT
GTCTGTGAATCTCTTTGCATTTATCCTATTTGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved