Macaca_mulatta Locus Mono:289:SNORA51
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:289:SNORA51
Macaca_mulatta
Mono:289:SNORA51
6
SNORA51
1001..1133
2133
ATAGATGAAATAATATAGTATGCACACTTTTGTGTTTGGCTTTTTTCACTCAGTGTAAT
ATTTTTGATATTTATGCATGTCGTTGCATGTAGCAGTAATTCGTTCTTTGTTGTTACTGA
GAATAATCCTATTATATAAACATACCACAAATTGTTCATCCATTTTCCCACTGACAGATG
GTTGAGTTGTTTGTAGTTTGGGACTATTGCGAAAAACAGTGCTATAGGCATTCTTGTACA
AATCTTTTTATGACAGTGTTTTCATTGCTTTGGGAATGAAATTTCTAGGTCAGGGTGTAG
GTATGCAGTTAACTTACAAAGGCACAGACAAATAGATTTCCTACATTGTTATAGCTTATT
TTCACTTCCATCAGCAACGTATTAGAGTTTTGTTCTATATTCCTCAAAATTTGGTATTGT
CAGTTTTTTTTTTTAATGTTAGCCATTCTAGTTAGTGTGAAATAGAAGTTCATTACGCTT
TTAATTTGAATTTTTCTGAAAACTAATTATTTTTATCATATTGGCTTTGTTGACTGTTGT
CAGATTTTGTTCTGTATATCACCGATATCTGCTCTTAAAATTTCTCTTTACTTCTACTTT
TTTTTGGGGTCTATTTTGTTGTTATTTTTCTCATTTCTAATGTTAGCTAGTTAATTTTTA
GGTTTTCCTTGATGTTAGATGAATGTTTATGTAACATTTCCTCTGAAGTGCCATTTTCTT
GCACGTCATAAGGTTTTATATGCAGTATTTTACTCTCATTTAATTCTAAATATTTTTCAA
ATTTCATTGTTATTTCTTTTTTTGAGCCATAGGTAACCTAGAATTGTTTTTTTTTTCTTT
CCCAATATATGTAGGGTTGATTTATCCTTTTGTTATAATTTTCTAACTTAATTGTGTTTT
GATGTCAGGGAATATAATCTACTCATGTAGATTACCAACATTTAGCAATTTGTTAAGACA
TACTTTCTAAGCTAGTATGTGATCAAGTTTTAGAAATTGTTGGCCTCCTGGTGCTTACCA
CCAACTGTGTGCTTGCATTGACTGTACAGAAAAAAGAGATAGAGTAAACACACCACATAT
ACACCTCAGCCCAGGTCCTGTGCCAGGTCTATATTGTGAATAGGGGGGACATAGAAAAAA
TCAAGAGAGAGATAAATTGTTCTTGTGTGTTTGGGAAAAATGTATATTCTGTAATAAATA
AATATAGAATTCTCTATATGTCCATTTGGTCAAGCATAGTAATTATATTGCTTGTATAGC
TTTGCTAAATTTTTATTGTTTGTTGTTGCATACATATCAGTAGTTATAAAGAATAACTCG
AACTCCTATTTACTAATTTATTCTTGCAGAGCTGCACTGACTAACCTCTTTCTCTAACAT
TTTTAAAATAGCTTTTCATTTTCCAGGGGCTTAGCTCAAGTTTTTTTTTTTTTTTTTTTT
TCTTTCGGTCTATAGTATCCTGGATTTCAAGTTTCCTTCTTTAGTCCTTCAAAGTTGCTT
TTAGAGACAGGAGCCAAAAGCCATCTTTACTGGCACTAAAACCCGTATCACTAACTTTTC
TGTATTAATTGTTTATTCAGAAATCTCTTTTTATTTGGACATAATCTATTTTTTGTATGT
ACAGATTCTTCTGAGATTTTTATGTAAATATTTAAAAAATAAATATGGTGTCTCTTCATG
TATTTATATTCTTTTTCTTTTTAATATTATTCTTGACTGCAACTGCCTATTACATTTTGA
ATAGTAGTAATGATACGGATACCCTTGTATTGTTTCTGGCTTTTAAGATAAAGCTTCCAA
AGATTTATCATTAATTATCATGTTTGTTTTAGTTTTTCCTAGATACATTTAATTAAAATA
AGGAGAACTATTCTTAGCTTGCAAAAATTTTTTTATTTGTTTTTAGAATCATGAATGGAA
ACTGAATTTAATGAAATTATTCTTTGACATATATCAAAATATTCCCTACTATTTTGCTTT
AAGTACATCAATACACCAGTGTTATGGTCTGTAAAAATAGATTTTACAGTATTAAATTAT
CCTTGCTCTTCTGAGACTAACCAATCTTCATTATATTCTTTTTTATTGATATCCCTAGGT
ATGGTTTTCTTATGTTTTGTTTAGAAATTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved