Macaca_mulatta Locus Poly:13:SNORA19
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:13:SNORA19
Macaca_mulatta
Poly:13:SNORA19
9
SNORA19, SNORA19
1001..1129, 1983..2114
3114
TAGAATGGTGTCAGTCTTGTACCCATTTTACATTAGAGTTAACCTTAGCCCTGAGTGCT
CACGTGTGTGGGCGCCCTCCTGACTTGGGGATGTGATCTGCCAACGTTTGCCTCGGTTTT
GTTACCCACTCTCTATGGGTGCACACTTCTGTGCTTTGCTCTGTCCCAGCAGTTAGTCTG
TCCTTGGGTTAACAGTTCCTAAAAAATGACATATTCCATGGTAAAATTGAAGTCTATATA
AATGGGGTGATATGTGAAATTCTTTTTCTCACCGTTATGTCTGTGAGATTTATTCATGTG
TTCTATGTAGTTGTTCTTTTTTGAGCATTTTTGTTTATTTTATGAACACAGCACTATCCT
ATTGATGAGTATGTGAATTCTCCCCAGTTTGGAGCTATTAGAAATAGTGCTGTCGTGATT
ATTTTTGTGTGACAATGTATATAAAAGTAAAATTCCGGTATTTTCCTTGTTATTGGTAAT
AAAATATTCCATTGACCACAGTAGTTGTCTTTGTGAATATTTAATTGGTTGTGGTTGTGT
TTTTTAGAGTTTTCTTTTTGCATACCTGTGGGGCTTTTCACTGTAGGTTAGTGTGCATAG
CGTGGGGCAAGAGACCCAGCATAGTTGTACTTTGGATTCATTTTTGGTAAATTTAGAGGA
GATTGAGGCTTGGTGATTTTTTAAATCGTTTTCCAGATTTCCAATGCTATCATTTATACT
AAGTTCAGAATTTTAGTTGGAAAATTTCCTTTGGCAGTTACATCTTTTGTTTTGCTTACT
GTAGGTCAGATTTAATGTACTACAATATGTTGTCCCAGAAGTGAAAGACCTTTACAATTG
GCTTGAAGTGGAATTTAACCCATTAAAACTCTGTGAGCGAGTCACAAAGGTAAGCCTTTG
TATTTTAGTTTTGGTTGTTACCACACAGTTGGCCTTATTGCAGTTTTGGGTTGTATTGAT
ACTTGTTAAGAGAGAAGTTTTGTCCTATGTGTTGGAATTCAGGGCACATTTCATTGTCTT
TTTTCTTTATTTCAAGAGGAAAGATATTTCTGATGTGCTAAACAAACATTTGGAGGTTAA
TTAGCAGCATGACTAATTTAGTCATTGCTGCCAGTCACCTTCAAACAAGTATCAGTAGCT
TCATGATACATTTTGTATTTCTTTGCATTGGATGATGTTTTTGTATATTAAAAAAACTGA
AAGAGTTTTAGATGTTTTAGTATCTATTATGTAGAAAGTATGATTCTCTTTCAACTTAAT
GAATTTTATAGGTTCTAAATTGGGTTAGGGAACAACCTGAAAAGGAACCGGAATTGCAAC
AGTATGTGCCACAACTGCAAAACAACACCATCCTCCGCCTTCTGCAGCAGGTAAAAATAA
AGTGTTTTGTGGAAGAACTAGAATTTCCTTGATTGTATGTGCTCATCATGAAACTAAAAA
CTGGAAAAATCTAGACCTGCCTAGGAAGTGAGAACCTCCCCATGTTCTGCCCCTGCCAAA
AATTAGTCTATTTATTAATTTGAAAATCAGAGTTATTATATTCACGTATTTTGTAATGCA
CTTTTTTTTTTTGGTCAAACACTGTCTTTGGGCATTTTTCCTTGTTAGTAATGTACGGTC
TACCTTATTCCATTTAAGGTACCGTGGTGTGTGTATTCAGACTCTCTTGATGAAAACCTA
TATTATTAGATTTTTTTTTTTCTTGTTAGAAGTCTTGTAGCATTGATCATCTTTCATACA
TGTATCTTTGCACACTTCTGTTACTTTCCGTGGCATAAGAAGTGGAATTAGTCATAGTGT
TTATGGATTTAAAGCTTTAATAGCTATTCAGAAGCCTGGATTAATAGATCCTCCCACTGT
GAGTGAATAAGACAGCCTTTTCATTTATTTTAGTCCAGGGGCTTAAGTAAGTGCTCCCAT
TTTGTTTTCCATTTGTTTCATTTGGGAAGGAGGGCCTTTTATTATATTTTCATCTCAGTA
TTTGTGCACATGTCATTGACCTGCTTTCTTCTGTATATGTGAGCAGTGTTATTTCTTATG
TGCTATACAAATAATTGAAGGCTAATTAGCAGTATAACTATAAAAAGTAATGCTGCCAGT
CTCCTTCAGACAAAAATTCTATAAGAAGTGTTTAAATATATTCGGTAAGTAGCAGGTTTT
TAGGCTTTTTTGTTTTACGACAACTAGGATTTGAAAAGATTATAGGTTTGAGAATAGTAT
GGTAATGGTTCTCAAAGCATGGGGTTTAGAGTTGATAGTCTGGGATTAGCATTCTGGCTT
TGACAGTGTACTGCTAACATAAATTATCTGGCATAATTTCTACTTCCCATGACTGTCATG
AGATTGCACATAAAAAGTGCTGAATAAATAGTGACTCGTGTTATTAACCCTATGTTTTCT
ATGCAGGTGTCACAGATTTATCAGAGCATTGAGTTTTCTCGTTTGACTTCTCTGGTTCCT
TTCGTTGATGCTTTCCAACTGGAACGGGCCATAGTAGACGCAGCCAGGCATTGCGACTTG
CAGGTAGGTATGTGCTGTAAGGAGATAGGAGAAGGCCCTTGAGGACTAGAAAAACACGTA
TCTTTTGTTTCTCGGCTTTTGGTACAGTGATACCATTTTAAAGTTTACTGAGTGAACTTT
TCCAGCTTTTGTATATGACGTTCTTCTGTTACTTTTTGACTTCATGCTTACTTATGGATT
TAACCATTGATAATTTAATTTTTAAGGTTCGTATTGATCACACTTCTCGGACCCTGAGTT
TTGGATCTGATTTGAATTATGCTACTCGAGAAGATGCTCCGATTGGTCCTCATTTGCAAA
GCATGCCTTCCGAGCAGATAAGAAATCAGCTGACAGCCATGTCCTCAGTACTTGCAAAAG
CACTTGAAGTCATTAAACCAGCTCATATACTGGTATGCATCTTCCCGGGGAAATAAATCC
CAGAAGTTTTGAGGGACTCTTGGGCCATGTCTTTCACAAAGAGGTTTGAGACAATATCTG
AGAGAAGGGATTTATGATATATTTCCTATATAATTGTACTTGGTAGTTTTGTTATTTGAT
CAAATACACAAATCATTGAGCTTTCTTCCGTCGAACAAAATACTTCTCTGTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved