Macaca_mulatta Locus Mono:247:SNORA70
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:247:SNORA70
Macaca_mulatta
Mono:247:SNORA70
3
SNORA70
1001..1135
2135
CAAGAGTAGCCACTGGTGCTGGCATGTTCTCTACCCGGGAAAGGATCTTAGATAGTGCC
TGGTCAGTTTTCCAGTGGATACAGGAATCTCCTCTACACTGAGAATAAACCCAGACGCCT
TGGTAAAATCATCCTACTAATAATACCTCACAAATAACACAGCCTTTTACCTTGAGAGTT
GGGAAATCCTGGTTTTTACCCTAATTTATTAAACTCTGGCAGGATGATACAGTATCGTAG
GGGTGCTATTTTACCCTTCATAAAATAGACATGGGTTCTACCATGTCTAGGTTTCTGCAT
AGGCCTCAGAAAACTTCCAGTGATGGCACACGGTGGAAAGCAGGCACATCACATGGCTGG
AGTAGGAACAAGAGAGAGAGGGGGAAGGGGCTACGCACTTTTAAACAACCGGGTCTCATC
AGAACTCACTCACTATCCTGAGGATAACATCGAGGGGGTGGTGCTAAACCACTTACGAGA
ATTCATGAGCACTCATGAGCCAATCACCTCCCACCAGGCCACACCTCCAACACTGGGAAC
CTCCTTCCTAGCAGTGGGCAAAAAGCAATAAATCACTAGGTAGCCAGGACAGTTCAATCC
ATGAGTAGCAATAGAAGTGACCTCAAAATTCCAAGTTACTTTTCTTAACCAAACGAAACC
TTTAAAACTTCAAATAGAGGAAGTTGTGTCAACAATTGCTAAGGTCATTATTTGTTGAAG
AGATTATTAGTAAAAGGAAGATTTTATAAGAAATGGAACTCACCTACTGGTCTGATTAAG
AAAATTCAGCATGGAAAGACTTCAACCAGAAAAGTGAGAGAAATATTTCATTCCTGCTTG
AATAACAGGGACATTTTAAAGGAAAACATGAGTGCCACAGAGTGGAGACTGAGCTCATCT
GAGACAAGACTTAGATCATGTCCTTAGCTGTGGCAGGATGAGGTGACTCCCGGTATAGGA
TTCACGGGGGTTGGCGACTGTATTAGTCTGTTCTCACATTGCTGCAGCCAATTAAGCTGA
GTGAGTTCTTTTCCTCATGGGGGCCAGGTGTGCAATGACTGCAAACAGCTGCTTCTTTGG
TAGTGTATGCAGCCTGTTTCTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCCTT
CAGATGGATGTTCATGTCTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATG
CGAGGTACCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGTACCATGGTTA
TCATGTCCATCTACACCAAGCTGCAGAACCAGGAGCATGTGATTGAGGCCCTGCGCAGGG
CCAAATTCAAGTTCCCTGGCTGCCCCAAAGATCCGCATCTCAAAGAAATGAGGCTTCACC
AAGTTCAATGCAGATGAATTTGAAGACATGGTGGCTGAGAAGTGGCTCATCCCAGATGGC
TGTGGGGTCAAGTACATCCCAGTTGTGGCCCTCTGGACAAGTGATAGGCCCTGCACTCAT
GAGGGCTTCCACTGTGCTGCCCCCTCTTAATATTCACCAATAAATCCTACTTACTGTCCA
AAAAAGGAAAAAGAAATACCCAAGAAGGGATAATTTACAAAGAAGAGTTTTGAGGCCAGG
CACGGTGGCTCACGCCTGTAATCCCAGCACTATGGGAGATGGAGGCAGGTGGATCACGAG
GTCAAGAGTTCAAGACCAGCCTGACCAACATGGTGAGAACCCCATCTCTACTAAAAATAC
AAAAATTAGCCTGGCGTGGGGGCAGACACCTATAATCTCAGCTGCTCAGGAGGCTGAGGC
AGGAGAATTTCTTGAACCTGGGAGGCAGAGTTTGCAGTGAGCTGAGATCGCACCACTGCA
CTCCAGCCTGAGTGACAGAGTGAGACTCTGTCTCAAACAAAAGAGTTTTGATTGGCTCAC
AGTTCTGCACGCTGTACAGGAAACATGATGCTAGCATCTGCTCAACTTCTACAGAGGCCT
CAGAAAACTTCCAATGATGGTGGGCAGTGGAAAGCAGGCATATCACATGGCTGGACTAGG
AACAAGAGAGAGCGGGGGAAGGTGCTCCACACTTTTAAACAACCAGATCTCACCAGAACT
CACCCACTATACTGAGGACAGCATCATGGGGATGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved