Macaca_mulatta Locus Mono:211:SNORA62
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:211:SNORA62
Macaca_mulatta
Mono:211:SNORA62
14
SNORA62
1001..1153
2153
CAATTTCCCCTATGATTTTAAGCCTGCAAAGAAATATACAGTGTTGGTTGAATGTTATC
TGTAGGCTGCTAGAAATCGGGAATTATACCAGAAACTGCATTCCACATAATAATGCTTAT
TGGGACAGCAACCATGAGCAAGCCCCATACATAGATTTTAAGAAAAAAAATAAAAACTGA
AGAGATCTTGTTTTGCGCTAGAGAGTATATAAAGAAAAAAAAATACTAGCATGAATCTTT
AAAATATTTCATTAATAAAGGAACAACATCTGGAAAATCCAGAGCATGAGCATGTATGAA
GAAATGTAATAATGTCTGTAAACCATGTAGCATATTGCCTGTCACATCACAATGACTCAG
TTATCAGTATCACAAAGGTAAAAACTTCTGCAGAACTAACAAGAAAACATCCTTAAGGTA
ATGTAGGTAATAGCGTCATATAGCGTTATGGAAAAACAAAGAACACATTGGAAAAATATC
AAAAGAATACAATACTAAAAAATAGAATTAAAGTACACATTGGACATAATCAAAAACCAG
AGTCAAGGGACAGTAATTAACTTAGTTCAATTTGGAGAATGCATTTGAAAAATTCTCTCA
TAATGCATAGAAAAAATACAATGAAAATAAAATAATGAGAAAATTGAATTTGGGAATGGC
ACAAAATGAAAAGCCAATATACAAATAACTAGGGTTTCAGGTACCCAAAACAAAAATAAA
TAGAATAAAAATGACTGTTCCAAAGGAAAGGACTACAGTGTATTGAGGATGAAAAAGCTC
ATTGCATTCCAGGTAAAATCAAGAAGATGAGAACAAGCATACAATATTTGACTTAAATTA
GTTTTTTAAAAATTACAAGCATTCAGGCAGAAAATATGGATTTCCTACAAAGAAAAGGAA
ATTAAGCCAGTTTTACAAAAATATTAAAATATTTAAAAAGACCTTTATACAACATGCTAT
TCCTGATGCAGAAATAATAAAATATGTTAAAACAGATGAAGATTGCACATTGTTGGAGCT
TGGAGTTGGTGCCCTAACTAGCTGACAAACTTGCAAGTGTAGGTAGTGTGCTATGTGAGG
GGCAAATTTTTCACTAACACGACAAAGGTCTTTGGCCTAGTGAGCAGAGTTTGACAATAA
TCCTTGCTACAAGTATAATGTTAAAAAAAAATTACAAAAAAACACACAACTAAGACACTG
ACGACTCCAAAGCTTTGCTGAGAGATATTTTAAAAGATGTAAATAAGTGGAGGGATATCA
CATGTAAATTAATTAGAAGACTCAATAGCATGGACATGGCTGTTTTCCCTTCGTGAATCT
ATAAATTTGATGTAATATCAACAGGTCTTTTTTACTGTAAAAATTGACATTCTACAATTT
ATATGGAAATGCAAAATACTTACAATTTTGAAACAGAAGAAACAACCTGGAGTGCTTACA
CTACCAGCATTCAAAACTTAACATTAAACCAATGCAATTAAGACACAGCATGAGGACAGT
CATACAGATTAAAAGAACAAATTGGAGAGTCCAGATTTAAACACGTACATTATAGCCAAT
TGATTTGTAACAAAGGTGTCAAGACAATTAAATGAAAGGATAGACTTTTCAACAAATGGT
GCTAGAACAATTAAATATCACTACAAAAAAACACACAAAAAAACCCAAAAAATAAAGAAC
TTGGATTCTTAGCAATCACTGTTCTGAAAAATTAGCTCAAAATGGATTATAGACCTAAAT
GTAAGAGGTAAAAATCAGAAACTTCTAGAAAAAAAAGTCGGAGAAGATTTTATGACCTCG
GTTAGGCAAAACATTATTAGATGCCATATTAAAAGTGTGAGCCACTAAAAAAAGATCAAT
ATCTACTTCAAACAAAAAAAAGGTACATTTTAAAAGTCACCATTAAGAAAATAAGAATAC
AGAAAACAGACTAGGAGAAAATATTTGCATAAAAACTCGTACACAAAAAATATAAAGAAC
TCTTACAACTCAACAAAGAGACAAACAATCCAATTAAAAATGGGCAAAATATTTGAATAG
ACATATCACCAAAACATATATAAATATGACTAACAAGCCCATAAAAAGATGAGAATTAGG
AAAATAAAATTAAAATAAAAAAATAAAAATTTAAACTGCTATAAAATACCATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved