Macaca_mulatta Locus Mono:189:SNORA67
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:189:SNORA67
Macaca_mulatta
Mono:189:SNORA67
8
SNORA67
1001..1141
2141
AATTACAATAATTTGCAATTACCCATTAAATCACCTTTTTTCCAACAGCAGCACTGTCC
TCTCTGTTCCACACGTTCCTAATGTAACTTGAGAATAATGTTTTTTTTCCAAGGTCTTGC
ATCAGTCGGGGCCCTATTTTATCCCATCTAATTTCTAACTTTCCTCCAGCATACCTTCCA
GTTCACCTGAGCTAAAATTTCTTCCTTTCTACCCTCACCCCTCTCGCACCCTTAGTCTCA
TCTGTCTCATAAACACACATGCACACCATACACAGGTACACGTGTGTACCTTTATACAAA
CATGCATACACATACATGCATACATACATAGGTACACACATGTACCTTTGTACCTGGCTG
ACAATTGCATTCCCAGCTCAGATGCTTCCAACCCTTTGTCTATGCAAACTCTACTCATCT
TCCAAGCCTTGCAAAGTTGCCTTGTTTCCAAAAACATTCCCTAATTTGCAAGATACTCTG
CTAGGCACAGTTAAAGAAAAAAGATTAATTCTACATAGCCTCTATCCTCAAGGAGCTGGT
AATGCTTATTGGTTCCTTCTCAAAGATACTAGGACATTTCATCTCACCACAAGTGCTTGA
TTATATAAAGAACATCTTGCTATTTTCTATCTCAACCATGGATTGTTAGAACATAAATCA
TATATTATTCTCCATTTTGCTTTGCTATTCCAATTTAGAGGAGGAGTGGCTGACAGGGGA
AAGAAGACATGAACACAGTGAAGGGCTCGGGTAATAATTTCAGTAGCCTTCAATTCTGGG
CCTAGGCCCAAGAGAATAACCAGGACTCTAAGTCACCTAGGGAAAGAATATGTATCAAGG
CCCATGTACCATATGGTTAAATATTTAATAGTATAGATCAAGCTAACAAATAAAATATGC
TCTCTCCTCTTATCTTGATGAATATTCCCTCACAACAATAAAATTGAAAAGCGTGTGTAA
AGCTAGGGTTTTAAATAACTAAAAATCAAAAAATATCAACAATCCAAGGGGACTCCCTCT
CCAAGGGAACATGCAGTACCCCTCTCAGGAAAGTACTAACTTAGAATAGAATCTAGCATG
TCTAAGGTCTTTGGGGAACAGGGGATGCTTATTTCCTCTGCCTTCCTTGGCTGCCTACAT
GGACACATAAGTCTCTTCCCTTCAGGATAGATTGTCCTCTCATGCACATGCTGAAGAGTT
GCCTTTCTTGACATAGGCCAGAGGCTCTGATGTACAGTAGGTTTCTTTAGTCATCAACTA
TGACCTTCCCATCAATAGGGAAAAGTATATCCACAGAATCAGTCGAGGTGGACGGTTTGG
CCATAAGGGTGTGGCTATTAACATGGTGAAAGAAGAAGACAAGAGAACTCTTCAAGACAT
TGAGACTTTCTACAACACCTCCACTGGGAAGATGCCCCTCAATGTTGCTGACCTCATCTG
AGGGGATGTCCTACTACCTAGCCCCAGTCAGGGTTCAATCTTGGGGGGCTGAGGAGCAGC
AGGAGAGGGGAAGGAAGGGAGAAAAGAAGTGGACATCTTGTTTTTTTCTTTGAATAAATA
TCACTTTTTGAGGCAAAAGAAATACATATATATGTGTATATATATCTCTCAACAATGACT
AAATATAATTATTATTGTCTTTTCCTAATGTTCTGTTGTTGGGCTAGTAGCAGTGTGTAG
ATAAGTAATAAAAGCAAACATGGTTCATAATTACTACTTATTTATTCCATAAGCTTTATT
TTCCTTGCCTTCATTTCAGCAAAATCACTGTTATCATTGAGATTTTCATGTTTCATATTC
TATTGATAGTAATGAGATTTTAAAATATATTTGTATCAAAGTTTACAAAATTTCAATATA
TTTTCAACAAATAGTAAATTTCAAAAAATAAAAAGTTTATTTTTATAATATGTTTCAAAA
AGGTATTTTTTCCAAAGCACACAAAGTAATCCATTAAAATTAAAAGACAAAAAAAGTAAT
TTAAAATATCAAATTTAAGTCAAAATTATTTAAGTAAAGCTGAATTTTATTTAACTTTTT
TTACTTAATTATATCTTACTATGTACTTTATAAAAATAAATTTATTCCCAATTCAATGTC
CATCTACTTGCCAATGAAGAATTAGTATTACATTTCACAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved