Macaca_mulatta Locus Mono:27:SNORA71
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:27:SNORA71
Macaca_mulatta
Mono:27:SNORA71
10
SNORA71
1001..1116
2116
ACAGCGTCTTCCAAAGAGTTGGTGCCCGGAGTCTAGGTGAGAAGTCAGCAACTGACCAT
GCAAGACCTGCGGGAGCTCCAGACCCATCTCTGCGCCAAGAGTGACCACCGTGCTGCAGA
TTTCGTTGTTATCTGTCCATTCTCCTCCTCGGCTTCTTACTGCTCCTCTGTTACTGTGTC
TTTCAGGAGTCCGTTTGGGTGATGAGCGCTCTCTGGGGGCACTATGGGGGCATCCATGGA
GCGTGGCAGCAGAGTGCTGCAATAGAAAACAGGTAGATGGGCTGGGCCAGGTGACTCACA
CCTGTAGTCCCAGCACCAGGGAGGCCAAGGCAGGCAGATCACTTGAGACTTGAGGTCAGG
AGTTTGTGACCAGCCTGACAAACATGGTAAAATCCCATCTCTACTAAAAATAGAAAAATT
AGCCAGGCATAGCGGTGGGCGCCTGTAATCCCAGCTACTCAGGAAGCTAAGGCACAAGAA
TCGTTTGAACCTGGGAAGCGGAGGTTACAGCAGGCCGAGACTGTGCCACTTCACTCCAGC
CCGGGTAATACAGCGAGACCTTGTATCAAAAAGTAAAATAAATAAAATAAAATAATAAAA
GTAAATTAAATTTAAAAATAAAATATAAAATAATAATAAAATAAAAATGAAGGAGCATCA
GAGATACTCGGGTCCCAATCCCCTCTGCCATGATCTAGCTCTGGGCCCTGCTTTTCACCT
CAGTTTACTCATCCCAAAAACAAAGCTGTGACGGAAAGGAATTTCCACTATTGTTGTTGT
CATTGTTCTTATAAATACAATCCTGATCTTTTCCAAAGCCAGGATTTTTTTCCTCTCTTT
TACCAGCAGCGTGTTCCCTTTCATTCCCTGGCAGGGAAATTTGCCCGGGTTTGGAGAACA
GGGTGGCTGTTGCTGGGCTCCGTGCTCACCAGGCTGCTCTTTCCCATGCTGGCCATTGGC
ATCTGCCTCCCGCCCTGTGTCATGCTGTGCTCTCTTTCTGTGTCTGCATTTGAAAGCGAT
CATCAGCTGCCTATTGATGCCTTGGTCATCGATAGTACAGGCAGTTGAACTGCACAAAGC
ATTCTCCGTGTTTGGAAACGCTGGTGCTTTTCTCGCATTCGACTTCTCTTCTGTGAACAC
TCTCAAGCCTCTGGGGCATTGTGCGCTGTCATTTTGTTTGGCCTTTCTCAGCTTGACTTC
TTGGCAAACATTAGGCTGTGTATATCCGGGACTATTTGTTCCCCAGGACGAGGTTAACTA
CTCAAGGGATGGCTGAGGCTCACAGAGCATGAGCCCTGCACAGAAGAGGTAACATTCACC
AGCCAGGTGAATTGTATAAAAATTGGGTATAGATCCTGATTATGATAGGATTTCCAAAGA
AAGATGGCTTCTTGGAGGTGGTGTGCTTTGGTGGTTTTCTGTTTGTGTTTTGAGACATGG
TCTTGCTCTGTTGCCCAGGCTGGAATGCAATGGCATGATTAGAGCTCACTGCAGCCTCAA
CCTGCTGGGCTCAAGCGATCCTCCTGCCTCAGCCTCCGAAGTAGCTGGGACTACAAGCAC
ATGTCACCATACCTGGCTAATTAAAACAATTTTTTTTTTTTTTGTAGAGATGAGGTCTCA
CTATGTTGTCCACGCTGGTCTCCAACTCCTGGGATCAAACGATTCTCCCACCTCAACCTC
CCAAAGTGCTAAGATTGCAAGTGTGAGTCATTGTGCTTGGACCTTGGTGGGTTTTTCTTT
TTCTGGAGACGAGGTCTTGCTATGCTTCTTTGGCCTCAAGGGATCCTTCTGCCTCAGCCT
CCCCAGTAGCTGGGACTATAGGTGCACACCAGCGTGTCTGGCTCTTGGTGGATTTTTGAA
GTACTCAAATAGGAGTCCTTTAAAGTTGCAATGGGAAGGCTCTTAAGGGTTGGGGGGGAG
AAAGAGGAAGACTCTGAAGCTGAAGAGGAGGAAGGGATGGGGAGTGGACACCTGTGCTGG
TATGTGGATAAGTTAGGAACCAGAGGGGGCAGTATCTCCCCATCTCATTGTGTGGCCTGT
AATAGATGACCTTTAAATGTTGATGCAAAAGAAGAAAGGGAAATGTTCATTGTGGCAACA
GGAGAGGGCTCACTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved