Macaca_mulatta Locus Mono:231:SNORA16
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:231:SNORA16
Macaca_mulatta
Mono:231:SNORA16
X
SNORA16
1001..1132
2132
AACTGGGTTGCAGCTACCTGAATTTTTTTCAAAAACCTCTTATTATTATAAAAATAAAC
AGGCCCAGAGCAGTGGCTCACACGTGTAATCCCAGAACTTTGGGAGGCTGAGGTGGGTGG
ATCACCTGAGGTCAGGAGTTTGAGACCAACCTGGCCAACGTGGTAAAACCCCGTCTCTAC
AAAAAAAAAAAAAAAAAAAAAAAATACAAAAAATTAGTCAGGTGTGGTGGCAGGTGCCTG
CAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCACTTGAACCTGGAGGCGGAGGTT
GCAGTGAGCCAAGATTGTACCATTGCACTCCAGCCTGGGCAACAAGAGTGAAACTCCATC
TCAATAAAAATAAGTAAAGCAAAAAAGATGAAAAGTTATACCTGATGTAAATGACGAGTT
GATGGGTGCAGCACACCAACATGGCACAAGTATACATATGTAACAAACCTGCACGTTATG
CACATGTACCCTACAACTTAAAGTATAATAATAATAAATTTAAAAAAAAAAGAAGAGTTT
AGCTATTCTTAGCATTTGCAAATAAATTTTAAAGTCAAAAAAAAAAAAAAAAAAAGAAAA
TCCAGTCCGAGCACCAAACAACCAAACAGACCACACAACCTTCCAAAATGCTCCCACCAA
ATTCCAAAGCCATGCCCTAGCAGCACTTACTGAATGAGCCCAGATGTCTGATCAGGTTCC
GTTGGTAGAACACAAGGGGGAGGATGTCAGCTTGAATTGCATTAGATTACTGGCCATGAT
ATAATGTGGAGAACTCATAGGAGCACTGCCCCCCAGGTCAGCCCTGACAGAAATAGCCAG
AGCAAAGGAAACTAAAAGCTAGGCATGGGCAGGAGAGACAAGAACAGACCTATGAGTCAA
CGATTTGGTGGCAAAGATGATTCGTGAAGAAGGTGGGATGTGGGTTGGAAGCTCTGTCCC
ACCACTTCCCAGTGAATGAAGACACAGAAATCTCCATGCTGGGCGGCTCTCATCGCAGCT
GCAGCTGCTTCCACATAGCTGCTGTGGTCAAAAAGAAGCCCAGAGTCAGTTCCCTTGACC
ATCACCATTCTGTTTGCTATAACTGATCTGTAACATTTTGGGAAAATACAGTTCCATTGA
AAAGAAAAAGAGAAAAAATCTCCAAGCTGGATGTTGGGTCTGCTGCATTCCTGGGTCTGA
CATGGAAGCTGCTGCTCCCCTAGAACACGCCCTTTCCCTCCTGCTCAGAAAGCTGCTGTG
TAGCTGTCCCTGTCGGCCCACGTGTGCTCTTTCCTCAATACCATAACCATCTGCTTTCTA
GCTCCTCTCCTACATCACCTCACTCCAGTGTGGTGTTAGTGGCCTCTTAGCAGGTCTCAG
GTCTACTCTGACAACAGAAATCAGGAATGAACAGAAGGGGGTGATTAACTCCTCTGCTTA
AAAGCCTGCAGAGATGACCTGCTGCCTAACAAAAAAAGTCCGCCTTCTCCACCTGGCCTT
CAGAAGCCTCGCACCCCAGCTTCCTCTCAGCAGGCTTTCCGACTGCACATGCTCACTCCT
CAGGGGTAAGATGTGTGTCTTCTTCCCAGAACATTTTTCCCTGCTCAGATCCTCCAATGT
ACCTGCCATACCCACAGCCATGACAGAGGGCACCGCCCATTCCCATGCTCTGCTGCAAAG
GTGGGCCTGGCAGCCTTGTGTGGGCACCATGACCCACCTCACACCTGGTGTCACCTGAGT
GGGAGTAAGGGTTGGTGGGCACACAGTATACTGGCCTTTGGGATGCTCTGACAAGGGCTT
AGGTCAGATGCTCATTCTTGGGAATGTGGATGAGAAATATCAAAGCCAATGAGCAAAGAA
AGTAGATCCTAAACAGATGCTCAGTGGGGTCGTGGTATAGAGAAAGGGTAGGTGGGGCTT
AAAGTTATGAGGGCACCAGAACCAAGCATCAGCAGAAGTTGGGAGGTAGGTACACAAAGG
ACACAAAGCCAGCAGGGCAAGAAAGGCTGCGGAAGCCTAAAGATAAGTGGACAGCGGAGC
AAACTTAACGCAACCAGGGCAAGGCCTGTTAGCAGAACAAGCATGAACAGTCAATAATTC
CCACCCCTACAGACCTGTGGGCCACTCCTTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved