Macaca_mulatta Locus Poly:9:SNORD50
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:9:SNORD50
Macaca_mulatta
Poly:9:SNORD50
4
SNORD50, SNORD50
1001..1070, 1332..1404
2404
TGGAGCAAAAGGTGGAGGTGCAGGCCGAGTTAAGAGTTTTGATAGTGTGAAACCATCTT
AGTGTAGAGCTTAGGGTGCTGAGAGTTGAAAGCTTGCACGTGGGAAATGTGCAGCCCGAC
CGCCACATGTACTGAGATTGAGTCGTGACGGCCACAGGCTCCGAGTTTTGGCGTGAGGAG
AACGCTGATCGGCCACGGGTGCCGCGCTTGCTGGCCTCTGGCATGTGCCTGAACGGCGGC
AGAAAAGCCACACTTAATTGGGGCAGAGGGTTAGTTTTAAGAGCAAGGGGCCTTTACTAA
AATGGCGAAGACCTTCCGTCGGCGTTGTTTTATAACGGGCAGCCTCAACCCTGCATTGAG
ACTGAGCTGTTCGAAGGCGGCGTTGTGTGCAATTCGGATTAATGAAGGGGAAAGGTTTTG
TGTGGAAAAACACCTTGGAGTGTGACGTTTCTGCGAGAATGCTTATCGGTTTCCCGCAGG
AACAATGGCGCTGTCATGGCCCAGCAGAGCAGCTCTGAAGATGCAAAGGTAAGAGCTGTT
AAGCTTAGTTACCAAACTAAAGGAGTAAACCTGTTGATTTACAGGAATAGGAACTGTTGC
ATCGTTTGATACTTACTTTTTTTTGTTAGATACATGAAAGAATTCCAGAATATGCGGGAG
AATATTTAATGGAAAACCGCTTGGTTAAACCTGACACTCTTCATGGGTATGTGTTGTTCT
AGTACTTTATGATAGAGCATAGTATTTAATCCACACCTAGACTAAATCAAATTTTTTTGT
CATTGAACAGCATTCTGGGTGTGGACGATCAGCCAGTGAAGATAATGAATGTCGGATGTC
ACTGACTAGCAGCTTCATTTTGAAGTAGGTTGTATGGCTTAAAAGTTCTGTAGTATTTGT
ACTATAATACTTGCCTTTTACCTTTACCTTGGCTTATGGTCAGTGTCACAAAAGTGCAGT
TTAATGTGTTAATATGTACATATACAAGGTCTGATTGGTCTAATCAATGATGAAACCTAT
CCCGAAGCTGATAACCTGAAGAAAAATAAATACGGATTCGGCTTCTGAGATTAAGACCAA
TAATTCAGAAGTGGAGTAAATTTTGTTGACGGGATTTTATAACAGTTCTGTTATAAAAGA
TCCGTAAAAGTTTATAACAGTTCTGTTATAAAATCCCGGGTTGTTGTTTTTTTTTTTCTG
CCAACAGTGAGGGTCGCTGTCTGCCCATTGATAAGAGGCCAGATTGTCTTGGAAGTTCCA
AAGTTGCAACTATTTCTGTAAGTGGAGTTTTTCTGTTTGCTTAGCGATTAGTGAATATTG
TGTCCTTGGTCTTATCTGTGATGATCTTATCCCGAACCTGAACTTCTGTTGAAAAAAAAA
ATTTTACGGATCTGGCTTCTGAGATGGACCATTATAAGGACAATACTTTTTTTTAATGCT
TTTACATAAGCTGTTGTAATGTTGGTAGTCTTGTAAGAATCTCATGTTTTTCCTTTTCTA
GGGCTAGTGCCACGAGGTTTACTTGACTGTTGTATGAAAAGCTGATAAGAAAACCATCCA
GAAAAAAAGCTCTTCGTTTTACAAACACGAAAATAAAACACGTAATTTTGGATTATGTTG
TTTTTAATTATTTTAAATAGGTCCTGAAATAACATGGTGGGCATTAAATGGAAAATCCAC
TGCTATCTGATACTACCAAATAAAATGAGAGAGAAGCCTTAGGCATGTAACATTACATTT
GGAGATAGAAAATACACCTTCACTATGAAGGTAGTGTGTGTAAGATAGCAGTGAAAGCAG
TGTTTGCATTTATACCCTTGATCTCCGATAACCCTTGCCTGCTAGACATAAAACTATTAA
TCATTGTTTTTCTCCCCCTTCCAGAACTTCTGCATAAAATTTTAAGATCTGTGTTTCATT
ACTTCAAAAGTGCCTAGAATAGGGCCAGGCACTTACTGTTATAGAATATGTGGTAAAAGA
CTATTCATATTCCACAGTTTTCAGGGAAGAGTGCCATTTCCCTTTTGTCAAAGCTGGCAA
CCAAGACAAAGTTGTGAAATAGACTATTTGCTTTCGAGCCCTCTGACCTCTTTTTCTGTA
GCTCCTTCTAACTCCCTTGCCTCCCAATAGATCTTTTAATATGTCACATTTTCTTAGTTG
ATATCAAAATTAGTACTCCACATTTATATACACTGGCCTGTGCTAGGCTCTGCCAAGGCT
CCTGAAATAAAACACCATTTTGTCAATAGTGGCACAGGATGCCAAGGAAAAGTCAAGCTA
TGAAGAATTCTTGAAAATAGAACAAGTGGATTTGAGTTTAAACCAGCACAGATGTTGGGA
AAATAGGCCCAAGAAATACTGAGCAAAGACAGTATGGTTCAGAGTCTGAGAGACAAATAT
TGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved