Macaca_mulatta Locus Mono:95:SNORA61
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:95:SNORA61
Macaca_mulatta
Mono:95:SNORA61
1
SNORA61
1001..1130
2130
NNNNNNNNNNNCACACACTAGAATATTATGTAGCCATGAAAAGAAGGAAATTATGATAC
ATACTATAGCATGGATGAACCTCAAAGACATTATGCTAAGTGAAATAAGCCAGTCACAAA
AAGATACATACTGTATGAGTCCACTTACATGAGGTACTGCTACTTTTTGTCCTTGAGTTA
GAGAATAATCTAACTTATAGGGACAAAAAGTAGAATGGTGATTGTGGGGAAGGGTAGGGA
AGGGGAAAATGGGGAGTTATTGTTTAATGGGTGATGTGGTTTGGCTGTGTCCCCACCCAA
AACTCATCTTGAATTGTAGCTCCAATAATTCCTACATGTTGTGGGAGGGACCTGGTGGGA
AATAAATGAATACCATAGTATTCTGTGGTAGTGAATGAGTCTCATGAGATCTGATGGTTT
TATGAGGGGTTTCCCCTTTTACTTGGCTCTCATTCTCTCTTGCCTGCTGCCATGTAAGAC
ATGGCTTTGCTCCTCCTTCACCTTCCACCATGATCGTGAGGCCTCCCCAGCCATGTTGAA
CTGTGAGTCCATTACCAGTCTTGGGTATGTCTTTATTAGCAGCATGAGAACAGACTATTA
CAATGGGTATAGAGTTTCAGTGTTGCAATATGAAAAGGGTTCTGGAGATGGATGGTGGCA
CTGGTTATACAACAACATGAATGTACTTAATGCCACTGAAGTGTATACTTAAACATGGTT
ATGATTTTTAAAAACCAAAAAATGGTTATGATGTTGTCTTAGTTCATTTTCCATTACTTA
TAACAAAATACCTCAAACTGGGTAAATTATAAGAAATGAAATTTATTTCTTACAGTTTTG
GAGGCTTTGAAGTCCAAGGTTGAGGGGATGAATCTAGTGAGAGCCTTCTTGCTGGGGGTG
CTCTCTGCGGAGTCTTGAGGTGGTGCAGGGCATTGCATGTAGAGCGGGCCAAGTGTGCTA
GTTCAGATCTCTCTTCCTCCTCTTTAAGCCACCAATCTCTGATCCTCTGGTTCCTTTTCC
CATTGGATCTGAATGCTGGTCTTGGTGGTTGTAAAAGGAGGAAAAGTAACACTGAAGGTG
GCTTCGCAGTCTTGTAGTCTGGCATATCGTTTCCACAATGGTTTGAAATAATAATAATAA
TAATAATAATGCCATAGTTCCATTCCTGTGATAACCCATTAATCCATGAATTAGCTCCCC
ATGACCTAATCACCTCTTAAAGGCCCCACCTCTCAATACTGCCACACTGGGGAATAAATT
CTGACATGAATTTTGAAGGGGACAAACATTCAAACCATAGCAGATGGTAAACTTCATGTT
GTGTGTATTTTACCATAATTTCTTGAAAAAGCCATTAGAGCCACCAGTCTTAATTTGGAA
ATCTTTAGACTGTATAGGTGACAACTAAAGTCATGGTCTCATAGAAAGCGAGAACAGTAG
AGGAAAACTACTAGTTGTGGGGTTGGCAGAGTAAAAGGAAGGTGCAAGGGGGCCTGTGAT
ATCAGAAGGAAAACAGGAAGGAGTGGTAGCATCGAAATGGATGAAGGAGAGCTCATCTTA
GGGTCAGAAGCTACAGACACATCAAGAATGAGAAGGACTAAGAGGAATCCTGTATTTAGC
GACAGAGAGAGTGTTTATGACCTAGGTGGGGGCAGCCTCAGGGGAGAGGTGGGGTAGAAT
TCAGATTGCAATGGGGTGAGGAGTGTGTGAACTGAGGAAGTAGGGAAGAGTGCAGCATCC
TGGAAGCTTGTTTATGACAGAGGGAGAGAGAAGATGGTGATAAAGACAGATGCAGCCGGC
TATCCTAAGTTGATGACAAGATCACTAGCTTTGCAATTTGCCCCAGTGTCATGCTCACTC
AAGCATCCTTTTGGATATATACATATTCCAACGCCCACATGAACATCTAGCCCACCAGAC
AGAGTAATGACTTGAGGAATCGGCATTCTAGTTGATACACTTTCCCTCAAAAGTTTGGTT
AGCTCAAGGTTAGATCTGACAAGATCAAGTTTTTGAAAGTGGAAAGCTCAAGACACTGAA
CTGTTTGGAGATCCCCACATGCCCACACTGCACCTCTCTTCTATGTCTTTCTTAAACCAT
CCTCCCTCCATGAAATGTCATCCCTCAGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved