Macaca_mulatta Locus Poly:5:SNORD115
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:5:SNORD115
Macaca_mulatta
Poly:5:SNORD115
7
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1080, 2978..3059, 4875..4956, 6775..6856, 8669..8749, 10557..10638, 12456..12537, 14050..14131, 15971..16051, 18636..18717, 20222..20303, 22126..22206, 24785..24866, 26368..26449, 28292..28372, 30951..31032, 32817..32898, 34707..34787, 35856..35937, 37756..37837, 39674..39755, 41495..41575, 42142..42223, 44009..44090, 45887..45968, 47791..47872, 50698..50779, 52577..52658, 54437..54518, 55338..55419, 57113..57194, 59001..59082, 60883..60964, 62764..62845, 64632..64713, 66483..66563, 68387..68468, 70250..70330, 71944..72024, 73817..73898, 75679..75759, 77540..77621, 79402..79482, 80956..81037, 82637..82718
83718
AGCCATGGCTGGTGCTTTGTCGTGCTGTAGGCCGACCCTGGGACTCATGGGCTTTGGGT
CAAGGATGCAGCCCGCCTGCTGCTGGGGATCACCCCTTATTCGAGGTCATTGATGGGAAG
GGTCACGTCCCCAGATTGGAAGGCCCCCTCCTGAGGGACCTGTCCTGGGAATTTGTGGCC
CAGGCTGCTCCTGAGCCATGAGGTCACCTCCAGGATGGTTGGGTCTTGGGCCCAAGGAAA
GGAGAGGGCACTATGTAGCTCCTGATTGGCCAAGTGTGGCCCAGCTCTGTGTTTGACAGG
GGTCTGGGGTGTGTGTGAGGACCCCCCAGAGAAAGCACGTGGCGCTTGACCCCAGGCTGC
GACTGCTGGTGCGTGCTTGGAGAGGGAGCCTGAGCTGGTGTCCTCCCTGTACAGGGGCAG
GCTGTGGGACTGCCAGTCGACAGCAGTGCCTGACATCCAGGCCAGCCTCCTTAGTTGGCC
GTAAGCTGGTTGATGACCTTGGACCCTGCCCAGGGGTTCTGTTGTGGTCCAGAGTCGTGT
AGTGGAGTCAGCATGGGCAGTGGAGGTGTCACAGGGGCTGCTGTATGGCACAGCCTGGGC
ATCTTGCCTGAACCCAGTGACTCGCCTACCCTGTCCTTTGAGAGTTTGGTGGCGGAGAGG
GCCAAGGGTTCCCTGGGTCCATGATTGTCATTATTTCATATAGATCCCATCACATGGGTC
CATGGAGGGAGAGCATGTGTGAGCCCGCACACCTTCCTCCCTTTCCCAAACAGAGGCGTG
AAGCCCTGTTTGGACACCTATCCCCTGTCCCTCCAGATGGTGACCCCAGAGGAAGACTTG
CATTGTGCCCGCTGGCCCCAGGCCAGCGGCCGTGAGCCAGTTGCCCAACCCCTGTTGCGC
TGAAGCTCAGGCCCTCCTGGGCCCTGGTCTCCTGCATTGAGCTTGGTGAGCACATCTCGG
TCCTGCTGGATATGTGTGTGGGTAGGCGGGTGCCCTGGGTTGGGTCGATGATGAGAACCT
TATATTGTCTGAAGAGAGGTGATGACTTAAAATCATGCTCAATAGGATTACGCTGAGGCC
CAGCCTAGGGGAGAATTTTGGAAGAGGATGCTGGGAATTACGAGTTACCTGGCAGAACCA
CTGTATTTTGGGCTGGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAACCCTGT
CTCTGCACTCCTCCGTGAGGCAGCCCAGGCTTACTATGTGGGCTTGGTGTCAGCGCTCCT
GTCACGCAGGTGCGTGGCACTTTGGTGGCTCCTTCCTAAGCCCCCATTCTCCCCTGTGTC
TTTCAGTGAGCTCTTCTGCCCAGCAGACCCCCTGGCATTGACCAGCATAGGTGAGTAGAT
CCTGCTGGGGTCATGGCCCATGAGCCAGGCTGTGTGGGGTTTCCGAGCATCAGTCTTCAG
ATGCACTGCAAGGGTTTCCTCAGTAGCTGAAGTGTGTCCCCACCTGGGATGGGTTCTCCA
GGAAGGCAGCTTTCTTAGGAATTGGACCCAAGGAGGTACCTTCCCTGAAGCCCTGCAGGG
GTTGCGATGGTCCAGGCAGTAAAGGGTTTCCTCAACCCCATGCAGGGCAGCACCCAGCTG
AGACTCGGTGCTCACGTCAGGCCTCTAGGATGGCCAGGCCACATGAGGGGAACCAGAAGG
GCTCTGGGGTACCAAGGGGGTCTTGCAGGGGCTCTCCGACCTTGGAGAGGTGTGTGTGTG
ATTTGGTCCACGAGGTCAGGCTTCTGATTTTCAAGGGTCTCTCTAAACCCATGGCCCGGA
ATGGGAGTGACCCTATTAAGCTATGGGCCATCCCAGTGGTGCATCTTTGAGCCAAGTGTG
GGGTGGGGCTGTTTCCATGAGGTCGGGTCAAGGCTAGCTCCAGTGACTCCATGATGGTAC
TGCAGTCTGGCCTTGGGACTCGTGGGCTTTGGGCCAAGCATACAGCCCGTGTCCCACTGG
GGGTCATACCTTGCTTGTGGGCGAGTAGTGGGAAGGGGTCCTCCTGAGGTGGGAAGGCCT
GCTGTGGAAGGACCTGTCCAGGCTGCTTCTGAGCTACGGGGCCACCTACAGGGTGGTGGG
GTCAAGGAAAGGAGAAGAAGACACCATGCATTCCCCGATTGGCTGAGTGTGGCCCCGCTC
TGTGTATGGGAGGTGTTGTGTGAGGCATGGATGGGGATGTATCAGAGAACACACGAGGCC
CTGGGTCCCCAGGCTGCAATTTCTGGTGTGGTGTGGAGTGGGGCCTGGGTACTTGCCCTC
CACACACAGGGGCAGACTATGCAACTGCCAGATGGGCAGAGGTGCATGGCATGCAGGCCA
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCCCTGGCCTACACCCAGGGGGCCAGTACAGCCCTGGGGTCATGCGAA
GCAAGTGGAGTGGGCAGTGGAGTTCTCAAGGTGCCTGCAGATAGCCAGGATGTCTTGCCT
GAGCCCAGTGACCTGCCTGCCCTGTCCTTCCAGGGTTCAGTGGTGGGGAGGGCCAAGGTT
CCCCCACGTCCATGACATGTCAGTGTTTCACATGGATGCCATCACATGGGTCCATGGTGG
GAGAGCAATCATGAGCTGGCACCTCCCACCCCCTTCCCATGTGGAGGCATGAGATTCCAT
TTGGACACATGAACACATCCTGTCCCCCAGATGGTGAGACCAGAGGAAAACTTTTGTTGG
GCGCACTGTCCCGTGGCGAGTAGTCATCCCTCAGGTCCCCAGCCCCCAGTGCACTGAAGC
TCAGGCCCTTCCTGGTGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCGGGTCC
CACTGGATGCATGCGTGGGGAGGGGGGTCCCCTGAGTTGGGTCAATGATGAGAACCTTAT
ATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTGAATAGGATTACGCTGAGGCCC
AGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCAAGGTCCCCTGGCAGGGCCAC
TGTATTTTGGGCTGGAGTCCTTGAGGCCCTGAAGGACACCTCCGGGATGCCCAACCCTGT
CTCTACTCTTCTCTGTGTGGCAGCCCAGGCTGCTTGTGCAGGCTTGGTGTTGGCACTCTG
GTTCCCTGGGGGCGGGGCACATTGGAGGCTCCTCCCTGAGCCCCTTTTCTCCTCTGTCTT
TCAGTGAGCTCTTCTGCCCAGGTGAGCCCCTGGCCTTGAGCAGCATAGGTGAGTGGATCT
TGCTGGGGTTACGGGCCATGAGCCAGGCTGCAGGGGATTGCTGAGGGTCACCCTTCAGGC
CATGAGGGTTTCCTTAGGGAGCTGACCTGAATCCCCACCAGGGATGGCTGGTTTCTCCAG
GAGGGAGGCTTCCTTGGAAACTGATCCCAGAAGGACGCCTTCCCTGAAACCCTGCAGGGG
TAACGGAGGTCCAGGCAGGAGAGGGTTCCTTCAACCCAATGCAGTGCAGCTCCTGAGACT
TGGGGCACGGCTTAGGCCTGGAGCACTTCCAAGGCCACATGATGGGGTCCACTGGGTCTC
CGGGGGCCACAGGTGTTATGCAGGAGCTCTCTGTCCCTGAGTCTTGCAGCGGGGTAGGGT
GTGGGTGATCGAGCTTATGGAGTCAGGCCATGAAGATTCAAGGACTGGGCCCAACCCATG
GCCCTGATGGGACTTACCTGTGGAGCAATGGGGCATCCCAGTGGTGCCTCCTTGAGCATG
GTAGGGGCGGTGTGGCCTCAGTGGGTTTGGGTCAAGACTGAGCTCTGGCCAGCACCTGGT
GGTTGGCCCTGGGAATCATGGGCTTTGGGCCAAGGGTGCAGCCTGAGTCCCATTGGAGGT
CACCGCTACCTGAAGTGGAATAGCTGGAAGGGTGGCATCCTGTGGTGGAAGGCCTACTGT
TAAGGGTCCTGTCCCAGCAATTTGATGCCCAGGCTACTTCTGAGCCATGGAGTCACCTCC
AGGGTGGTGGGTCTTGAGCTGAAGGAAAGGAGAGGACATCACATGGCCTCTGATTGGCTG
AGCATGGCCCAGCTCTGTGTTTGGGAGGTGTGCGGTGCATGAATGGGGACCCCCCAGAGA
AGGCACGTGGCCCTGGGGACCCAGGATGCAATTTCTGATGTGAGCTTATAGAGGGTGCCT
GGATGGGTTCATTTCATGCCCAGGGGCAGGCCACGTAACTACCAGGTCTGCAGTGGCACG
TGGCATCCAGGCCAGCCTCCTTGGTTTGTTGTGAGCTGGTTAGTGGCTGTGGCCCTGCCC
AGTGGTCCCGGTGCAGCCCAGAGTCGAGCAGGGGATTTTGCGTGGGCAGTGGAGGTTCTC
CAGGGTCCTGCAGTAGGGTGCAGCCTGGGCGTTTTGCTCCAACCCTGTGACCTGCCTGCC
CTGTCATTCCAGGGTTCAGTGGCCAAGGGTTCCTTGCGTTTGTGACCATCACGGTTTTAC
ATGGATCTCATCTCATGAGTCCATGGAGGAAGAGCATGTGTGAGCCAGCCCCACCCTGCC
CACTTTCCTGCATGGAGACATGAGGCTCTGTTTGGACACCTGTCCCCCACCCCTCCAGAT
GGTGACCCCAGAGGAAGACTTACATTGGGCCTGCTGGCTCTGGCCCAGTGTCTCTCAGCC
AGGTGCTCAGCCCCTGGTGAGCTGAAGCTCAGGCCCTTCCTGGCACCCTGGTCTGCTGCA
CTGAGCTGCGGTGAGCCCATCTGTGCCCCACTGGATGCATGAGTGGCGGGCGGTTGGGGG
GCGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGA
CTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAG
AAGATGCTGGGATCCGGAGTTCCCCGGAATGGCCAGTGTATTTTGGGCTAGAGACCTTGA
GGCCCTGAATGGAATCTCATGGGGATCCGACCCCTTCTCTGTGCTCCTCTGTGAGGCAGC
CCAGGCTCCCCGTGTGGGCTTGGTGTCGGTGCTCCGGTTCTGGCAGCCCCCATTCTCCCT
TGTGTCTTTCAGTGAGCTCTTCCACCCAGGTGCAGCCCCCAGGCACTGACCAGCATAGGT
GAGTGGTCCTGCTGGGGTCATGGGTTATCAGTCAGGCAGCGTGGGGTCACCGAGGGTCAG
CTTTTGAAACAGGAAGGTTTCCACAGGCAACCAACCTGAATCCGCACCAGGGAAGGGTGG
ATTGGTCCTCCAGGAGGGCTGATTTTTTGGGAATCGGACCCAAGTAGGATGCCTTCCCTG
CAGCCCTGCGGGGATGACGATGGTCCAGGCAGGAAAGGGTTCCTTCAGTCTCAAGCAGGG
CAGCTCCCAGCTGAGTCTCGGTGCACTGGTCTGGCCTTGAGGACTGACCAGGCCACATGA
GGGAGGCCACAGGGGCTTCGGGACACCATGGGGTCATACAGGAGCTCCCCATCCCTGGAG
AAAGGTGGGCATAGGGCCCATGGAGTTGAGCTGCAGAGATTTAAGGATCGCACAGGACTT
ATTGCCCTGAATGGGACTGACCCTGTTGATCTGTGTGCCATCCCATGGAACCTGTTTGGG
CCTGGAGGGGGCGGTGGTATTTCCCTAGGTTTGGGTCAAGGCTGAGCTCTCGCCAGTGCC
TGGTGGTGCTACAGTTCAGCCATGGACTCGTCAGCTTTAGGCCAAAGGGTCAGTCCACGT
CCTGCTGGGGATCTCCCCTTCCCTGTGGCTGGAAATGACCCCTTCCCTGTTGGCAAGAGT
CAGGAAGGGTGGCCTCCTGAGGTGGAAGGCCTGCTGTCAAGGGTCTTACCCCTGGAATAT
GCTGCCCATGCTGCTTCTGAGCCACGGGGTCACCTCCAGGTTAGCGGGTCATGGACCCAA
GGAAAGGAGAAGTCACCATGTGTCCCCCGATTAGCCGAGTGTGGCCCTGCTCTGTGTTAA
GGAGGTGCGTGGGGCATGGATGGGGACCCACCAGAGAAAGCATGTGGCCCTGGGACCCCA
GGTTGCGATTTCCATTTCATGCTGGGATAGGGTGCCTGGGTGGGTGCCCACAATGCACAG
GGGCAGGCTATGTGACTGCCAGCTTTGCAGTGGCACCTGGCATCTGGGCCAGCCTCCTTG
GTTGGCTGTGAGCTGGTTGATGGCCCTAGTCTGTGCCCAGTAGTTCTGGCATGATCCTGG
GGTCGTGCAGGGAAGCTGGCATGGGCAGTGGAGGTGCTCATGGGACCTGTAGTAGGACAC
AACCGGATCTTCTTGCCCAAGCCCAGTGACCCGCCTGCCCTGTCTTTCCAGGGTTCAGTG
TTGAGAGAGCATTGGGTGCCCTGTGTCCGAGACGAGCCAGTGGTCTGCATGGATCCCATC
ACATGGGTCCATGGAGGGTGAGCATCCCTGAGCCGCCACACCCCACCTTCTGCCCCCATG
GAGGCGTGAGGTTGTGTTTGGATGCCTGTCCTACTCCTGTTTCCCCAGATGTTGAGGCTG
GAGGAAGACTTGAATTGGGCCCAATGGCCCCAGGCCAGTGTCCATCAGCTAGGTGTCCAG
CCCCTGGTGCACTGAACATTCAACACTTCCTGGCACCCTGGTGTCCTGCACTGAGCTGTG
GTGAGCACATCCGGGTCCTGCTGGATGTATGCACTGGGAGGTGGTGCCCTGAGTTGGGTC
GATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATA
GGATTACGCTGAGGCCCAGTCTAGGTGAGGGTTTTGGAAGAGGACACTGGGATCCCGAGG
TTCCCTGGAAGAGCCATTGTATTTTGGGCTGGAGACCTGGAAGCCCTGAAGGGCATCTGG
GGGGCCCACCCCTGTCTCTGTGCTCCTCCATGAGGCAGTCCTGGCTCCCTGTGTGGGCTT
GGTGATAGCCCTCCTGTTCCCCAGGAGCGACACACGTGGGCGGCTCCTCCCTGACCGCCA
TTCTCCCCTGTGTCTTTTAGTGAGTTCTTCCACCCAGGCGGGCACCCTGGCATTGACCAG
CATAGGTGAGTGGATCCTGCTGGGGTCGTGGGCCATGTGCCAGGCTGCATGGAGTCACCA
AGTATTAGCCTTCAGGCAGGAGGTTTTCCTCAGGGACCTTAATCCCCACCTGCGGAGAGA
TGGGTTTGTCCTCTAGGAAAGCAGCTTTCTGGGGAATCAGACCCAATACCATGCCTTCCC
TGAAGCCCTGCAGGGGTGACAGTGGTCCAGTCTGGAAAGGGTTCCTTCAGTCTCATGCAG
GGCAGCTCCAAGCTGACACTCGGTTTGCGAGTTTGTCCTCGAGGGCTGCCCAGGACAAAT
GAGCGGGACAGCAGAGGCTCTGGGGTGCCACGGGGATCACTCGGGGGCTCGCCGTCCCTG
GAAATGGGTGGGCGATCGGGCCCATGGGATGGGGCTGCGGAGATTCAAGGATCGTGCCCC
ACTCATGGCCCTGAATGTGAATGACCCTGTTGAGCAATGGGCCACGCCAGTAGCTCCTTC
TTGAGCCTGGTGGGTGGCGGTTCAGCTTCAACTGGTTGAGTCAAGGCTGAGCCATGGCTG
GTGCTTTGTGGTGCTGCAGGCCGGCCCTGGGACTCATGGGCTTTGGGTCAAGGGTGCAGC
CCGCCTGCTGCTGGGGGTCACCCGTTCTTCGAGGTAAGTGACTGGAAGGGTCGCATCCCG
AGGTTGGAAGGCCCCCTCATGAGGGACCTGTCCCAGGAATTTGTGGCCCAGGCTGCTTCT
GAGCCATGGGGTCACTTCCAGGGTGGCGGGGTCTTGGGTCCAAGGAAAGGAGAGGGTACC
ACGTGGCTCCTGATTGGCTGAGTGTGGCCCAGCTCTGTGTTTGGCAGGTGTCTGGGGTGT
GGATGAGGACCCAGCAGACAAAGCACGTGGCCCTGGACCCAGGCTACGATTTCTGGTGTG
CGCTTGGAGAAGGATCCTGGGCAGGCATTCTCCGCACACAGGGGCAGGCTGTGGGACTGC
CAGGTTGGCAGCAGCGCCTGGCTTCCGGGCCAGCCTCCTTGGTTGGCTGTGAGCTGGTTG
GCGGCCTTGGTCCCCGCCCTAGGTTTCTGTTGTGGTCTAGAGTCGTGCAGTGGAGCCACT
GTGAGCGGTGAAGGTGCTCCAGGGGCCTGCTGTACAGCAGAGCCTGGGCAACTTACCCAA
GCCCCGTGACCTGCCTACCTTGTCCTTCAAGGGTTCAGTGGTGGAGAGGACCAAGGCTTC
CCTGGGTCCATGACCATCATTATCTCATATGGATGCCATCACATGGGTCCGTGGAGGGAG
AACATGTGTGAGCCAGCCCCCACTCCCTGCTTTCCCGCATGCAGGCATGAGGCCCTGTTT
GGATACCTGTCCCCTGTCCCTCCAGATGGTGACCAGAGAGGAAGACTTGCATTGCGCCTG
CTAGCCCCAGGCCAGTGGCCATCAGCCAGGTGCCCAGCCCCTGGTGAGCTGAAGCTTGCG
CCCTACTGGGCCCTGGTCTCCTGCATTGAACTTGGTGAGCACATTAGGGTCCCACTGGAT
GCATGTGTCGGGAGGGGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCTGA
AGAGAGGTGATGACGTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTGGGTG
AGAATTTTGGAGGATTCTGGGAATTACAAGTTCCCCGGCAGGAGCACTGTATTTTGGGCT
GGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAACCCTGTCTCTGCGCTCCTCC
GTGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTCGGCCCTCCCCTTACCTGGGGGCA
GGGTACTTTGGCAGCTCCTTCCTGAGCCCCCATTCTCCCCTGTGTCTTTCAGTGAGCTCT
TCTGCCTAGCAGACCCCCTGGCATTGACCAGCATCGGTGAGTGGATCCTTCTGGGGTCAT
GGCCCATAAGCCAGGCTGTGTTGGGTTGCTGAGCGTCAGCCTTCAGCCGCAAGAATTTTC
TCAGGAGCTGTCCTGAATACCCACTTGGAATGGGTTCTCCAGACGGGCAGCTTCCTTGGG
AATCAGACCCAAGGAGGATACCTTCCCTGAAGCCCTGCAGGGGTTACAGTGGTCCAGACA
GTAAAGGGTTCCCTCAGCCCCATGCGGGGCAGTGCCCCGCTAAGACTCAGGCTCAGGTCA
GGCCTCTAGGACAACCAGGCCACATGCGGGTGGCCACAAGGACTCTGGGGTGCCAAGGGG
GTCTTGCAGGGGCCCTCTGACCTTGGAGAGGTGTGTGCGATTCTGCCCATGGGGTTGGGC
TTCGGATTTGCAAGGATCTCTCCAAACCTATAGCCCTGAGTGGGACCGACCCTATTAAGC
TATGGGCCATCCCAGTGGTGCCTCTTTGAGCCAAGTGTAGGGCGGCACTGTTTCCCTAAG
GGTGTGTCAAGACTAGCTCTAGCTGGCACCTGAGGGTGCTGCGTTCCGGCCTGGAATTGG
TGGCTTTGGGCCAAGGGTACAGTGCATGTCCCACTGGGGGTCACCCCTTCTTTGTCGGCA
GTGACAGGAAGGCTGTCCTCCTGAGGTGGGGAAACCTGCTGTGGAAGGACCTGTCCTGGA
AATTTGTGGTCCAGGCTGCATCGGAGCCATGGGGTCACCTCTAGGGGGGTGGGATCTTGG
GTCCAAGTAAAGGAGAAGATACCAGGTGTCCCCTGATTGACTGAGTGTGGCCCCGCTCTG
TGTGTGGGAGGTGTTGTGTGGCCATGGATGGGGACTCACCAGAGAACACACGAGTCCCTG
GGGCCCCAGGCTGCGATTTCCGGTGTGGTGTGGAGCGGGGCCTGGGTTCTCACCCTCCAC
ACACACGGGCAGACTATGCAACTGCCAGATCGGCAGTTCATGGCATCCGGGCCAACCTCC
TTGGTTGCCTGTGAGAGGGTAGGTGGCCCTGGCCTGCACCCCAGGGGCCAATACAGCCCT
GGAATTGTGAGAGGCAGCTAGCGTGGGCAGTGGAGGTGCTCAATGTGCCTGCAATAGGGC
GTAGCTAGGGCGTCTTGCCTGAGTCCAGTGACCCACCTGCCCTGTCCTTCCAGGGTTCAG
TCGTGGGGAGGGCCAAGGTTCCCCTGCATCCATGACACATCGGTGTTTCACATGGATCCC
ATCACATGGGTCCATGGTGGGAGAGCAGTCGTGAGCTGGCATCCCCCACTCCCTTCCCGC
TTGTAGGCGTGAGGTTCCATTTGGACACAGGTCCACCTCCTGTCCCCTAGATGGTGAGAC
CAGAGGAAAACTTTCGTTGGGCCCGCTGTCGCAGGGCGAGTGGTCGTCAGTCAGGTGCCC
AGCCCCTGGAGCGCTGAAGCTCAGACCTTTCCTGTCGCTCTGGTCTCCTGCACTGAGCTG
TGGTGAGCACATCCGGGTCCCACTGGATGCATGTGTGGGGAGGTGGTGCCCTGAGTTGGG
TCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAA
TAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTCGAAGAGGATGCTGGGATCCCAA
GGTCCCCTGGCAGGGCCACTGTATTTCGGGCTGGAGTCCTTGAGGCCCTGAAGAGCACCT
TAGGGGTGCCCAACCCTGTCTCTGTGCTCCTCTGTGTGGCAGCCCAGGCTCCTCATGCGG
GCTTGGTGTTGGCACTCTGGCTCCCATGGGCTGGGGCAAGTTGGTGGCTCCTCCCTGAGC
CCCCGTTCTCCCCTGTGTCTTTCAGTGAACTCTTCTGCCCAGGTGAGCCCCTGGCCTTGA
GCGGCATAGGTGAGTGGATCTTGCTGGGGTCATGGCCCATGAGCCAGGCCATGGGGGTCC
ACTGAGGGTCACCCTTCAGGCCACGAGGGTTTCCTCAGGGAGCCGATCTATATCCCCACC
AGGGACAGATAGTTTCTCCAGGAGGGTGGCTTCCTTGGAAATCGATCCCAAGAAAGATGC
CTTCCCTGAAACCCTGCAGGAGTAACAGAGGTTCAGGCAGGAGAGGGTTCCTTCGACCCA
ATGCAGTGCAGATCTCAGCTGAGACTTGGTGCACAGGTCAGGTCTGGAGGACTGCCCAGG
TCACATGAGGGCATCCACAGGGTCTCTGGGGCCAGGAGTCTTATACAGGAGCTCTTTCTC
CCCGAGGCTTGCAGGGGGTTGGGTGTGGGTGATCGGGCTTACAGAGTCAGGCCGTGAAGA
CTCAAGGGTTGAGCCATACTCTGGGCCCAGAATGGGGCAGACCCTGTTGAGCAATGGGCC
ATCCCACTGGTGCCTCCTTGAGGCTGGTGGGGGTGGTGCGGCCTCACTAGGGTTGGGTCA
AGGGTGAGCTCTGGCCGGCACCTGGTGGTTGGCCCTGGGAATCGTGGGCCAAGGGTGCAG
CCTGCGTCCCATTGGAGGTCACCCCTCCCCAAAGTGGAGTGGCTGGAAGGGTGGCATCCT
GTGGTGGAAGGTCCACTGTCAAGAGACCTGTGCTAGCAATTTGCTGCCCAGGCTGCTTCT
GAGACATGGGGTCACCTACAGGGTGGTGGAGTCTTGAGCCAAAGGAAAGGAGAAGATACC
ATGTGCCCCTTGATTGGCCGAGTGTGGCCTGGCTCTGTGTTTGGGAGGTACGTGGTACAT
GAATGGGGACCCACCAGAGAAGGCACGTGGCCCTGGGACTCCAGGATGCGATTTCTGGTG
TAGGCTTATAGAGGGTGCCTGGACAGGTGCCTTCCACATCCAGGGGCAGGCTATGTGCCT
GCCAGTTCTGCAGCTGCACATGGCATCCAGTCCAGCCTCCTTGGTTTGCCATGAGCTGGT
TGGTGGCCCTGGCCTTGCCCAGTGGTCCAAGTGTGGCCAGGTCATGTGGGGGAGCTGGTG
TGGGCAGTGGAGGTGCTCCAGGATCCTACAGTAGGGTGCAGCCTGGGCGTCTTGCTGGAA
TCCCATGACCTGCCTACCCTTTCCTTCCAGGGATCAGGGGCAGGGAGGGCCAAGGTTTCC
TTGCAGGCATAACCGTCACTGTTTTACATGAATCCCATGTATTGAGTCCAGGGAGGGAGA
CCATCTGTGAGCCAGCATGCCCTGCCCACTTTCCTGCATGGAGGCGTGAGGCCGTGTTTG
GACAACTGTCCCCCACCCCTCCAGATGGTGACCCTGGAGGAAGAATTGCATGAGGCCCAC
TGGCCCTGGGACAGTGTCCCTCAGCCAGGTGCTCGGCCCCTGGTGAACTGAAGCTCAGGC
CGTTCCTGGTGCCCTGGTCTCCTGCACAAACCTGTGGTGAGCACATCTGGGTCCCAGTGG
ATGCATGCATGGGTTGGGGGAGTGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATAT
GGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAG
CCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATTTCTAGGTCCCTGTCAGGGGCTGTGT
ATTTTGGACTGGAGAAATCTAGGCCCTGAACAGCATCTTGGGGGAGCTCTACCCTGTCTC
TGCATTTCTACGTGAGGCAGCCCAGGCTCCCTCTGTGGGCTTGGTGTTGGCTCTCCGGTT
CCCCGGGGTAGGGCACCTTGCTGGGTCCTTCCTGAGCCCCTGTTCTCCTCTTGTGTCTTC
TGTATTTCAGTGAGCTCTTCAGCCCAGGTGGGCCCGCTGACATTGACGCACATAGGTGAG
TGCATTCTGCTGGCATCGTGGGCCATGAGCCAGGCCACATGGTGTCACTGAGGGTCAGCC
CTTGGGAAAGAAGAGTTTCCTCAGGGAGCCGACATGAATCCCCACTGGGGAGAGATGGTT
TCTGCAAGAGACTGGCTTACTTGGGAATCAGACCCAAGACCATGCCTTCCCTGATGCCTC
ACAGGGGTGACGGTGGTCCAGGCAGGAAAGAGTCCCCTCAGTCCCATGCAGGGCAGCTCC
CAGCTGAGACTTTGTGTGCGGGTCTGGCCCAGGCCACATGAAGGGGGCCACAGGGGCTCT
GGGGTGCCACAGGGGTCACACGAGAGCTCTCTTTGCCTGGAGAGGTGCTCGAATGGGCCC
GTGGGGTCAGGCTGCAGAGATTCGAGGACTGCATCCCAACCATGGCCCTAAATGCAACCG
ACTGTGTTGAGTAATGGGCCATCTCAATGGCGCCTCTTTGAGCTTGGTGGGGGGTGGTGC
TGTTTCCCTGGGTTTGGGTCAAGACTGAGCTCTGTCCACTGCCTGGCGATGCTGCAGGCT
GGCCCTTGAACTTGTGGGCTTTGGTCTAAGTCGGCAGCCCACACCTCCTGGAGGTCACCC
TGGAGGGCCTTTGCATGTCGGTGAGTGGCTGGAAGAGTGGATCGTAAGGTAGGAAGTCCC
GCTGTCGATGGTCCTGTCCTGGGAATTTGCCACCCAGGCCTCTTCTGAGCCAAGGGGTCA
CCTCCAGGGTGGCAGGATCTTGGGTCTAAGGAAAGAGAGGATACCATGCGGCCCAGGGTT
GGCCGAAGGTGGCCTGACTCTGTTTTGGGGACCTGTGCGGGACATGGATGGGGACTCGCC
AGAGAAAGCCTGTGGCCCTGGGACTCCAGGCTTCGATTTCAAGTGTGGTTTGCCAAGAGT
GCCCCACTTCCATGATAGGTCTGTGTTCTGTGTGGATCGCATCACGTGAGTAACCCTCAC
CCCTTTGCCGCATGGAGGCATGAGGCCCCGTTTGGACACATGTCCTCCTCCTGTCCCTCC
AGGTGGTGAGCCCAGAGGAAGACTTGTGTTGGGCTCAATGTCTTCGAGCCAGTGTCCCAA
AGCCAGGTGCCCGGCCCCTGGTTTGCTGAAGCTTGGGACCTTCCTAGTGACCTGGTCTCC
TGCACTGACCTGTGGTGACTACAACCGGGTCCCACCGGATGCCTGTGCAGGAAGGAGGGT
GTCCTGGGTTGGGTCGATGATGAGAACCTTGTATTGTCCTGAAGAGGGGTGATGACTTAA
AAATGATGCTCAATAAGATTACCCTGAAGCCCAGCCTAGGTGAGAATTTTGGAAGAAGAT
GCTGGAATCCCGAAGTCCTCATCAGGGCCCCTGTATTTTGGGCTGGAGACCTGGAGGGCC
TGAAGGACATCTGGGGGGCCCAACCCTGTCTCTGCACTCCTCCGTGAGGCAGCCCAGGCT
CCCTGTTTGGGCTTGCTGTTGGTGGTCCAGTTTCCTGGGGTGGGGCATGAGGGCAACTCC
TCCCTGAGCCCCCCTTCTCCGTTTTTGTCTTACAGTGAGCTCCTCCACCCAGGCAGGGCA
CCCTGGCATTGAGCGGCATAGGTCAGTGGATCCTGCTGGTGTTATGGGCCATGGGTCAGG
CCACGTGGAGTCGCTGAGGGTCAGCCTTCAGGACAGGAGGGTTTCCTTAGGGAGCAGACT
TGAATACCCACCAGGGATGGAAGGGTTGATCCTCTAGGAAAGTGGCTTCCTGAGGAATCG
AACCCAAGGAGTACGCCTTCCCTGGAGTCCTGTAGGGATGACAGTCGTACAGGCAGGAGA
GGGTTCCTTCAGTCTCACACAGGGCAGCTCCCAGCTGAGTCTTCCTGTGCTGCTGTGACC
TCGAGGACTGTGTAGGCCACATGAGGGTGTCCACAGGGCCTCTGGGATGCCATGGGGTCA
CACAAGAGCTCTCCATCTGTGGAGAAAGGTGGGCTAGGGCCCATGGAGTTGAGCTGCAGA
TATTCGAGGATCGCACATGACTTATTGCCCTGAATGGGATGGGCCAGTTGAGCAATATGC
CAACCCGTGGCACCTCTTTGAGCCTGGAGGGGGCGGAGCTCTTTCCCTAGGTTTGGGTCA
AGGCTGAGCTCAGGCTGGTACCTGGTGTTGCTGCAGTCTGACCATGGACTCGTTAGGTTT
AGGTCAAGGGGTCAGTCCACGTATTTCTGAGGTTCTCTCCTTGGCTGAAATTCACCCCTT
TCCTCTGGGCACGTGTCTAGAAGGGTGGTCTCCTGAGGTGGAAGGCCTGCTGTCAAGGGT
CTTGTCCCTGGAATATGCCGCTCATGCTGCTTCTGAGCCATGGAGTCACCTCCAGGGTGC
TGAGTCTTGTGCCCAAGGAAAGAAGTCACCATGTATCCCCCGAATAGCCAAGTGTGGCCC
TGCTCTGTGTTAGGAGGTGTGTGGGGCATGAATGGGGACCCACCAGAGAGAGCATGTGCC
CCTGGGACCCCAGGCATGTACAGGTCTCTAGTACGTGCTGTGATAGGGCATGTGGGTGGG
TTCCCACAGTGCACAGGGGCGGGATATGTGACTGCCAGCTTTGCAGTGGCATCTGGCATC
TGGGCCAGCCTCCTTGGTTGGCGATGAACTGTTTTGTGGCCCTGGTCAGTGCCCAGTAGA
CCTGGCATGGTGCTGGGGTCATGCGGTGGAGCCGGCATGGGCAGTGGAGATGCTCATGGG
CTCTGCAGTAGGGCACAGCTGGGGCTTCTTGCCCGACCCCAGTGACCCGCCTGCCCTGTC
CTTTCAAGGATTGGTGACTGAGAGAGCACAGGGTGCCCTGCGTCTGCGACGGGCCAGTGT
TCTACATGGAACCAACCACATAGGTCCATGGAGGGTGAGCATCCCTGAGCTGCCACACCC
CACCTTCTGCCTCCATGGAGGGATGAGGTTGTGTTTGGACACCTGTCCTACTCCTGTTTC
CCCAGATGTTGAACCTTGAGGAAGACTTGTATTGGACCCAATGGCCCTGGGCCAGCGTCT
GTCAGTCAAGTGCCCAGCCCCAAGGCACTGAAGATGGGGCCCTTCCTGATGCCCTCGTCT
CCTGCATTGAGCTATGGTGAGCACATCCGGGTCCCACTGGATGCATTGATGGGGAGGGGG
TGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCTAAAGAGAGGTGATGACATAA
AAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTGGGTGAGAATGTTGGAAGAGGAT
GCTGGGAATTATGAGTTCCCTGTGAGATCCACTGTAATTTGGGCTGGAGACCTGGAGGCT
CTGAGGGCATCTAGAGGGTGCCCAACCCTGTCTCTGCACTCCTCCATGAGGCAGCCCAGG
CTCACTATGTGGGCTTGGTGTCAGTGCTGCTGTTACCCAGGGGTGGGGCACTTTGGTGGC
TCCTTCCTGAGCCCCCATTTTCCCCTATGTCTTTCAGTGAGCTCTTCTGCCCAGCAGACC
CCCTGGCATTGACCGACATAGGTGAGTGGATCCTGCTGGGGTCATGGCCCATGAGCCAGG
CTGTGTGGGGTTTCTGAGCATCAGTCTTCAGATGCACTGCAAGGGTTTCCTTAGGAGCCT
TCCTAAATGCCCATCTGAGATTGGTTCTCTAGGAGGGCAGCTTCCTTAGGAATCAGACCC
AAGGAAGATACATTCCCTGAAGCCCTGCAGGGGTTGTGGTGGTCCAGGCATTAAAGGGTT
TCCTCCACCTCATGCAGGGCAGTGTCCCGCTGAGACTCGGTCCTCAGGTCTGGCCTCTAG
GATGGCCAGGCCACATGAAGAGGGACACATGGGCTCTTGGGCACCAAGAGGTTCATGTAG
AGGCTCTCTGACCTTGGAGAGGTGTGTGTGATTCGGCCCAGGGGGTTGGGCTGTGGATTT
TCAAGGATCGCACCAAACCCATGGCCCTGAATGGAACTGACCCTATTAAGCAATCGGCCA
TCCCAGTGGTGCCTCCGTGAGCCAAGTGCGGGTCAGCACTGTTTCCTCAGAGTGAGTCGA
GACTAGCTCTGACCAGCATCTGATGGTGGTGCAGTCGTGCCCTGGGATTGGTGGGCTTAG
GGACAAGGGGATGACCCATGTCCCATCTGGGTCACCCCTTCCTTGTGGGCGAGTGGCAGG
AAGAGTGTCCTCCTGAGGTGGGAAGGCCTGCTGTGGAAGTTCCTGTCTCAGAAATTTGCT
GTCCAGGCTGCTTCTGAGCTATGGGGTCACCTCCATGCTGGCGGGGCCTCAGGTGAATGG
ATCCTACTGGGGTCATGGGCCATGAGCCAGGCCGGGGTGGGGTCCCTGAGTGTCACGCTT
CAGGTCATGAGGGTTTCCTCAAGGAGCTGACCTGAATCCCCACCAGGGATGGATGGTTTC
TCCAGTTGGGAGATTTCCTTGGAAATCGGTCCCAAGAAGGACGCCATCCCCGAAACCCTG
CGGAAGTAACAGAGGTTCAGGCAGGAGAGGGTTCCTTCAACCCAATGCAGTGCAGATCCT
AGCTGAGACTTGGTGCACAGGTCAGTCCTGGAGGACTGCCCAGGCCACATGATGGCATTC
CCAGGGTCTTCCGGGGCTAGGAGTCTTATATGGGAGCTCTTTGTCCCTGAGGCTTGAAGG
GGACAGTGTGTGGCTGATCCGGCTTACGGAGTCAGACCCTGAAGATTCAAGGGTCAGGAA
TAACCTATGGCCCTGAATGGGACTGACCCTGTTTAGCAATGGAGCAATGGGCCATCCCAG
TGGTGGCACCTTGAGCCTGGTGGGGGTGGCGCAGCCTCGGTGGGGTTGGGTCAAGGCTGA
GCTCTGGCTGTCACCTCATGGTTGGCCTTGGGAATCAGGGGTTGGGGCCAAGGGTGCAGC
TCGGGTCCCATTGGAGTCACCCCTCCCCATAGTGGAGTGGCCAGAAGGGTGGCATTCTGT
GGTGGAAGGGCCACTGTGAAGGGTCCTGTCCCAGCAATTTGCTGCCAAGGCTGCTTCTGA
GTCATGGGGTCACCTCCAGGGTGATGGGGTCTTGAGCCAAAGGAAAGGAGAGGACATTAT
GTGGCCCCTGATTGGCAAAGCGTGGCCCAGCTCTGTGTTTGGGAGGTGTGAGGTGCATGA
ATGGGGACTCACCAGAGAAGGCACGTGGCCCTGGGTCCCCAGGATGGTATTCTGGTGTGA
GCTATGGCGGGTGCGTGAATGTGTGCATTCCATGCCCAGGGGCAGGCTATGTGACCGCCA
GGTCTGCAGTGGCGCATGGCGTCCAGGCCAGCCTTCTTGGTTTGCCGTGAGCTGGTTGGT
GGCCCTGGCCCTGCCCAGTGGTCCCATTGAGGCCCAGAGTTGTGTGTGGGAGCTGGTGTG
GGTAGTGGAGGTGCTCCAGGGTCCTACAATAGGGTGGAGCCTAGGCGTCCTGCTGGAATC
CCATGATCCATCTGCCCTGTTCTTTCAGGGTTCAGTGGCAGGGAGGGCCAAGGTCATTCC
TCACGTGCATGACCGTCACTGTTTTACATGGATCTCATCTCATGAGTCCATGGAGGGAGA
GCATGTGTGAGCTAGCACCCCCTGCCCACTTTGCCCTATGGAAGCGTGAAGCCCTGTTTG
GACACCTGTCCCTCACCCGTCCAGATGGTGACCCTGGAGGAAGAATTCCATTGGGCCTGC
TGGCCCTGACACAGTGTCCCTCAGCCGGGTGCTCAGCCCCTGAAAAGCTGAAGCTCTGGC
CCTTCCTGATGCCCTGGTCTCCTGCACAGAGCTCTGGTGAGCCCATCTGGGTCCCAGTGG
TTGCATGCATGGGTTGAGGGGTTGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATAT
GGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAG
CCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATTTCTAGGTCCCTGTCAGGGACTCTGT
GTTTTGGACTGGAGAAATACAGGTCCTGAACAGTATCTTGGGGGAGCTCTACCCTGTCTC
TGCATTTCTACGTGAGGCAGCCCAGGCTCCCTCTGTGGGCTTGGTGTTGGCTCTCCGGTT
CCCCGGGGTAGGGCACCTTGCTGGGTCCTTCCTGAGCCCCTGTTCTCCTCTTGTGTCTTC
TGTATTTCAGTGAGCTCTTCAGCCCAGGTGGGCCCGCTGACATTGACGCGCATAGGTGAG
TGCATTCTGCTGGCATCGTGGGCCATGAGCCAGGCCACATGGTGTCACTGAGGGTCAGCC
CTTGGGAAAGAAGAGTTTCCTCAGGGAGCCGACATGAATCCCCACTGGGGAGAGATGGTT
TCTGCAAGAGACTGGCTTACTTGGGAATCAGACCCAAGACAATGCCTTCCCTGATGCCTC
ACAGGGGTGACGGTGGTCCAGGCAGGAAAGAGTCCCCTCAGTCCCATGCAGGGCAGCTCC
CAGCTGAGACTTTGTGTGCGAGTCTGGCCCAGGCCACATGAGGGGGGCCACAGGGGCTCT
GGGATGCCACAGGGGTCACACGAGAGCTCTCTTTCCCTGGAGAGGTGCTCGAATGGGCCC
GTGGGGTCAGGCTGCAGAGATTCGAGGACTGCATCCCAACCATGGCCCTAAATGCAACCG
ACTGTGTTGAGTAATGGGCCATCTCAATGGCGGCTCTTTGAGCTTGGTGGGGGGTGGTGC
TGTTTCCCTGGGTTTGGGTCAAGACTGAGCTCTGTCCACTGCTTGGTGATGCTGCAGGCT
GGCCCTTGAACTTGTGGGCTTTGGTCTAAGTCGGCAGCCCACATCCTCCTGGAGGTCACC
CTTTGCATGTCGGTGAGTGGCTGGAAGAGTGGATCGTAAGGTAGGAAGTCCCGCTGTCGA
TGGTCCTGTCCTGGGAATTTGCCACCCAGGCCTCTTCTGAGCCATGGGGTCACCTCCAGG
GTGGCAGGATCTTGGGTCTAAGGAAAGAGAGGATACCATGCGGCCCAGGGTTGGCCGAAG
GTGGCCTGACTCTGTTTTGGGGACCTGTGCGGGACATGGATGGGGACTCGCCAGAGAAAG
CCTGTGGCCCTGGGACTCCAGGCTTCGATTTCAAGTGTGGTTTGCCAAGAGTGCCCCACT
TCCATGATAGGTCTGTGTTCTGTGTGGATCGCATCACGTGAGTAACCCTCACCCCTTTGC
CGCATGGAGGCATGAGGCCCCGTTTGGACACATGTCCTCCTCCTGTCCCTCCAGGTGGTG
AGCCCAGAGGAAGACTTGTGTTGGGCTCAATGTCTTCGAGCCAGTGTCCCAAAGCCACGT
GCCCGGCCCCTGGTTTGCTGAAGCTTGGGACCTTCCTAGTGACCTGGTCTCCTGCACTGA
CCTGTGGTGACTACAACCGGGTCCCACCGGATGCCTGTGCAGGAAGGAGGGTGTCCTGGG
TTGGGTCGATGATGAGAACCTTGTATTGTCCTGAAGAGGGGTGATGACTTAAAAATGATG
CTCAATAAGATTACCCTGAAGCCCAGCCTAGGTGAGAATTTTGGAAGAAGATGCTGGAAT
CCCGAAGTCCTCATCAGGGCCCCTGTATTTTGGGCTGGAGACCTGGGGGCCTGAAGTACA
TCAGGGGGGACCAACCCTGTCTCTACAGTCCTCCATGAGGCAGCCCAGGCTCCCTGTTTG
GGCTTGCTGTTGGTGGTCCAGTTTCCTGGGGTGGGGCATGAGGGCAGCTCCTCCCTGAGC
CCCCCTTCTCCGTTTTTGTCTTACAGTGAGCTCCTCCACCCAGGCAGGGCACCCTGGCAT
TGAGCGGCATAGGTCAGTGGATCCTGCTGGTGTTATGGGCCATGGGTCAGGCCACGTGGA
GTCGCTGAGGGTCAGCCTTCAGGACAGGAGGGTTTCCTTAGGGAGCAGACTTCAATGCCC
ACCAGGGATGGAAGGGTTGATCCTCTAGGAAAGTGGTTTCCTGAGGAATCGAACCCAAGG
AGTACGCCTTCCCTGGAGTCCTGTGGGCATGACAGTCATCCAGGCAGGAGAGAGTTCCTT
CAGTCTCACACAGGTCAGCTCCCAGCTGAGTCTTCATGTGCTGCTGTGACCTCGAGGACT
GTGTAGGCCACATGAGGGGGTCCACAGGGCCTCCTGAATGCCATGGGGTCACACAAGAGC
TCTCCATCTGTGGAGAAAGGTGGGCTAGGGCCCATGGAGTTGAGCTGCAGATATTCGAGG
ATCGTACATGACTTATTGCCCTGAATGGGATGGGCCAGTTGAGCAATATGCCAACCCGTG
GCACCTCTTTGAGCCTAAGGGGGCGGAGCTATTTCCCTAGGTTTGGGTCAAGGCTGAGCT
CAGGCTGGCACCTGGTGTTGCTGCAGTCTGACCATGGACTCGTTAGGTTTAGGTCAAGGG
GTCAGCCCACGTATTGCTGAGGTTCTCTCCTTGGCTGAAATTCACCCCTTTCCTCTGGGC
AAGTGTCTGGAAGGGTGGCCTCCGGAGGTGGAAGGCCTGCTGTCAAGGGTCTTGTCCCTG
GAATATGCCGCTCATGCTGCTTCTGAGCCATGGAGTCACTTCCAGGGTGCTGAGTCTTGT
GCCCAAGGAAAGAAGTCACCATGTGACCCCCGAATACCCAAGTGTGGCCCTGCTCTGTGT
TAGGAGGTGTGTGGGGCATGAATAGGGACCCACCAGAGAGAGCATGTGGCCCTGGGACTC
CAGGATGTACAGGACTCTAGTACGTGCTGTGATAGGGCATGTGGGTGGGTTCCCACAGTG
CACAGGGGCGGGATATGTGACTGCCAGCTTTGCAGTGGCATCTGGCATCTGGGCCAGCCT
CCTTGGTTGGCGATGAACTGTTTTGTGGCCCTGGTCAGTGCCCAGTAGACCTGGCATGAT
GCTGGGGTCATGCGGTGGAGCCGGCATGGGCAGTGGAGATGCTCATGGGCTCTGCAGTAG
GGCACAGCTGGGGCTTCTTGCCCGACCCCAGTGACCCGCCTGCCCTGTCCTTTCAAGGAT
TGGTGGCTGAGAGAGCACAGGGTGCCCTGCGTCTGCGACGGGCCAGTGTTCTACATGGAT
CCCACTACATAGGTCCATGGAGGGTGAGCATCCCTGAGCTGCCACACCCCACCTTCTGCC
TCCATGGAGGGATGAGGTTGTGTTTGGACACCTGTCCTACTCCTGTTTCCCCAGATGTTG
AACCTTGAGGAAGACTTGTATTGGACCCAATGGCCCTGGGCCAACGTCTGTCAGTAAGGT
GCCCAGCCCCAGTGCCCTTCCTGATGCCCTCGTCTCCTGCATTGAGCTATGGTGAGCACA
TCCGGGTCCCACTGGATGCATTGATGGGGAGGGGGTGCCCTGGGTTGGGTCGATGATGAG
AACCTTATATTGTCTGAAGAGAGGTGATGACATAAAAATCATGCTCAATAGGATTACGCT
GAGGCCCAGCCTGGGTGAGAATGTTGGAAGAGGATGCTGGGAATTATGAGTTCCCTGTGA
GATCCACTGTAATTTGGGCTGGAGACCTGGAGGCTCTGAGGGCATCTGGAGGGTGCCCAA
CCCTGTCTCTGCACTCCTCCATGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTCAGT
GCTGCTGTTACCCAGGGGTGGGGCACTTTGGTGGCTCCTTCCTGAGCCCCCATTTTCCCC
TGTGTCTTTCAGTGAGCTCTTCTGCCCAGCAGACCCCCTGGCATTGACCAGCATAGGTGA
GTGGATCCTGCTGGGGTCATGGCCCATGAGTCAGGCTGTGTGGGGTTTCCGAGCATCAGT
CTTCAGCTGCAAGGGTTTCCTTGGGAGCCTTCCTGAATGCCCACCTGGGATTGGTTCTCT
AGGAGGGCAGCTTCCTTAGGAATCAGACCCAAGGAAGATACATTCCCTGAAGCCCTGCAG
GGGTTGTGGTGGTCCAGGCATTAAAGGGTTTCCTCCACCTCATGCCGGGCAGTGTCCCGC
TGAGACTCGGTCCTCAGGTCTGGCCTCTAGGATGGCCAGGCCACATGAAGAGGGACACAT
GGGCTCTTGGGCACCAAGAGGTTCATGTAGAGGCTCTCTGACCTTGGAGAGGTGTGTGTG
ATTCGGCCCAGGGGGTTGGGCTGTGGATTTTCAAGGATCGCACCAAACCCATGGCCCTGA
ATGGAACTGACCCTATTAAGCAATCGGCCATCCCAGTGGTGCCTCCGTGAGCCAAGTGCG
GGTCAGCACTGTTTCCTCAGAGTGAGTCGAGACTAGCTCTGACCAGCATCTGATGGTGGT
GCAGTCCTGCCCTGGGATTGGTGGGCTTAGGGACAAGGGGATGACCCATGTCCCATCTGG
GTCACCCCTTCCTTGTGGGCGAGTAGCAGGAAGAGTGTCCTCCTGAGGTGGGAAGGCCTG
CTGTGGAAGATCCTGTCTCAGAAATTTGCTGTCCAGGCTGCTTCTGAGCTATGGGGTCAC
CTCCATGCTGGCGGGGCCTCAGGTGAATGGATCCTACTGGGGTCATGGGCCATGAGCCAG
GCCGGGGTGGGGTCCCTGAGTGTCACGCTTCAGGTCATGAGGGTTTCCTCAAGGAGCTGA
CCTGAATCCCCACCAGGGATGGATGGTTTCTCCAGTTGGGAGATTTCCTTGGAAATCGGT
CCCAAGAAGGACGCCATCCCCGAAACCCTGCGGAAGTAACAGAGGTTCAGGCAGGAGAGG
GTTCCTTCAACCCAATGCAGTGCAGATCCTAGCTGAGACTTGGTGCACAGGTCAGTCCTG
GAGGACTGCCCAGGCCACATGAGGGCATTCCCAGGGTCTCCGGGGCTAGGAGTCTTATAT
GGGAGCTCTTTGTCCCTGAGGCTTGAAGGGGACAGTGTGTGGCTGATCCGGCTTATGGAG
TCAGACCCTGAACATTCAAGGGTCAGGAATAACCTATGGCCCTGAATGGGACTGACCCTA
TTTAGCAATGGAGCAATGGGCCATTCGGTGGTGGCACCTTGAGCCTGGTGGGGGTGGCAC
AGCCTCGGTGGGGTTGGGTCAAGGCTGAGCTCTGGCTGTCACCTCATGGTTGGCCTTGGG
TATCAGGGGTTGGGGCCAAGGGTGCAGCCCGGGTCCCACTGGAGTTCACCCCTCCCCATT
GTGGAGTGGCCAGAAAGGTGGCATTCTGTGGTGGAAGGGCCACTGTGAAGGGTCCTGTCC
CAGCAATTTGCTGCCAAGGCTGCTTCTGAGTCATGGGGTCACCTCCAGCGTGATGGGGTC
TTGAGCCAAAGGAAAGGAGAGGACATTATGTGGCCCCTGATTGGCAAAGCGTGGCCCAGC
TCTGTGTTTGGGAGGTGTGAGGTGCATGAATGGGGACCCACCAGAGAAGGCACGTGGCCC
TGGGGCCCCAGGATGGTATTTCTGGTGTGAGCTTATGGAGGGTGCGTGAATGTGTGCATT
CCATGCCCAGGGGCAGGCTATGTGACCGCCAGGTCTGCAGTGGCGCATGGCGTCCAGGCC
AGCCTTCTTGGTTTGCTGTGAGCTGGTTGGTGGCCCTGGCCCTACCCAGTGGTCCCATTG
AAGCCCAGAGTTGTGTGGGGGAGCTGGTGTGGGTAGTGGAGGTGCTCCAGGGTCCTATAA
TAGGGTGGAGCCTAGGCGTCCTGCTGGAATCCCATGATCCATCTGCCCTGTTCTTTCAGG
GTTCAGTGGCAGGGAGGGCCAAGGGTTCCTCACATGCATGACCGTCACTGTTTTACATGA
ATCTCATCTCATGAGTCCATGGAGGGAGAGCATGTGTGAGCTAGCACCCTCTGCCCCCTT
TCCCCTATGGAGGCATGAAGCCCTGTTTGGACACCTGTCCCTCACCCCTCCAGATGGTGA
CCCTGGAGGAAGAATTCCATTGGGCCTGCTGGCCCTGACACAGTGTCCCTCAGCCGGGTG
CTCAGCCACTGAAAAGCTGAAGCTCTGGCCCTTCCTGGTGCCCTGGTCTCCTGCACAGAG
CTCTGGTGAGCCCATCTGGGTCCCAATGGATGCAGGCATGGGTTGAGGGGGTGGTGCCCT
GGGTTGGGTCAATGATGAGAACCTTATATGGTTCTGAAGAGAGGTGATGACTTAAAAATC
ATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGG
GATTTCTAGGTCCCTGTCAGGGTACTGTATTTTGGACTGGAGAAATCCAGGCCCTGAACA
GCATCTTGGGGGAGCTCTACCCTGTCTCTGCATTTCTACGTGAAGCAGCCCAGCCTCCCT
CTGTGGGCTTGGTGTTGGCTCTCCGGTTCCCCGGGGTAGGGCACCTTGCTGGGTCCTTCC
TGAGCCCCTGTTCTCCTCTTGTGTCTTCTGTATTTCAGTGAGCTCTTCAGCCCAGGTGGG
CCCGCTGACATTGACGCGCATAGGTGAGTGCATTCTGCTGGCATCGTGGGCCATGAGCCA
GGCCACATGGTGTCACTGAGGGTCAGCCCTTGGGAAAGAAGAGTTTCCTCAGGGAGCCGA
CATGAATCCCCACTGGGGAGAGATGGTTTCTGCAAGAGACTGGCTTACTTGGGAATCAGA
CCCAAGACAATGCCTTCCCTGATGCCTTATAGGGGTGATGGTGGTCCAGGCAGGAAAGAG
TCCCCTCAGTCCCATACAGGGCAGCTCCCAGCTGACACTTTGTGTGCGGGTCTGGCCCAG
GCCACATGAGGGGGGCCACAGGGGCTCTGGGGTGCTACAGGGGTCACACGAGAGCTCTCT
TTCCCTGGAGAGGTGCTCGAATGGGCCCGTGGGGTCAGGCTGCAGAGATTCAAGGACTGC
ATCCCAACCATGGCCCTAAATGCAACCGACTGTGTTGAGTAATGGGCCATCTCAATGGCG
CCTCTTTGAACTTGGTGGGAGGTGGTGCTGTTTCCCTGGGTTTGGGTCAAGACTGAGCTC
TGTCCACTGCCTGGCGATGCTGTAGGCCGGCCCTTGAACTTGTGGGCTTTGGTCTAAGTC
AGCAGCCCACATCCTCCTGGAGGTCACCCTTTGCATGTCGGTGAGTGGCTGGAAGAGTGG
ATCCTGAGGTAGGAAGACCCGCTGTCGATGGTCCTGTCCTAGGAATTTGCCACCCAGGCC
TCTTCTGAGCCATGGGGTCACCTCCAGGGTGGCAGGGTCTTGGGCCTAAGTAAAGAGATG
ACACTGTGTGGCCCAAGGTTGGCCGAAGGTGGCCTGACTCTGTTTTGGGGAGCTTGCGGG
ACATGGATGGGGACTCGCCAGAGAAAGCCTGTGGCCCTGGGACTCCAGGCTTTGATTTCA
AGTGTGGTTTGCCAAGGGTGCCCCACTTCCGTAATAGGTCTGTGTTCTGTGTGGATCCTA
TCCCGTGAGTAACCCTCACCCCTTTGCCGCATGGAGGCATGAGGCCCCGTTTGGACACAT
GTCCTCCTCCTGTCCCTCCAGGTGGTGAGCCCGGAGGAAGACTTGTGTTGGGCTCAATGT
CTTTGGGCCAATGTCCCAAAACTAGTGCCTGGACCCTGGTGTGCTGAAGCTTGGGACCTT
CCTAGTGACCTGGTCTACTGCACTGACCTGTGGTGTCTACAGACGGATCCCACCGGATGC
CTGTGCAGGAAGGAGGGTGTCCTGGGTTGGGTCGATGATGAGAACCTTGTATTGTCCTGA
AGAGGGGTGATGACTTAAAAATGATGCTCAATAAGATTACCCTGAAGCCCAGCCTAGGTG
AGAATTTTGGAAGAAGACACTGGAATCCCGAAGTCCCCATCAGGGCCCCTGTATTTTGGG
CTGGAGACCTAGAGGGCCAAAGGGCATCAGGTGGGCACAACCCTCTCTCTGCACTCCTCC
GTGAGGCAGCCCAAGCTCCATGTGCGGACTTGCTGTTGGTGGTCCAGTTTCCTGGGGTGG
GGCATGAGGGCAGCTCCTCCCTGAGCCCCCCTTCTCCATTTGTGTCTTTCAGTGAGCTCT
TCCACCCAGGCAGGGCACCCTGGCATTGAGCGGCATAGGTCAGTGGATCCTGCTGGTGCT
GTGGGCCATGGGTCAGGCCACGTGGAGTCGCTGAGGGTCAGCCTTCAGGACAGGAGGGTT
TCCTTAGGGAGCAGACTTGAATGCCCACCAGGGATGGAAGGGTTGATCCTCTAGGAAAGT
GGTTTCCTGAGAAATCGAACCCAAGGAGTACGCCTTCCTTGGAGTCCTGTGGGGATGACA
GTCATCCAGGCAGGAGAGGGTTCCTTCAGTCTCACACAGGTCAGCTCCCAGCTGAGTCTT
CGTGTGCTGCTGTGACCTCGAGGACTGTGTAGGCCACATGAGGGTGTCCACAGGGCCTCT
GGGATGCCATGGGGTCACACAGGAGCTCTCCATCTATGGAGAAAGGTTGGGTAGGGCCCA
TGGAGTTGAGCTGCAGATATTCAAGGATCGCACTTGACTTATTGCCCTGAATGGGATGGG
CCATGTTGAGTAATATGCCAACCTGTGGCACCTCTTTGAGCCTGGAGGGGGCGGTGCTAT
TTCCCTAGGTTTGGGTCAAGGCTGAGCTCAGGCTGGCACCTGGTGTTGCTGCAGTCTGAC
CATGGACTCGTTAGCTTTAGGCCAAGGGGTCAGTCCACGTATTGCTGAGGTTCTCTCCTT
GGCTGAAATTCACCCCTTTCCTGTGGGCAAGTGTCTGGAAGGGTGGCCTCCTGAGGTGGA
AGGCCCGCTATCAAGGGTCTTGTCCCTGGAATATGCCGCCCATGCTGCTTCTGAGCCATG
GGGTCACCTCCAGGATGGTGAGTCTTGTGCCCAAGGAAAGGAGAAGTCACCATGTGTCCC
CCGAATAGCCAAGTGTGGCCCTGCTCTGTGTTAGGAGGTATGTGGGGCATGAATGGGGAC
CCACCAGAGAGAGCATGTGGCCCTGGGACTCCAGGCATGTACAGAGCTCTAGTACGTGCT
GTGATAGGCCACGTGGGTGGGTTCCCACAGTGCACAGGGACAGGATATGTGACTGCCAGC
TTTGCAGTGGCATCTGGCATCTGGGCTAGCCTCTTTGGTTGGCAATGAGCTGTTTTGTGG
CCCTGGTCTGTGCCCAGTAGACCTGGCATGGTGCTGGGGTCATGTGGTGGAGCCGGCATG
GGCAGTGGAGATGCTTATGGGCTCTGCAGTAGGGCACAGCTGGGGCTTCTTGCCCGACCC
CAGTGACCCGCCTGCCCTGTCCTTTCAAGGATTGGTGACTGAGAGAGCACAGGGTACCCT
GCGTCTGCGGCAGGCCAGTGTTCTACATGGAACCAACCACATAGGTCCATGGAGGGTGAG
CATCCCTGAGCCGCCACACCCCACCTTCTGCCTCCATGGAGGGATGAGGTTGTGTTTGGA
CACCTGTCCTACTCCTGTTTCCCCAGATGTTGAACCTTGAGGAAGACTTGTATTGGACCT
AATTGCCCTGGGCCAACGTCTGTCAGTCAAGTGCCCAGCCCCAGTGCACTGAAGATGGGT
CCCTTCCTGATGCCCTCATCTCCTGCATTGAGCTATGGTGAGCACATCCGGGTCCCACTG
GATGCATTGATGGGGAGGGGGTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTC
TGAAGAGAGGTGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCAGG
GTGAGAATGTTGGAAGAGGATGCTGGGAATTATGAGTTCCCTGTGACATCCACTGTATTT
TGGGCTAGAGACGTGGAGGCTTTGAGGGTATCTAGAGGGTGCCCAACCCTGACTCTGCAC
TCCTCCATGAGGCAGCCCAGGCTCACTATGTGGGCTTGGTGTCAGCGCTGCTGTTACCTA
GGGGTGGGGCACTTTGGTGGCTCCTTCCTGAGCCCCCATTTTCCCCTGTGTCTTTCAGTG
AGCTCTTCTGCCCAGCAGACCCCCTGGCATTGACCGGCATAGGTGAGTGGATCCTGCTGG
GGTCATGGCCCATGAGCCAGGCTGTGTGGGGTTTCTGAGCATCAGTCTTCAGCTGCAAGG
GTTTCCTTAGGTGCCTTCCTGAATGCCCACCTGGGATTGGTTCTCTAGGAGGGCAGCTTC
CTTAGGAATCAGACCCAAGGAAGATATATTCCCTGAAGTCCTGCAGGGGTTGTGGTGGTC
CAGGCATTAAAGGGTTTCCTCCACCTCATGCAGGGCAGTGTCCCGCTGAAACTTGGTTCT
CAGGTCTGGCCTCTAGGATGGCCAGGCCACATGAAGGTGGATGCAAGGGCTCTGGGGCAC
CAAGAGGTTCATGCACAGGCTCTCTGACCTTGGAGAGGTGTGTGTGATTCGGCCCATAGG
GCTGGGCTGTGGATTTTCAAGGATCACACCAAACCCATGGCCCTGAATGGGACTGACCCT
ATTAAGCAATCAGCCATCCCAGTGGTGCCTCTGTGAGCCAAGTGCGGGTCAGCACTGTTT
CATCAGGGTGAGTCGAGACTAGCTCTGACCAGCATTTGATGGTGGTGCAATCCCACCCTG
GGATTGGTGGGCTTAGGGACAAGGGGATGACCCATGTCCCATGGGGGTCACCCCTTCCTT
GTGGGCGAGTGGCAGGAAGAGTGTCCTCCTGAGGTGGGAAGGCCTGCTGTGGAAGATCCT
GTCTCAGAAATTTGCTGTCCAGGCTGCTTCTGAGCTATGGGGTCACCTCCATGCTGGCGG
GGCCTCAGGTGAATGGATCCTACTGGGGTCATGGGCCATGAGCCAGGCCGGGGTGGGGTC
CCTGAGTGTCACGCTTCAGGTCATGAGGGTTTCCTCAAGGAGCTGACCTGAATCCCCACC
AGGGATGGATGGTTTCTCCAGTTGGGAGATTTCCTTGGAAATCGGTCCCAAGAAGGATGC
CTTCCCCGAAACCCTGCGGAAGTAACAGAGGTTCAGGCAGGAGAGGGTTCCTTCAACCCA
ATGCAGTGCAGATCCTAGCTGAGACTTGGTGCACAGGTCAGTCCTGGAGGACTGCCCAGG
CCACATGATGGCATTCCCAGGGTCTTCCGGGGCCGGAGTCTTATATGGGAGCTTTCTGTC
CCTGAGGCTTGCAGGGGCACAGTGTGTGGCTGATCCGGCTTACGGAGTCAGACCCTGAAC
ATTCAAGGATCAGGAATGACCTATGGCCCTGAATGAGACGGACCCTGTTGAGCAGTGGAG
CAATGGGCCATCCCGGTGGTGGCACCTTGAGCCTGGTGGAGGTGGCGCAGCCTCGGTGGG
GTTGGGTCAAGGCTGAGCTCTGGCTGTCACCTCATGGTTGGCCCTGGGAATCGTGGGCTT
TGGGCCAAGGGTGCAGCCCGGGTCCCATTGGAGTTCACCCCTCCCCATAGTGGAGTGGCC
AGAAGAGTGGCATCCTGTGGTGGAAGGGCCACTGTGATAGGTCCTGTCCCAGCTATTTGC
TGCCAAGGCTGCCTCTGAGTCATGGGGTCACCTCCAGGGTGATGGGGTCTTGAGCCAAAG
GAAAGGAGAAGACATTATGTGGCCCCTGATTGGCAGAGTGTGGCCCAGCTCTGTGTTTGG
GAGGTGTGAGATGCATGAATGGGGACCCACCAGAGAAGGCACGTGGCCCTGGGGCCCCAG
GATGGTATTTCTGGTGTGAGCTTATGGAGGGTGCGTGAATGTGTGCGTTCCATGCCCAGG
GGCAGGCTATGTGACCGCCAGGTCTGCAGTGGCGCATGGCATCCAGGCCAGCCTTCTTGG
TTTGCCATGAGCTGGTTGGTGGCCCTGGCCCTGCCCAGTGTTCCCATTAAGGCCCAGAGT
TGTGTTGGGGAGCTGGTGTGGGCAGTGGAGGTGCTCCAGGGTCCTACAATAGGGTGCAGC
CTAGGCGTCTTGCTGGAATCCCATGATCCATCTGCCCTGTTCTTTCAGGGTTCAGTGGCA
GGGAGGGCCAAGGGTTCCTCACATGCATGACCGTCACTATTACATGGATCTCATCTCATG
AGTCCATGGAGGGAGAGCATGTGTGAGCTAGCACCCTCTGCCCGCTTTCCCCATGGAGGC
GTGAAGCCCTTTTTGGACACCTGTCCCTCACCCCTCCAGATGGTGACCGTGGAGGAAGAA
TTCCATTGGGCCTGCTGGCCCTGACACAGTGTCCCTCAGCCGGGTGCTCAGCCCCTGAAA
AGCTGAAGCTCTGGCCCTTCCTGGTGCCCTGGTCTCCTGCACAGAGCTCTGGTGAGCCCA
TCTGGGTCCCAATGGATGCAGGCATGGGTTGAGGGGGTGGTGCCCTGGGTTGGGTCAATG
ATGAGAACCTTATATGGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGAT
TACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATTTCTAGGTCCC
TGTCAGGGTACTATATTTTGGACTGGAGAAATCCAGGCCCTGAACAGCATCTTGGGGGAG
CTCTACCCTGTCTCTGCATTTCTACGTGAGGCAGCCCAGGCTCCCTCTGTGGGCTTGGTG
TTGGCTCTCCGGTTCCCCGGGGTAGGGCACCTTGCTGGGTCCTTCCTGAGCCCCTGTTCT
CCTCTTGTGTCTTCTGTATTTCAGTGAGCTCTTCAGCCCAGGTGGGCCCGCTGACATTGA
CGCGCATAGGTGAGTGCATTCTGCTGGCATCGTGGGCCATGAGCCAGGCCACGTGGTGTC
ACTGAGGGTCAGCCCTTGGGAAAGAAGAGTTTCCTCAGGGAGTCGACTGAATCCCCACTG
GGGAGGGGTGGTTTCTCCAGGAGGCTGGCTTCCTTGGGAATCAGACCCAAGACCATGCCT
TCCCTGATGCCTCACAGGGGTGACTGTGGTCTAGGCAGGAAAGGGTCCCCTTATTCCCAT
GTGGGGCAGTTTCCAGCTGAGGCTTGGTATGCAGGTCTGGCCTGAAGGACAGCCCAGGCT
ACATGACGGGTGTCACAGGTGCTCTGGGTGCCCCAGGGGTCACACGAGAGCTCTCTTTTC
CTGGAGAGGTGTTCGAATGGGCCCGTGGGTTCAGGCCACAGAGATTCAAGGATTGCATCC
CAACCATGGCCCTAACTGAGACGGACTGTTGAGTAATGGGCCATCTCAGTGGCGCCTCTT
TGAGCCTGGTGGGGGGCCGCGCTGTTTCCCTGGGTTTGGGTCAAGGCTGAGCTCTGGCCA
GCACCTGGTGATGCTGCAGGCTGGCCCAGGTTCTTCTGGGCTTTGGTCCATTTGGCAGCC
CGGTCCTGCTAGAGATCACCCCTTGCCGGTTGGTGAGGGGCTGGAAGAGTGGATCCTGAG
GTCGGAAGAGCCACTGTCGATGGTCCTGTCCTGGGAATATGCCACCCAGGCCTCTTCTGA
GCCATGGGGTCACCTCCAGGGTGGTGGGGTCTTGGGGCTAAGGAAAGAGAGGACACTATG
TAGCCCATGGTTGCCCAAGGGTGGTCTGACTCTGTGTTTAGGACATTTGCAGGACATGGA
TGGGGACCCGCCAGAGAAAGCATGTGGCTCTGGGACTCCAGGCTTTGATTTCGGGTGTGG
CTTGCAAATAGCACGTAGGCAGGTGCCCACCACACCCTGGGGCAGGCTATGCATCTTCCA
TGTCCACAGTGGCATATAGCTTCTGGGCCACTCTCCTTGGCTGGCCATGAGCTGGCTGGT
TCCCTGTGCCCTGTGTTCCCAGAGTGGCTCTGGAATTGTGTGGGGCAGACAGCTTGGGCA
GTGGAGATGCTATCAAGGCCATCAGTAGGGTGCAGTCTGGGCATCTTGCCTGAGCCCAGA
CCTACCTACCCTGTTTTCTCAGGGTTTGGTGATTGGGAGGGCCAAGGGCTCCCCATGTGC
ATGATAGGTCAGTGTTTCTCATGGACCCCATCACATGCGTATACCTTACCCCTTCCCCAC
ATGGAAGGATGAGGCCTTGTTGGGACACATGTCCTCTTCCTGTCCCCCCAAATGGTGAGC
CTGGAGGAAGACTTGCATTGGGCCCAATGGACCCAGGCCAGTGGCCATCAGCCAGGTGCC
CACCCTGGTGTGCTGAAGTTTGGGACCTACCTGTCGTCCTGGTTTCCTACACTGTGCTGT
GGTAAGCACATCTGGGTCCCGCTGGATGCATGCATGGGGAGGGGGGTGCCCTGGTTTGGG
TCGATGATGAGAACCTTTTATTATCCTGAAGAGAGGTTATGACTTAAAATTCATGCTCAA
TAGGATTACGCTGAGGCTCACCCTAGGTGAGAATTTGGAAGAGGATGCTGGGATCCCGAA
GTCCCCGGTAGGGGGCTTTATTTATTAGTTTTGAGCTAGAGCCCTGGGGGCCCTGAAGGG
CATCTGGGGGGCCCAACCCTGTCTCTGCACTCCTCCGTGAGGCAGCCCAGGCTCCCTGTG
CGGGCTTGCTGTTGGTGGTCCAGTTCCCTGGTGGGGGGTGGGGCACGTGGAAGCTCCTCC
TTGAGCCCCACTTCTCCACTTGTGTCTTTCAGTGAGGTCTTCAACCCAGGCAGGGCACCC
TGGCATTTACTGGCATAGGTGAGTGGATCCTGCTGCCATCATGGGCCATGGGCCAGGCCA
CGTGGAGTCATTGAGGGTCAGCCTTTGGGACAGGGGGGTTTCCTCAGGGAGCGAACCTGA
ATCCCCACCCAGGAGGGATGGGTTGGTCCACCAGGAGGGTGGCTTCCTGGGAAATCGGAC
CCAAGGAGGATGCCTTCCCTGGAGCCCTGCAGGGATGACAGTGGTCCAGGCAGGACAGCG
TTCCTTCAGTCTTACACATGGTAGCTCCCCCATGAGTCTAGGTGTTCGAGTCTGGCCTCA
AGGACTGCCCAGGCCACCTGAGGGGCCAATAGGGGCTCTGGGACGCCATGGGGGTCACAC
AGGAGCTCTCCATTCACGGAGAAAGGTGGGTAATAGGGAGGGCCCATGGAGTTGAGCTGT
AGAGATTTAAGGATTGTGCCCAATGCATGGCCATGAATGGGACAGACCCTGTTGAGTAAT
GAGCCATTCCATGGGCCTTGTTGAGCCTTGAAGGGGGTGGTACTGTTTCCCTAGGTTTGG
GTCAAGACTGAGCTCTGGCCGGCGCCTGGTGGTGTTGAGGTCTGGCCATGGACTCGTCGG
CTTTGGGCCAAGGGGTCAGCCTGCTCCCACTGGAAGTCCCCCTTCCCCGTGGCTGGAAGT
CCCCCCTTCCCTGTGGCTGGAAGTCATCCCTTCCCAATGGTCAAGTGTCGGGAATGGTTG
ACTTGAGGTTGGAAGGCCTACTGTCAAGGGTCTTGTCCTTGGAATATGCGGCCCATGCTG
CTTCTGAGTCATGGGGTCACCTCCAGGGTAGCGGATGTTGGGCCCAAGGACAGGAAAAGA
TGCTGTGTGTCCCCTGATTAGCTGATTGTAGCCCTGCTCTGTGTTCAGGAGGTGTGTGGG
GCATGGATGCGGACCCATCAGAGAAAACATGTGGCCCTGGGACCCCAGGTTGCTATTTCC
AGTATGTGCTGGGAAAGGGCATCTGGGTGGGTGCCCACCATGCACAGGGATAGGCTGTGT
GACTGCAGGTCTGCAGTGGCATCTGACATCCAGGCCAGCCTCCTTGGTTTGCCGTGAACT
GGTTGGTGGCCCTGGCCTGTGCCTAGTAGTCCTGGCGTGACCCTCGGGTTGTGTGGGTGA
GCCAGTAGGGTCCCAGTGACCCGCCTGCCCTGTCCTTCCAGGGTTCTGTGGCTAAGAGCA
CTGGGTGCCCTCTGTCCGTGATGGGCCAGTGTTCCACATGCATCCCATCACATGGGTCCA
TGGAGGGCGAGTATGCTTGAACTGCCACACCCCACTTTCTGCTCACATGGAGGAATGAGG
TTGTGTTTGGACAACTGTCTTACTCTTGTTCTCCCAGATCGTGACCCCAGAGGAAGAATT
GTTTTGGGCCCAATGGCCCTGGGCCAGTGTCCATCAGCCCGGTGTCCAGCCCCTGGTGTA
CTGAAGCTCAGGCCCTTCCTGGTGCCCTAGTCTCCTGCACTGAGCTTGGTGAGCCCATTC
GGGTACTGCTGGATGCAGCAGTGAGGAGGGAGATGATGAGAACCTTATATTGTCCTGAAG
AGAGGTAGTGACTTAAAAATCATGCTCAAAAGGATTATGCTGAGGCCCGGCCTAGGTTAG
AATTTTGGAAGAGGATGCTGGGCTCCCGAGGTCCCCAGGAGGGCCCCTGTATTTTTGGCT
GGAGACCTGGAGGCTATCTGGAGGGTGCCCAACCCTGTCCCTATACTCTTCTGTGAGGCA
GCCCAGGATCTCTGTGCAGGCTAGGTGTTGGCACTCTGGTTTTCTGGGGGCAGGTGAGGT
TGGTGGCTCCTTCGTGAACCCTTATTCTCCGCTTGATTCTTTCAGTGAGCTCTTCTGCTC
AGATGGGTCCCCTGGCATTGACCAGCATAGGTGAGTGGATCCTGCTGGGTTCATGGGCCA
TGAGGCAGACACATGGGGTCACTGAGGGTCAGCCTTCGGGACAGGAGGGTTTCCTCAGGG
AGCCGACCTGAATCCCCACCATGGAGGGATGGGTTGGTCCTCTAGAACAGTGGCTTCCTG
GGGAATCTGACACCAAGAGGACACCTTCGATGAAGCNNNNNNNNNNNNNNNNNNNNTTCG
CTGAAGCCCTGCAGGGGTGATGGTGGTCCAGGCTGGAAAGGGTTCCTTCAATCTCATTTG
GGGCAGCTCCCTGCTGACATGAGGTCTGACATTGAGGACTGCCCAGGCCCCATGAGCAGG
ACAACAGGGGCTCCAGGGTGCCATGGGGATTGTGCAGGGGGCTCTCCATCCCCGGAGAGA
GGTGGGCAATCGGGCCTATAGGGTCAGGCTTCTAGGGTTCAGTGGCGGGGAGAGCCAAGG
GTTCCCTGGGTCCATTACTGTCAGTGTTTCACATGGATCCCATCACATGGGTCCATGGAG
AGACAGCATGTGTGAGCAGGCACCCCTTGCTCCCTTTCCCACATGGAGATGTAAGGCCCT
GTTTGGACACCTGACACCCATCCCTGCAGATAGTGAACCTGGAGGAAGACTCTTCCTGGG
TCCCCTGGCCCCAAGCCAGTGTCCATCAGTCAGATACCAGATCCCAGTGTGCTGAAACTC
ATGCCCTTCCTGGTGCCCTGGTCTCCTACACTGAGCTATGGTGAGAACATCCGGGTCCCA
CTGGATGCATGCGTGGGGAGGAATGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATAT
TGTCCTGAAGAAAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAC
CCTAGGTGACAATTTTGGAAGAGGACACTGGGAATCAATGAGGTCCCTGGCAGGGCCACT
GTATTTTGGACTGGAGACCTGGAAGCCCTGAAAGGCACCTCGTTGGGGGCCCAGCTCTGT
CTTCTCTCCCCCATGAGGCAGCCCAAGCTCCCTGTGTGGGCTTGGTGTCAGCGCTCTGCT
TTCCTGGAGGCGGGGCATTTTGGCTGCTCCTTCCTGAGCCCCTGTTCTCCCCTGTGTCTT
TCAGTGAACTCTTTCACCCAGCAGACTCCCTGGCATCGACCAGCATAGGTGAGTGGCTCC
TGCTTGGGTCATGGGCCATGAGCCAGGCCATAGGATTGCCGAGGGTCAGCATTTGAGCCA
TGAGGGTTTCCTCAGGAGCTGACCTGAATCCCCACCTGGAATGGGTTCTCCCAGAGGGCA
GCTTCCTTGTGAGTCTGACCCAAGTAGGATGCCTTCTCTGAAGCCCTGCAGGGGTGACAG
TTGTCCAGGCAAGAAAGGGTTCCCTCAGCCCCACGCGGGGCAGCACCCAGCCGAGACTCA
GTGCTTGGGTTAGGCCCCTAGGATGGCCAGGCCCTTTGAGGGGGGTCACAAGGGCTCCAG
GGCACCACAGGGGCCTTGCAGGGTCTCTCGGAACCCGGAGAGTGGTATGCGATTCGGCCC
ATAGGATCGGGCCCCAGATTCAAGGATCACACCACATCCATGGCCCTGAAGGGAACCAAC
CCTGTTAAGCAATGGGGCATCCCAGGGGTGCCTCTTTGAACCAAGTATGAAGTAGCGCTG
TTTTCCTGAGGTTGAGTCAATACTAGCTCTGTCCAGTGCCTGTTGGTGGTGCAGTCCAGC
CCTGAAATTCATGGGCACCGGGCCCAGGGTGCAGCCTGTGTCCCACTGGGGATTCACCCC
TTCCTTGTGGGCGAGTGGCGGGAAGGGTATCCTCCTGAGGTGGGAAGGCCAGCTGTGGAA
GGAACTGTCCCAGAAATTTGCCATCCAGTCTGCTTCTGAGCCATGGGGTCGCCTCCAGGG
TTGGCAGGGTCTTGGGCCCAAGGAAAGGAGAGGACACCATGTTTCCCTCAACTGGCCAAG
CGTGGCCCTGCTCTGCATGTGGGAGGTGTTGTATGGGGCATGGATAAAGACCCACCAGAG
AAAACACGTGGCCCTCAGGCCCAAGGCTGCAATTTCTCAGTGCACGCTTGGAGACGGTCT
TGGACCCCCTCCATTCCCAGGGGAAGGCTGTGCAACTGTCAGGTTGGCAGTGGCATGTGG
CATCTGGGCCAGTGTATTTGGTTGGCCATGAGCTGTTGGTGGCCCTGGTCCTTTCCCAGG
GTTTGGGTGCAGCCCTGGGGTCATGTGGGACAGCCAGTGTGGGCAGTGGAGGTGCTCTGG
TGGCCTGCAGTAGGGTGCAGCCTGGGTGTCTTGCCCGAGCCCAGTGACCTGCCTGCCATG
TCCTCACAGGGTTCCCTGGCAGGGAGGGCCAAGGGTCCTCTGTGTCTGTGACACATCAGT
GTTTCCCATGGATCCCATCAAATTGGTCCATGGAGGGAGAGCATGCGTGAACTGGCATCC
CTCCACCCTCTTCCCTGCATGGAGGCATGAGCCCCTGGTTGGATATATGTCCTCCTCCTG
TCCCCCCAGATGGTGGCCCTGGAGGAGGACTTGTATTGGGACCACTGGCCCCACATCAGT
GTCTTTCAGCCAGGTGTACAGCCCTTGGTGTGTTGAAGCTCAGGCCCTTCCTGGTGCTCC
GGTCTCCTGCACTGAGCTTGGTGAGCCCATCCAGGTCCTGCTGGATGCATATGCGGGAAG
GGGGGTGCCCTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATG
ACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATTTTGGAA
GAGTATGGTGGGATCCTGAGATCCCCAGCCAGGCCACCGTATTTTGGGCTGGAGTCACTG
AGGCCCTGGGCATCTCAGGGTGCCCAAATCTGTCTCTGCGCCTGTCCATGAGGCAACCCA
CTTTCCCTGTGTAGGCTTGGTGTCGGCCCTCCCGCTCCCCGTGAATGGGGCATATTGGCG
GCCTCTCCCTGAGTACCTGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGG
TCGGTCCCCCTGGCCCTTGAGGGGCATAGGTGAGTATGTCCTGCTGGCATCATGGTCCAT
GAGCCAAGGTGCGTGGGGTTGCCAAAGGTCATCCTTTAGACTGTAGGTTTCCTTAGGGAG
CTGACCTGAATTCCCACTGGGGGGGGCTGGTTTCTCCAGGAGGGCGTCTTCCATAGAAAC
TGGTCCCAAGAAGGACTCCTTCCCTGAAGCCGTGCAGGGGTGACAGTGGTCCAGGCAGGA
AAGGGTTCCTTCAAACCAACGCAGTGCAGCTCCTAGCTGAGACTCAGTGCACAGGTCAGG
GCTTGAGGACTCCCAGGCAACATGAGGGGATCCATAGGATCTCCGGAGGCCACGGGTGTT
AAGCAGGAACTCTCTATCCTTGAGGCTTGCTGGGGGCGGTGGGACGGTGGCAGGGTGTGG
GTGATCGAGTTTATGGAGTCAGGCTGTGAAGATTCAAGGGTCAGGCCCCACCCATGGCCC
TGATGGGACCAACCCTGTTGAGCAATGGGTTATCCCAGTGGTGCTTCCTTAAGCCTGGTG
TGGGCAGCGTGGCTTCAATGGGGTTGGGTCAAGGCTGAGCTCTGGCCTGCACCTGGTGGT
TGGCCCTGGGAATTGTGGGCTTTGGGCCAAGGGTGCAGCCTGCCTGCTGCTGGAGGTCAT
CCTACCCAGAGGTGGAGTGGCCGGAAGAGTGGCAGGCATCCTGTGGTGGAAGGCCCACTG
TTGAGGGTCCTGACCCAGCAAATTGCTGTCCAGGCTGCTTCTGAGCCATGGGTTTACCTC
CAGGGAGGTGGGATCTTGAGCCCAAGGAAAGGAGAGGACATCATGTGTCCCCTGAATGGC
CGAGAGTGGGGAGAATGTTTGGGGGGTATGTGGTGAATGCATGGGGACCCACCAGAGAAG
GCACATGGCCCTGAGGCCCCAGGACGCAATTTCTAGCACGCTTATAGAGGGTGTCTGAGG
GGGCACTCTCCATGCCCCGGTGCAGGCTATGTGACTGCCAGGTCTGCAGCAGTTCGTGGC
ATCCGGGCTAGCCTTCTTGATTGCTTATGAGCTGGTTGATAGCCCTGGCCTGTGCCGAGG
GGTCCTGGTGCGGCCCTGGGGTTGTTCGGGGAGCTGGCGTGGGCAGTGGAGGTGCTCTTA
GGGCCTGCAGTAGGGCACAGCCCAGGTGTTCTTGCTTGAGTTCAGTGAACCTCCTGCCCT
GTCCTTCCAGGGTTCAGTAGCAGGGAGGGCCCCATGTCCTCCCTGCTACTGGTCAGTGGA
GGTGGGTCAGTGTTCCGCATGGATTCCATCACATGGGTACGTGGAAGGAGAGCATGTGTG
AGCCAGCACTGCCTGCTCTCTTCCCCGCGTGGCAGGGTGAGGCCCTGTTTGGACCCACCC
TCCACTTATCTCACCAGATGGTGAGCCCAGAGGAAGACCCCCTGGCTGTGGGCCAGCCTC
CGTCAGCCAGATCCCCAGCCCCTAGTGTGCTGAAGCTCAGGACCTTCCTGGTGCCCTGGT
CTCCTGCACTGAGCTGTGGTGAGCCCATCCGGGTCCTGCTGGATGCACGAGTGGGGAGGG
GGGTGCCCTGGGTTGGGTCAATAATGAGAACCTTATATTGTCCTGAAGAGAAGTGATGAC
TTAAAATTCATGCTCAATAGGATTACACTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGA
GGATGCTGGGATCCCAAGGTCACAGGCAGGGCTACCGTATTTTGGACTAGAGACCTCAAG
GCCCTGAAGGGCATCTTGAGGGGATCCAACCCTGTCTCTGTGCTCCTCCGTGAGGCAGCC
CTGGCTCCCTGTGTGGGCTTGGTGTTGGTGCTCTGGTTCCTGGACAGGGCATGTGGGCGG
CTCCTTCCTGAGCCCCCGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGG
CCCCCTGGCATTGACTGGCATAGGTGAGTGGATCCTGCTTGGGTCATGGGTCATGAGCGA
GGCAGAGTGGGGTCACCATGTGTCTGCCTTCGGGTCACAAGAATTTCCTAAAAGTGTGGA
CCTGAATTCCCACTGGGGATAAGTTCTCCAGAAGGGCCACTTCCTTGGGAATCGTACCCA
AGATGGATGCCTATCCTGAAGCCCAGCAGGGGTGATGGTGGTCCAGGCAGGAAAGAGTTC
ATTCAACCCCATGCAGGGCAGCTCCTATCTGAGACTCGGTGCGTCAGTCAGGCCTCAAGG
ACTGCCCAGGACACATGAGGTGGCTACAGAGGGTCTGGGGCACTACGGGGATTCTGGGGA
GAGGGGTAGGCAATCAGGTCCATGGGGATCATGCCATGCAGTTTCAAGGACACCCATGAC
CCTGAATGAGACTGACCCTGTTGAGCAATGGGCCATCCCAATGGCGCCTTCTTGAGTCTG
GTGGTGGGTGGTGCTGTTTCCCTGGGGCTAGGTCAAGGCTGAGCTCTGGCCAGTACCTGT
GGTGCTGCAGGCTGGCCCTGGAACTCATGGGCTTTGGACCATGGGGACAGCTTGGGTCAT
GCTTGGGGTCACCCCTTCCCGGAGGTTGAATGGTGGGAGTGGTAGCTTCCTAAGGTGGGA
AGTCCCGCTGTTGAGCAACCTGCCCTGGGAATTTGCCACCCAGGCTGCTTCAGAGCCATG
GGGTCACCTCCAGGGTGGCAGCCTCTTGGGCCCAAGGAAAGGGGAGCACACCATGTGTCC
CTGGATTGGTTGAGTGTGGCCTCACTCTGTGTTTGGGAGGTGTGCAGGGCATGGATGGGG
ACCCATCAGAGAAAGTACATAGCCCTGGAGCCCCAGGCTGTGATTTCCAGTGTGTGCTTG
GAGAGGGGCAGGGGCAGGCTCTCGACTGCCAAGTCTGCAGCAGTGTGTGGCATCCAGGCC
AGCCTCCTGGTTGGCCATGTGCTGGTTGGTGGCCCTGGCCTGTGCCCAGTGGTCTCAGGG
TGGACCTGGCATTGTGCAGGGCAGCCAGCAGGTCAGTGGAGGTGCTCTCAGGACCTGCAG
TAGGGTGCAGCCTGGACTTTTTGCATGAGACCAATGACCTGCCTACCTTGTCCTTCCGGG
GTTGGGTGGCTGGGAGGGCCAAAGGTGGTCTGTGTCCGTCTTTGTGACGCACCAGTGCAC
GGATCCTATCACATGGATATCCCCTACCCACCTTCCCCACATAAAGGCATGAGGCCCTAT
TTGGACACGTGTCCTCCTCCTGTCCTAGATGGTGAGCTCAGAGGAAGACTTGCATTGGGC
CCAATGGACCCAGGCCAGTGTCTGTCAGCCAGGTGCCCAGCTCCTGATGTGCTGAAGCTC
AGGCCCTTCCTGGAGCCCTGGTCTCATGCCCTGAGCTGTGGTGAGCCCGTCTGGGTCCCA
CTGGATGCATGCATGGGAGGGGGGTGCCCTCGGTTGGGTCGATGATGAGAACCTTATATT
GTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACC
TAGGGGAGAATTTTGGAAGAGGATGCTGGGATCCTGAGGTCCCTGGCAGGGCCACTGTAT
TTTGGGTTGGAGACCTCAAGGTCCTGAAGGGCATCTTGGCGGCCCCCAGCCCTGTCTGCA
CTCCTCTGTGAGGCAGCCCAGGCTCACGGAGTTTGGTGTCAGAGTCCCATTCCCCAGGGG
CGGGGCAGGTTGGCGGCTCCTCCCTGAGTCCCCCTTCTCCCTTGTGTCTTTCAGTGACAT
CTTCTGCCCAGGTGGCCCCCTGGCAGTGACCAGCATAGGCGAGTGGAACCTGCTGGTGTC
ATGGGCCATGAGCCAGGCTGCGTGGGGACGCCAGGTCAGCCTTAGGGACAGGAGGGTTTC
CTCAGTGAGTGGGGGAATCCCCACTGGGGAGGGATGGGTTCTCCCAGAGGGCCACTTTCT
TTCTAATCAGACCCATGGAGGACATTTTCTCTGAAGACCTGCAGAAGTGATGATGTTTCA
AGCAGCAAAGGGTTTTTACAGCTCCTGCAGGGCAGACAGCTGTAAAACAGATGTATGCAT
GGGGAGCGGGGTGCACTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAG
GTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGACAATT
TTGGAAGTGGACACTGGGAATCACGAGGTCCCTGACAGGGTCACTGTATTTTGGGCTGGA
GACCTGGAGGCCCTCAAGGGCCTCTTATGGGGACCCAGCCCTGTCTCTGTGCTCCTCCAT
GAAGCACAGCAGGCTCCCGGTGTGGACTTGGTGTCAGCGCACTGGTTTCCTGAGGGCAGG
GCATATTGGTGGCTGTTCCCTGAGTCCTCATTCTCACCTTGTGTCTTTCAGTGAACTCTT
CAGCTCAGAAGGGGCCCTTGGCCTTGACTAGCATAGGTGAGTGCATCCTGCTGCCGTCAT
GGGCCATGAGTCAGGCCGCATGGGGTCACCGAGGGTCAGTCTTTAGGACAGGAGGGTTTC
CTCAGGGAGCCAACCTGTATTTCCACTGGGGAGGGACAGTTTCTCCAGGAGGGCAGCTTC
CTTGGGAATTGTACCCAAGACGTGGCTTTCCTGAAGCCCTGCAGGGATGGCAGTGGTCCA
GGCAGGTCCTTCATCCCCATGCAGAGGAGCTCCTAGCTAAGACTCGGTGCGTGTGTTGGC
CTCGAGGACTGCCCAGGCCACATGATGGGGGCCACAGGGCCTCCGGGGCACCACGGGGGC
CATGCAAGAGCTCTCTTTCCCCGGACAGGGGTGCTTGAATGAGCCCATGGGGTTGGGCCA
TGGAAATTCACGGATTGCACTGCAACCATGGCTCAAAATGGGACTGTTGCGCTATGGACC
ATCCCATGGCACCTCTTTGAGCTTGGTTGGGGGCAGTGCTATTTCCCTGGGTTTGGGTCA
AGGCTGAGCTCTGGCCAGCGCCTGGTGGGGCTGTGGGTCAGACCTGGGACTCATGGGCAT
TAGGCCAAGTCGACAGCCTGTGTCCTGCTGGAGGTCACCCCTTCCCCATGAGTGAGTGGC
TGGAAGAGTGGAATGTGTGGTGGGAAGGCCTGCTGTTGATGGTCCTGTCCCAGGAATTTG
CTGCCCAGGCTTTTTCTGTGCCATGGGGTCATGTCCAGAGAGGCAGGGTCTTGGGCCTAA
GGAAAGGAAAGTACACCATGTGGCCCAGGATTGGCCAAGGGTGGCCTGGCTCTGTGTTTG
GGACATGTGTGGGGCATTGATGGGGACCCACCAGAGAAAGCACATGGCCCTGGGACTCCA
GGCTGCGATTTCAGGTGTGACTTGGAGAGAGCACCTGGGCAGGTTCCCACCACGCCCAGG
AGCAGGCTATGCAACTTCCATGTCCACAGCAGCAGATGGCTTCTGGGCCAGCCTCCTCGG
TTGGCTATGAGCATATCAGTGACCCTGTCCCATGTTCAGTGGTCCTGGGGTAGACCTGGC
TGGTGCAAAGGAGAAGCCAGAGGGCGCACTGGAGGTGCCCTCAAGGTCTGCAGTAGCATG
AAGACCAGGGATCTTGCCCAAGCCCAGTGATCCACCTGCCCTGTTTTTTCAGGGTTTGAT
GATGGGAAGGGCCGGGGGTGCCCTGTATCCGTGACAGGTCAGTGTTCCACATGGATCCCA
TCACATGGGTATCCCTTACCCCATTCCCCACCTGGAGGTGTGAGGCCCTGTTCAGACACA
TGTCCTCCTCCTGTCCATCCAGATGGTGAGCCTGAAGGAAGACATGTCAGGACCAATGGA
CCCTGGCAAGCGTCCATCAGCCAGGTGCTCAGCCCCTGGTTCGCTGAAGCTCAGGCCCTT
CCTGGTGCCCTGGTCTCCTGCACTGACCTGTGGTGAGCACATCTGGGTCCTGCTGGATGC
ATGTGTGAGGAAGGGGGGTGCCCTGGGTTGGGTCAATGATGAGAACCCTATATCGTGTTG
AAGAGAGGTGATGACTTAAAATTACCATGCTCAATGATTACGCTGAGGCCCAACCTAGGT
GAGAAATTTGGAAGAGGTTGCTGGGATCCCAAGATTTCCGGCAGGGCCACTGTATTTTGG
GCTGGAGCCCTGGAGGCCCTGAAGGGTATCTGAAGGAGGTCCAACTCTGTCTCTGTGCTC
CTCTGTGAGGCAGCCCAGGCTCCCTGTGCGGGCTTGGTGTTGGCCCTTCTGTTCCCCAGG
GACATGGCACGTGGGTGGCTCCTCCCTGAGCCCTGGTTCTTCTCCCCTTGTGTCTTTCAG
TGAATTCTTCTGCCAAGGGGTGGCCTCCTGGCATTGACCAACATAGGTGAGTGGGTCCTG
CTGGTGTCATGGTCCATGAGCCAGGCTGCTTGGGGTTGCTGAGGGTCAGACTTTGGGCCA
TGAGGGTTTCCTCAGGGAGCCAACCCTAATTCCCACCAGCGAGGCATGGTTTCTCCAGGA
GGGCAGCTTCCTTGGGAATCTTACCTGAGGAGGATGCCTTCCCTGAAGCCCTGAAAGGGT
GATGATGGTCCAGATGGCAAAGGGTTCCTTCAGCCCCATGCAGGACATCGCCCATTTGAG
ACTTGGTGTGTGGGTCAGGTCTTGAGGACTGCCCAGGTCACATGAGGGGGGCCAGAAGGG
CTCCGGCGTGCCACGGGTATCACATGGGAGCTCTTGGTTCCCGGGCATGTTCCTGGGGGG
TGGTGACCGGGTTGGGCCACAGAGGTTCAAGGATCTCATCCCACCTGTGGCCCTGAATGG
GGCCGATCCTGTTGAACAATGGGCCATCCCAGTGGCACATATTGAGCCTGGTCAGGGGTG
GTGCAATTTCAATGGGGTTGGTCAAGGTTGAGATCTGGCTGGCTCCTGGTGGTGCTTCAG
GCCAGTCCTGTGACCCATGGGCTTTGGGCTGAGGGGGGCAGCCTGTATCCCATGGGGGTC
ACCTGTTCTCCATGTTTGAGTGGCAGTAACAGTGGCATTCTGAGGTGGGAAAGTCCACTG
TCTAGGGTATTGTACCGGGAATTTGCCACCCTGGCTTCTGAGCCATGGGGTCACCTCCAG
GTTCGCAGGATCTTGGGCCCAAGGAAACGAGAAGATACCATGTGGCCCTTGATTGGCCGA
GTGTGGCCTGGTTCTCTGTTTGGGACATGTGTGGGTTATGGATGGGGTCCCACCAGTGAA
AGCACATGGCCCGGGTCCCCAGGCTGTGATTTTCAGTGCACACTTGGGGAGGGCTCCTCA
GTGGATGCCCACCACACCCAGAGGCAGGTTTGTGACTGCCAGGTTTGCAATGGTGCATAG
CTTCCAGGCTACCCTCCTTGGTTGGCCAGGAGCGGGCTGGTGGCTGTGGTCCATGCCCAG
TGGTCACAGGGCAACCCTGGGATCATGCAAGGAAGCTGGCGGGGCCAGTGGAGGTGTTCT
CCCGACCAGAAGTAGGGTGCAGCCCAGGTGTCTGGCCCGAACCCAGTGACCAGCCTGCCC
TGTTTTTTCAGGGTTTGGTGATGGGGAGGGCCAAGGGTGCCCTGCATCCATGACCAGTCA
GTGTTCCACATGGAACCCATTACAGGGATATCCCTTACCCCCTTCTCCACATGGAGATGT
GAGGCCCTATTTGGACACATGTCCTTCTCCTGTCCCCTCAGATGGTGAGCCTGGAGGAAG
ACTTGCATTGGGCCCAATGGCCCTGGACCAGTGTCTGTCAACCAGTTCCCAGTCCCAGGT
GCACTGAAGCTCAGGCCTCTCCTGGTGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCAT
ATCCTGGTCCTGCTCCATGCAAGTGCGGGGAGGAGTTGTCCTAGGTTGGGTCAATGATGA
GAACCTTATAATGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACG
CTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACACTCGGATCCCAAAGTCCCCGGG
AGGGCCCTTGTATTTTAGGCTGGAGACTTCAAGGCTCTGAAGGGCATCTGGAGGTGGCTC
AACCTGTCTCTGCTCTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGTGGGCTTGCTGTGGC
ACTCCGGTTCCCTGGGCCGGGGAACATTGGTGGCTCCTCCCTGAGTCCCTGTTCTCCCCT
GTGTCTTTCAGTGAGCTCTTCTGCTCAGGCAGGCCACCTGGCATTGACCGGCATAGGTGA
GTGGATCCTGCTGTGGTCATGGGTCATGAGCCAGACCACAGGAGTCCCCCAGGGTCAGTG
TTATGGCCATAAGGGTTTTTTCTCAGGAAGCCAACCTGAATTCCCACCGGGGAGGCATAG
GTTCTCCAGGAGGGTGGCGTTTTGGGGAATCAGACCCAAGGGGGACACCTTCCCTGAAGC
CCTGCAGGGTTGATGGTGGTCCAGGCAGGAAAGGGTTTTTTTCAGCCCCACACAGGGCAG
CTCCTAGCTGACACTCGGTGCTTGGGTCAGACCTCAAGGATTGCCCAGGCCACGTGAGGG
GGACTGAGAGCCTCCAGGGTGCCACAGGGGTCACATGGGAGTTCTCGGTGCCTGGCATGT
GGTGCACAAATGGGCCTCTTGGGTTTGGTCATGGAGATTCAAGGATCTCACCCCACTATG
GCCCTGAATGAGACGGTCCCTGTTGAGCAATGGGCCATCCCAGTGGGTCTCCTGGAGCCT
GGTTGGGGGGTGGTGTTTTTTCCCCGGGGTTGGGTGAAAGCGGAGTTCTGACCGGCACCT
GGTGGTGCTGCAGGTCAGCACTGGGACTCATGGGCGTTGGGCCAAGGGGGAGCCTGCATC
CCACTGGGGAGTCACCCTTTTTCTGACGTCAAGTGTCTGGAAGTGTGGCCTCCTGAGGTG
GAAAGGCCTGCTGTTGAGGGCCGTGTCCCGGGAATTGGTCGCTCAAGCTTCTTCTGAGTT
TTGGGCTCACATCCGGGGTGGCGGGGTCTTGGGCCCAAGCAAAAGAGAGAGCACCATGTG
TCTCCCGATTGACCAAGTGTGGCTGTCTGTGTGTGTGGGAGGTGTGTGGAGTATGGATGG
GGACCCACCAGAGAAAGCACGTGGCACTGCAGCCCCAGGCTACGATTTCTGGTGCATGCT
TGGAGAGGGTGCCTGGACAAGCATGCCGTGCCCAGCGGCAGGCTTTGCAACTGCCAGGTT
TTCAGCAGGTTGTGACATCTGGGCCAGCCTCCTTGGTTGGCCGTGACCTGGCTGGTGGCC
CAGGTCTGTGCCCAGTGGCCCCAGGGCAGCCCTGGGGTCATGCAGGGGAGGCATTTTGAA
CAGTGGAAGTGCTCTGGGGGCCTGTAGTATAGTGCAGCTTAGGTGTTTTGCTCAAGCCCA
GTGACCCACCTGCCCTTTCCTTTTTGGGTTCGTGGAAGGGAGGACCACGTACTTCACAGT
GCACCATGTACTTAACGAGTCAGTATTTCACATTGAACTCATCACATGTGTCCATGGAGG
GCGAGCAAGGGTGAGCTGGCACCCCTGACCCCCTTCCCCACATGGAGGTCAGTTTGGACA
CAAGTCTTCCTCCTGTCTCCCCAGATGGTGACCTCAGAGGGAAACTTGTGTTGGGCCCGC
TGTTCCTGGGCCAATGTCAGTCAGCCAGGTACCCAGCCCCCAGTGTGTTGAAGCTTGGGC
CCTTCCTGGTACTCTTGGCTCCTGCACTGAGCTGTGGTCAGTCCATCTGGGTCCTGCTGG
ATGCATGCGCAAGGAGGGGGTACCCTGGGTTGGGTCGATGATGAGAACCTTAAATTGTCC
TGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCAGCCTAG
GTGAGAATTTTGGCAGAGGGCACTGGGATTCTGAGGTCCCTGACAGAGCAAATATATTTT
GGGCTGGAGACCTTGAGGCCCTGAATGGCTTCTGGTGGGCTCAACCCTGTCTCTGCGCTC
CTCCGTGAGACAGCCCAGGCTCCCTGCACTGGCTTGGTATCTGGGCTTCAGGTTCCCGGG
GGCAGGGCACATTGGAGGCTCCTTCCTGAGCCCCCACTCTCCCCTGTGTCTTTCAGTGAG
CTCCTCTGTCCAAGTGGTCCCCCCAGCCTTGAGCAGCATAGGTGAGGACATCCTGTTTTG
GTCATGGGCCATGAGTGATGCAGCATGGGGTCCACGACATTCAGCCTTCAGGCCACTAGG
GTTTTCTCAGGCTGCCAACCTACTCCCCACCAGGGAGGGATGGTTTCTACAGGAGGGCTG
CTTCCTTTGGAATCTGACCCAAGGAGCATGCCTTTCCTGAAGCCCTGCAGGGGTGACAGT
GGTCCAAGCAGGAAGGGATTCCTTCAGCCCAAGGTAGGGCAGCTCCCAGCTGAAACTTGG
TGGCCAGGTCAGGCCTGGAGTACTGCCCCGGGCACAAGGGGAGGTGGGGCACAGGGGATG
CAGTGCACCCTGGAGGTCACACTGGAATTCTCTCTCCCTGGAGTGGGGTGAGTGACTGGG
TCCACATGGTCAGGCTGTGGAGGTTCAAGGAATGCTCCACACCCATGGCCTTGAATGGGA
CCCAACCCTGTTGAGTAATGGGCCATCTTAGTGGCACCTCCTTGAGCCTGGTTGGGGACA
GCACTCTTTCAGTGCTTTGGGGTCAAGGCTGAACTCTGGCTGGCACCCGGTGGTGCTGCA
GGCTGGCTCTGACACTTGGGGGCTTTGGGTCAAGGGGGCATGGGTCACCTCAGGATGGCA
AGGTCTTGAGTCCAAGGAAAGGAGATGACACCATCTGGTTCCTGATTGCCTGAGTGTGAC
TGGGCTCTGTGTGGCGGAGTTGAGCAGGGCATGGATGGGTACCTACCAGAGAAAGCATGT
GGTCCCTAGGCTCGGAGAGGGCACCAGGGCTCATGCCCACCACACTCAAGTGCTGGCTCT
GGGACAGCCAGATCTGCAGTGGCTGTTGGCATCTGGGCCAACCACCTAGGTTGGTCAGGA
GCTGGTTGATGGTCCTGTCCTGTGCCCTGTGTTCCCAGTATGGCCCTGGGGTCATGTGTG
GGAGCCGGCCTGAGCAGTGGAGGTGCTCTTGGGGCCTGCAGTAGAGTGCAGCCCAGGCAC
CTTGCCCAAGCCAGGTGACGTGCTTGTCCTGTCTTTCCAGGGTTTCATGACAGGGAGGGC
CAAGGGTACCCAGTATCCGTATTGGGTCAGTGTTCAGTATGGATCCCATCACATGAGTTT
CCCTTAACCCCTTCCCTGCATTGATGTGTGAGGCCCTGGTTGGACACATGTCCTCCTCCT
GTCTCTCCAGATGGTGAGCCTGGAGGAAGACTTGTGTTGGACACGCAGGCCGAGGGCCAG
TGTCTGTCAGCCAGGTGCTCAGCCCCCAGTAGGCTGAAACTCTGACCATTCCTGGCACCC
TGCTGTCCTGCACTGTGCTGTAGTGAGCACATCTGGGTTCCAGTGGTTGTTTGTGCAGGG
AGGGGGCTCCCTAGGTTGGGTCAATGATGAGAACAGGGCCACATAAGGGGGACCAGAGGA
GCTACGGGGTGCTATGTTGTAACAAGGGAGCTCTTGGTCCCTGGAGTATGGTGTGTGAAT
GGGCCCATGGGGTTGGGTAGCAGAGATTCAAGGATCCCACCCTACCCATGGCCCTGAATG
TGACCATCCCTGTTGAGCAACGGGCCATCCCAGTGGGTCTCCTGGAGCCTGGTGGAGGGT
GGGTTATTTCCCTGGGGTTGGGTCAAGGTTGGCTCTGGCTGGCACCTGGTGGTGCTGCAG
GTCAGCCCTGGGACTCATGGGCTTTGGGCCAAGGGGCAGCCCACATCCCGCTGGGGGCCA
CCCAAGTGTGAAAGGTGGCCTCCTGAGTTGGGAAGGCCCACTACTGAGGCACCTGTACTG
GGAATTTGTTGCTCATGCTGCATGGGAGTCATGGTATCACCTCCAAGGTGGCGGGGTCTT
GGGACCAAGCAAAGGGGAGGGCCCCTTGAGTCTCCGGATTGGCTATGTGTGACTGGCTCT
GCGTCTGGGAGGTATGTGGAGTATGGACGGGGACCCACCAGAGAAAACAAGTGGCCCTGA
GGCCCCAGGCTCTCTTTTCTGGTGCCTGCATGGAGAGGGTGCCTGTACGCATGCCCCGCA
TGCCCAGGTGGCGCATGGCAGATGGGCCAGCCTCGTTGGTTGGCTGTGACCTGGCTGGTG
GCCCGGACCTGTGCCCAGTGGTCCCAGGGCAGCCCTGGGGTCATGTGGAGGAGCTGTTTT
GGCCAGTGGAAGTGCTCTCAGGTCCTGCAGTCCTGCATACCCTGGGCATTTTGCCTGAGC
CCAGTGAGCTACCTGTCTCGTCCTTCACAGCTTCGGTGGCAGGGAGAGACACCTGTGAAG
GTGATGAGTCAGTATTTTGCATGGATCTCGTCACATGTGTCCATGGAGGGGGAGCAAGCA
TGAGCTGGCACCCAACACTCCCTTCTCCACATGGAGGGAGTGTCCTCCACCTGTTTCCCC
AGATGGTGAGGCTTCTGTTGGGCTCGCTTTTCCTGGGCCAGTGTCCATCAGCCAGGTGCT
TAGCCCTCGGTGCACTGAAGCTCCAGCCCTTCCTGGTGCCCTGGTCTCCTGCAATGCGCT
GTGGTGAGCACATCCGAGTTCCACTGGATGTTTGTGTGGGGAGGGGGTTCTCTGGGTTGG
GTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCA
ATAGGATTACGCTGAGGCCCAGCCTAGGGGAGAATTTTGGAAAAGGGTGCTGGGATCCCA
AGGTCCCCATCAGGGCCAGTGTATTTTGGACTGGAGACCTGGAGGCTCTGAAGGGCATCT
GGAGGTGGTCCAACCTATCTCTGTGCTCTAGGTTCCCTGTGTGGGCTTGGTGTCGGTGCT
CCGGTTCCCCAGGGGCAGGGAATGTTGGTGGCTCCTTCCTGAGTCCCTGTTCTCGCCTTT
GTCTTTCAGTGAGCTCTTTCACCTAGGAGGACCGCTTGGCATTGACTGACATAGGTGAGT
GGATCCTGCTGGTGTTATGGATCATGATCCAGACCATGTGGGGTCCCCGAGGATCAGCCT
TTGGGCCACAAGGGTTTTCTCAGGGAGCAGACCTGAATTTCCACCTGAAACGGAAGGGTT
CTCCTGGAAGGCAGCCTTTTTGGAATCAAACCCAAGGAGGACACCTTCTCTGAAGCCCTG
AAGGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCTCCCCAAAGCAGGACAGTGCCC
AGTTGAGACTTGGTGCTGTGGTAGGGTCTTGAGGACTGCCCAGGCTACATGAGGGGGGCC
AGAGGGGCTACGGAGTGCCACGGGGATAATGGGGAGCTCTCGGTCCCCAGAGTGTGGTGC
GTGAATGGACCCATGGTGTTGGGTTGTATAGATTCAAGGATTGTGCCCCACTTATGGCCC
TGAATGCGACTGTCCCTGTTTAGCAATGGGCCATCTCAGTGGGTCTCCTGGAGGCTGTTG
GGGGGCGGAGTTGTTTCCCTGTGAGTGGGTTAAGGTGGAGCTCTGGCCGGCATCTGGTAG
TGCTGTAGGTCAGCCCTGGGACTCGTGGGCTTTTGGCCAAGGGACAACCTGCATCCCCCG
GGGGTCATCCTATCTCCGAGGTCAAGTGTCGTAAAGGGTGGCCTCCTGAAGTGGGAAAGC
TTGCTGTCGAGGAACCTGTCCTAGGATTTTCTGCTCAGGCTGCTTCTAAGCCGTGGCGTC
ACCTCCAGGGTGATGGGGTCTTGGGAACAAGCAAAGGAGAGGGCACCATGTTGCTCCGGA
TTGGGCAAGTGTGGCCTAGCTCTGTGTGTGTGAGGTGGGCAGAGTATGGATGGTGACCCA
CCAAAGAAAGCATGTGACCCTGCAGCTCTAGGTTGTGGTTTCCACGCACACTTGGAGATG
GCATCTTGATGCGTGCCCAACACGCCTAGGGGCAGACTATGCGATAGCCAGGTCTGCAGC
GGTGTGTGGCATCTGGGCCAGCCACCTTGGTTGGCCATGAGCTGCCTCATGGCCCTGGCC
CATGCCCACTTGTGCCAGGGAGGCCCTGGGGTCGTGTGGGGAGCCATCTTTGGCAGTGGA
GATGGATTCGGGGCCTGCAGTATGGCACAACCCGTGCATTTTGCCTGAGCCCAGTGACTT
GCCTGCCCTGTTCCTCCAGGGTTTGGTGGCAGGGAGGGCTAAGGGTGTCCTGCGTTGGTG
ACGAGTCAGTACTTCACATGGATCTCATCGCATGTATCCATGGAGGGCGAGCAAATGTGA
GCTCCCACCCCCTACTGCCTTCCCCACATGGAGGTCAGTTTGGACACATACCATCATGCT
GTCCCCCAGATGGTGAGACCGAAGAAAGACTTGCATTGGGCCCACTGTTCTTGGGCCAAT
GTCAGTCAGCCAGGTGCCCAGCTCCAAGTGCGCTGAAGCTTGGGCCTTTGCTGGCATGCT
CAGCTCCTGCACTGAGCCAAGGTGAGCACATCGGGGTCCTGCTAGAAGCATGGGTGGGGA
GGGGTGTGCCCTGGGTTAGGCTGATGATGAGAACCTTATATTGTTCTGAAGAAAGGTGAT
GAATTAAAAATCATGCTCAATAGGATTACACTGAAGCCCAGGATAGGTAAGAATTAGGGA
AGACGATGCGGGGATCCAAAGATCTCTAGCAAGGCCACACTTATTTTGCACTGGAGAACT
TGAGAACATGAAGGGCATCTTGTGGGGGCCCAGCGCTGTCTGTGTACTCCTTCGTGAGGC
AGCCCAGGCTCCCCTTGAAGGCTTGGTGTCCGTGCTCCACTTCCCCGGGGACAGGGCAAT
TTGATGGCCCCTTCCTGAGCCCTCCTTCTTCCCTGTGTCTTTCAATGAGCTCTTCTGCCC
AGGTGAGGCCCCTGGCTTTGAGCGGCATAGGTCAGTGCATCCTGTTGGGGTCATGGGCCA
TGAGTGAGGCAGCATGGAGTCATCGAGAGTCAGCCTTTGGGCCAACTAGGGTTTTCTTAG
GGAGCCAACCGAATACCCACCGGGAGGGATGGTTCCTCCAGGAGGATCGCTTCCTTGGGA
ATTTGACCCTAGGAGCACGCATTTCCTGAAGCCCTGCAGGGTGACGGTCCAGACAGGAAA
GGGTTCCTTCAGCCCAACAGAGCAGCTCCCAGCTGAAACTCGGTGGGCATGTCAGGCCTC
GAGGACTGCCGAGGCCACATGATGGAGGCCACAGGGGCTCTGGGGTGCCCTGGGGGTCAT
GCTGGAGTTCTTCCCCGAAGAGGGGTGGGTGATAGGGCTCACCCAGTCAGGCTGCGGAGA
TTCGAAGAATGCGCCCCACCCACGGCCCTGAATGGGACCAGCCCTGTTGAGCAATGGGCC
ATTTTAGTGGCGCTTCCTTGAGCCTGTTGGGGGTGGCGCTGTTTCACTGCAGTTGGGTCA
AGACTCAGCTGTTGCCTGGTGGTGCTGTGGGCTGGTCCTGGGGCTCATGGGCTTTAGGCC
CAGGGGGCAGCTCCTGTCCCACTGGGGTAATCCCTTCCTTGAGGTCCAGTGGTGGGAAGA
GTGGCCTCCTGAGGTGGGAAGACCTGCTGTCAATGGGACCTGTCCTGGGAATTTGCCACC
TAGGCTGCTTCTGAGCCATGGAGTCACCTATAGGGTGGCAGGGTCTTGAGCCCACAGAAA
GGAGAGTACCATGTGGTTCCTGATTGGCTGAGTGTGGCCCGGCTCTGTGTGTGGGAGGTG
TGCAGGGCATGGATGGGGCTCATCAGAGAAAGCATGTGGCCCTGGAGGCCCCCGGACTTT
GATTTCTGGTACATGCTTGGAGTGGGCACCAGGGTGGCCCTACCATGCCCAGGGCAGGCT
CTGTGACTGCCAGGTCTGGAGTGGCTCTTGGCACCAGGACCAGCCTCCTTGACTCAACCA
ACCTTGAGCAGGTTGGTTGCCCTGGTCCCAGTGCGACCCTGGGGTTGCTCGGGGGATCCG
GCCCGGGCAGTGGAAGTACTCTTGGGGCCTGCAGTAGGGCACAGGCCAGACCTCTCGCCC
GAGCCCAGTAACCCGCTTGCCCTGTCTTTCCAGGGTTTGGTGGCAGGGAGGGCCAAGGGT
GCTCACTCCACGTCCGTGTTGGGTCAGTGTTCTGTAAGGATCCCATCACAAGGGTATCCC
CTAACCACCTTCCCTGCATTGATACATGAGGCCCTGGTTGGACACATGTCCTCCTCCTTT
CCCTACAGATGGTGACCCTGGAAAAAGACTTGCGTTGGGCCCGAAGGCCCCGGGGCCAGT
GTCCATCAGCCAGGTGCTCAGCTCCCAGTGCACCGAAACTCCGACCCTTCCTGGTTTCCT
GGTCTCTTGCACTGGGCTGTGGTGAGCACAACCAGGTCCCGCTGGATGCATGTGTGGGGA
GGGGGGTGCCCTGAGTTGGGTTGGTGATGAGAACCTTATATTCTTCTGAAGAGAGGTGAT
AACTTAAAAATCATGCTCAATAGGATTATGCTGAGGCCCAGCCTAGGTGAGAATGTTGGA
AGAGGGCGATAGGATTCTGAGGTCCTTGGCAGAGCCACACTCTATTTTGGGCTGGAGACC
TGGAGTCCCTGAAAGGGCATCTGGTAGGAGCCCAACCCTGCCTCTGCAATCCTGCATGAA
GGTCCCCAGGCTCCCTGTCCAGGCTTGGTGCTGATGCTCTGGTACCCCAGAGACGGAACA
GGTTAGTGACTCTTTCCCGAGCCCCCGTTCTCCCTTTGTGTCTTTCAGTGAGCTTTTCCA
CCCAGGTGGGTACCCTGGCATTGACTAGCCTCCTTGGTTGGCTATGACCTGGCTGGTGGC
CCGGGTCTGTGCCCAGTGGTCCCAGGGCAGCCCTGGCGTCATATGGGGGAGGTGTTTTGG
GCAGTGGAGGTGCTCTCCAGGCCTGAAATACAGCACAATCTGGGCATTTTGCCTGAGCCC
AGTGACCTGCCTGCCTTGTCCTTCCTGGGTTTGGTGGCACGGAGGGCCAAGGGTGCCCTG
TGTCAGTGATGAGTCAGTATTTTGCATGGATCTCATCACGTGTCCATGGAGGGAAAGCAA
GCATGAGCTGGTACCCAACACCCCCTTTTCCATATGGAAGGTGGTCACATGTCCTCCACC
TGTGCCCCCAGATGATGAGAATTGAGGAAGACTTCCATTGGGCCTGCTTTTCCTGAGCTA
GTGTCCGTCACCCAGGTGCTCAACCCTTGGTGCACTGAAGCTCCAGCTCTTCCTGGCTCC
CTGGTCTCCTGCACTGAGCTGTGGTGAGTACATCCGGGTTCCACTGGATGTTTGTGCAGG
GAGGGGGTTCTCTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAAAGGTGA
TGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATTTTGG
AAGAAGATGCTGGGATCCCGAGATTTCCAGCAGGGCCACTATATTTTGGTTTGGATGGAG
GCCCTGAAGGGCATCTGGAGGTGGCCCAACTCTTTCTCTGTGCTCCTCCATGAGGCAGCC
CAGGCTCCCTGTGCGGGCTTGGTGTTGGCCTTCCTGTTCCCCAGTGACGGGACACATCAG
TATCTCCTCCCTGAGCCCCCGTTCTCCCCTTGTTTCTTTCAGTAAGCTCTTCTGCCAAAG
GGGGGCCTCCTGGCATTGACCAACATAGGTGAGTGGATCCTGCTGGCGTCATGGGCCATG
AGCCAGGCCGCATGGGTTCGCCAGGGGTCAGACTTCAGACCCTGAGGGTTTCCTCAGGGA
ACTGACCTGAATTCCCACGAGGGAGGGATGGTTTCTCCAGGAGGTCAGCTTATCCGAGGA
ATCTTACCCAAGGAGGATGCCTTCCCTGAAGCCCTGCAGGGGTGACGACGGTCCATATGG
CAAAGGGTTCCTTCAGCCCCACACAGGACATCACCCAGTTGAGACTTGATGTGCGGGTCA
GGCCTTGAGGACTGCCCAGGCCACATGATGGGGGCCACAAGGGCTCTGGGGTGCCATGGC
TGTCATGCAGGAGCTCTCAGTCCCCAGACTTGTTTCGTGGGGGTGGTGATGGGATCGGGT
TGTGGAGGTTCAAGGATCTCATCCTACCTGTGACCCTGAATGGGGCCAACACTGTTGAGC
AACAGGCCATCCCAGTGGCACGTATTGAGCCTGGTGGGGTGTGGTGCAGTTTCAATGCAG
TTGAGCTAATGCTGAGATCTGTATGACGCTTGGTGCTGCTGCTGGCCAGCCCTGGGACCC
ATGGGCTTTGCGCTAAGTGGGTAGCCCACATCCCACTGGTGGTAACCCATTCTCCGAGTT
TGAGTAATGGTTAACAGTGGCATTCTGAGGTGGGAAGGCCCACTGTCTAGGGTCCTATAC
TGGGAATTTGCCGCCCCGGCTTCTTCTGAGACATGTGGTCACCTCCAGGGTCGTGGGGTC
TTAGGCCCAAGGAAAGGAAAAGGTACCATGTGGCCCTTGATTGGCCAGGTGTGGCCCAGG
TCTGTTGGGGAGGTGTGTGGGATATGGATGGGGTCCCACCAGTGAAAGCATGTGGCCCAG
GTCCCCAGGCTGTGATTTTCAGTGCACATTTGGACAGGGTGCCTCAGCATGTGCCCACCA
CGTCCAGGGGCAGGGTATGTGACTGCCAGGTTTGCAATGGTGCGTAGCTTACGAGCTACC
CTCCTTGGTGGGCCAGGAGCTGGTTGGTGGCTGTGGCCCATGCCCAGTGGTCACAGGGCA
GGCAGACTGTCCTGTTTTTTCAGGGCAGGGGAGGGCCAAGGGTGCCCTGCATCCGTGATG
GGTCCGTGTTCCACATGGAACCCATTACGTGGGTATCTCTTACCCCTTCTCCATATGGAG
ATGTGAGGACCTATTTGGACACATATCCTCCTCCTGTACTCCCAGATGGTGAGCCCGGAG
GAAGACTTGCATTGGGCCCAATGACCCTGGTCCAGTGTCTGTCGGACAGGTTCCCAGACC
CCGGTGCAGTGAAGCTCAGGCCTTTCCTGGTGCCCTGGTCTCCTGCACTGAGCTGTGGTG
AGCATATGCTGGTCCTGCTGGATGCATGTGCAGGGAGTGGGGTGCCTTGGGTTGGGTCAA
TGATGAGAATCTTATATTGTTCTGAAGAAAGGTGATGACTTAAAAATCATGCTCAATAGG
ATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACACTGGGATCCCGAAGTC
CCTTGCAGGGACCCTGTATTTTGGGCTGGAGACCTCAAGGCTCTGATGGGCATCTGGAGG
TGGCCCAATCTGTCTCTGTGCTCCTCTGTGAGGCAGCCCAGGCTCCTTTTGTGGGCTTGG
TGTTGGTGCTCTAGTTCCCTGGGCCAGGGAACGTTGGTGGCTCTTTACTGAGCTCCGGTT
CTCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGGCTCCCTGGCATTGACGGGCAT
AGGTGAGTGGATCCTGCTGGGGTCATGGGCCATGAACCAGGCCACGTGGGGTCACCAAGG
GTCCCTCTTCTGGCCACGAGGGTTTTCTCAGGGAATGGACCTGTATTACCACTGGGGAGG
CGTAGGTTCTCCAGGAGGGCTGCTATTTTGGGAATTGGATCCAAGGGGGACACCTTCCCT
GAAGCCCTGCAGGCGTGATGGTGGTCCAGGCGGGAAAGAGTTTCTTCCACCCTGCACAGG
GCAGCTCATAGCTGAGAGTTGATGCTCGGGTCAGGCCTCGAGGATTTCCCAGGCCACATG
AAGGGGACAGAGGAGCTCTGGGTACCATGGGGGTCACATAGGAGCTCTCAGTATTTGGTG
TGTCATGCACAAATGGGCCTCTTGGATTGGGTCATGGAGATTAAAGGATCGTGCACCACC
ATGGCCCTGAATAGGACCGTCCCTGTTGAGCAATGGACCATCCTAGTGGGTCTCCTGGAG
CTTGGTGGAGGTGGGAGGCGGCATTGTTTCCCTGGGTTTGGGTCAAGGCAGAGCTCTGGC
CAGCACCTGGTGGCTTCTGCAGGTCAGCCTTGGGACTCATGGGCATTGGGCCAAGGGGGA
ACCCGCATGCCATTGGTGGTCAGTGTCAAGTGTCTGGAAAGGTAGCCTCCTGAGGTGGGA
AGGCCTGCTGTCGAGGGACGTTTCCTAGGAATTTGTTGCTCAAGCTTCTCCTAAGCTTTG
GGGTCATATCCAGGGTGGCAGGCTCTTGGGCCCAAGCAAAACAGAGGGCACCATGTGGCT
CCTGATTGGCCATGTGGCTGTCTCTATGTGTGGGAGTTTGCAGAGTATGGATGGGGACCC
ACCAGAGGAAGCACATGGTCCTGCAGCACCAGGCTGTGATTTCTGTTGCACACTCGGAGA
GGGTGCCTGGATGCGTGCCCTTCATGCCCGGCAGCAGGCTATGCAACTACCAGGTTTGCA
GCAGGGTGTGACATCTGAGCCAGCCTCCTTGGTTGGCCGTGACCTGGCTGGTGGCCTGGG
TCTGTGCCCAACAGTCCCAGTGCAGCCCTGGGGTCATGCAGGGGAGCCATTTGGGACAGT
GGAGGTGCTCTCAGGGCCTGCAGTGTCATGCAGCCTGGGTGTTTGCTGAAACCCAGTGAC
CTACCTGCCCTGTCCTCTCTGGGTTGGGTGGAAGGGAGGGTCAACAGTGCACCACGTACT
TAAGGAGTCAGTATTTCACATTGAACTCACCACATGTGTCCATGGAGGGCGAGCAAGGGT
GAGCTGGCACCCCCAACCCCCTTTCTGACGTGGAGGTCAGTTTTGACACGTCTTCATCCT
GTCTCCCCAGATGGTGACCCTGGAGGAAAACTTGTGTTGGGCCCGCTATCCCTGGGCCAA
TGTCGGTCAGCCAGGCACCCAGCCCCTAGTGCACTGAAGCTCAGGACCTTCCTGGAGCCT
TTGGCTCCTGCACTGAGCTGTGGTGAGCCCATCTGGGTCCTGCAGGATATATGCGCTGGG
GGCAGGAGGGTGCCCTGGGTTGGGTCAGTGATGAGAACCTTATATTGTTCTGAAGAGAGA
TGATGACTTGAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTT
TGGAAGAGGACACTGGGATTCTGAGGTCCCTGACAGAGCAAATGTATTTTGGGATGGAGA
CCTTGAGGCCCTGAAGGGCATCTGGTGGACCCAACCCTGTCTCTGCACTCCTCTGTGAGG
CAGCCCAGGCTCCCTGTGCTGGCTTGGTATCCGGGCTCTGGGTCTCTGGTGACAGGGCAT
GTTGGAGGCTCCTTCCTGAGCCCCCACTCTCCCCTGTGTCTTTCAGTGAGCTCCTCTGAC
CAAGTGGTCCCCCCTGGCCTTGAGCAGCATAGGTGAGGACATCCTGTTTTGGTCATGGGC
CATGAGTGATGCAGCATGGGGTCCATGACATTCAGCCTTCAGGCCCCTAGGGTTTTCTCA
GGCTGCCAACCTACTCCCCACCAGGGAGGGATGGTTTCTCCAGGAGAGCTGCTTCCTTTC
GAATCTGACCCAAGGAGCACATCTTTCCTGAAACCCTGCAGGGGTGACAGTGGTCCAGGC
AGGAAGGAGTTCCTTCAACCCAATGTAGGGCAGCTCCCAGCTGAAACTCGGTGGCCAGGT
CAGGCCTGGAGTACTGCCCAGGGCACATGGGGAGAGGGGCAGGAACAGGGGATGTAGTGT
GCCCTGGAAGTCACACTAGAGTTCTCCTTCCCTGGAGAGGGGTGAGTGACTGGGCCCACA
TGGTCAGGCTGTGGAGATTCAAGGAATGTTCCACACCCATGGTCTTGAATGGGACCCAAC
CCTTTTGAGCAATGGGCCATCTTAGTGGCACCTCCTTGAGCCTGGTGGGGAATGGCACTG
TTTCAATGAGGTTGGGTCAAGGCTGAGCTCTGGCTGGCACCTGGTGGTGCTGCAGGGCCT
GGGATTTGTGGGCTTTGGGCCAAGGGAGCAGCTCTGATCCTGCTGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAATTTGCTGCCCAGACTGCTT
CTGAGTCTTGGGGGTCACCTCAGTGTAGCAGGGTCTTGAGCCCAAGGAAAGGAGAATACA
CCGTGTGGTTCCTGATGGGCTGAGTGTGACCTGGCTCTGTGTGTCAGAGTTGGGCAGGAC
ATGGATGGGGACCCACCGTAGAAAACATGTGACCCTGGAGGCCCCTAGGCTTGGAGAGGG
CACCACGGCCAGTGCCCACCACGCCTAGGTGCAGGACTGCCAGGTCTGCAGTGGCTCTTG
GCCTCTGGGCCAACATACTTGGTTGGCCAGGAGCTGGTTGGTGGCCCTGTCCTCTGCCCC
GTGTCCCTGGTGTGGCCCTGGGGTTGTGTGTGGGAACAGGCCCGGGCAGTGGAGGTGCTC
TTGGGGCCTGCAGTAGGGTGCAACCCAGACATTTTGCCTGAGCCAAGTGACATGCTTGCC
CTGTCTTTCCAGGGTTTGGTGGCAGGGAGGGCCAAGGGTACCCAGTGTCCGTGTGGGTCA
CTGTTCAGCATGGATCCCATCACATGAGTATCCCTTAGCCCTTTCTCCACATTGATGTGT
GAGGCCCTGGTTAGACACATTTCCTCCTCCTGTCCCTCCAGATGGTGAGCCTGGAGGAAG
ACTTGTGTTGGCCCACAGGCCCCAGGCCAATGTCAGCCAGGTGCTCATCCCCTGGTGTGC
TGAAACTCTGGCCCTCCGTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCATATCC
TGGTCCTGCTGAATGCAAGTGTGGGGAGGGATTGTCCTAGGTTGGGTCAATGATGAGAAC
CTTATAATGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGA
GGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACACTGGGATCCTGAAGCCCCCTGCAGGG
CTCCTGTGTTTTGGGCTGGGGACCTGGAGGCCCTGAAGGGCATCTGGTGGACCCAACTGT
ATCTCTGTGCTCCTCCATGAGGCAGCCCAGCCTCCCTGTACTGGCTTGGTATCTAGGCTC
TGGGTCTCCAGGGACGGGACACGTTGGAGACTCCTTCCTGAGCCCTCGTTCTCCCTTTGT
GTCTTTCAGTGAGCTTTTCCACCCAGGTGGGCCCCCTGGCATTGACTGACATAGGTGAGT
GCATCCTGCTGGGGTCATGGGCTATTAGATAGTCAGTGTAGGGTCACTGAGGTTCAGCTT
TTGGGCCACAAGGGTTTTCGCAGGCAACCGACCTGAACTCCCACCTGGGAGAGATGGGTT
CTCCAGGAGGGCAGCTTTTTTAGGAATCAGACTCAAGGAGGATGCCTTCCCTGAAGCCCT
ACAGGGGTGATGGTGGTCCAGGCGGGAAAGGGTTCCTTCTGCCCAACTCAGGGCCCAACG
CAGGGCAGCGCCCCCTTGAGAATTGGTGCTCTGGTAAGGCCTGGAGGACTGCCCAGGCCA
CGTGAAGGAGGTCAGAGGGGCTACAGGGAACCATGGGGGTAACAGGGGAGCTCTTGGCCC
CCCGAGTGTGTGAATGGGCCCGTTGAGTTGGGTTGCGGAGATTCAAGGATCGCACCTGAC
CCATGGCCCTGAATGACCATCCCTGTTGAGCAGTGGGTCATCCCAGTGGGTCTCCTGGAG
CCTGGTGGGGGTCGGCGTTGTTTTCCTGGGGTTGGGTCAAGGTGGAGCTCTGGCTGGTAC
CTGGTGGTGCTGCAGGTCAGCCCTGGGACTCGTGGGCTTTGGGCCAAGAGGCAGCCCACA
TCCCACTGGGGGTCACCCTTTCTCTGAGGTTGAGTTTCATGAAGGGTGGCCTCCTGAGGT
GGGAAGGCCCACTGTTGAGGCACCTAGACTGGGAATTGTTCCTCAGGCTGCTTAGGAGCC
ATGGTGTCACCTCCAAGGTGGTGGGATCTTGGGACTAAGCAAAGGAGGGGGCACCATGTG
GCTCCCAATTGGCCATGTGTGGCTGGCTGTGTGTCTGGGAGGTGTGTGGAGTATGGATGG
GTCCCCCCAGAGAAAGCAAGTGGCCCTGCAGTCCTAGGAGGTGATTTCTGGTGTAGGCTT
GGAGAGGGTGCCTATATGCGCGCCCACCATACCTAGGAGCAGGCTATGCCACTGCAGAGT
CTGCAGTGACACCTGGCATATGGGCCAGCCTCCTTGGTTGGCTGTGACTTGGCTGGTGGC
CTGTGCTTGTGCCCAGTGGTCAGGGCAGCTCTGAGTTAATGCAGGGGAGCCATTTTGGGC
AGTGGAGGTGCCCTCGGGTCCTACAGTATGGCACAGCCTGGGTGTTTTGCTCAAGCCCAG
TGACCTGCCTACCTTATCCTTCCCGGGTTCGGTGGCAGGGAGAGCCAAGGGTGCCCTGCA
TTGGTGACGAGTCAGTATTTTGCATGAATCTCATCACATGTGTCCATGGAGGACAAGCAA
GCATGAGCTGGCACCAGCCGCCCCCTTCTCTGCATGGAGGGTGGTTATGTGTTTCCCTAG
ATGATGAGACTGGAGGAAGACTTCCGTTGGGCCCACTTTTCCTGGGCCAGTGTCCATCAG
CCAGGTGCTTAGCCCCAGTGCCTTGAAACTCCGGCCCTTCCTGGCACGTGGTCTCCTGCA
CTGAGCTGTGGTGAGTACATCCGGGTTCCACTGGATGTTTATGCGGGTAGGGGTTTTCTG
TGTTGGGTCAATGATGAGAACCTTAAATTGTCCTGAAGAGAGGTGATGACTTAAAAATCA
TGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATTATGAG
ATTCAGGCCACTGTATTTTGGGCTGGAGACCTGGAGGCTCTGAAGGGCATCTGGAGGTGG
CCCAACCTATCTCTGTGCTCCTCCATGAGGCAGCTCAGGGTCCCCTTGTGGGGTTGGTGG
TGTTCTGGTTCCCTGGTGTGGGGAATGTTGGTGGCTCCCTCCTGAGCCCCCATTCTCGCC
TTGTGTCTTTCAGTGAGCTCTTCCACCCAGGAGGGCCCCTTGGCATTGACTGGCATAGGT
GAGTGGATCCTGCTGGGATCATTGGTCAGGAGCCATAACGTGTGGGGTCCCCGAGGTTCA
GCCTTTGGGCCACAAGGGTTTTCTCAGGGAGCAGACCTGAATTTCCACCTGGGAGGGAAA
GGTTCTCTTGGAGGATGGCTTTTTTGGGAATCTAACCCAAGGAAGACTCCTTCTTTGAAG
CCCTACAGGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCTGCCCAACGCAGGACAG
CGCCCAGTTGAGACTTGGTACTCCAGTAAGGTCTCAGGACTGCCCAGGCCACATGAAGGA
GGCCAGAGGGGCTATGGGCTGCCACTGGGGTAATAGGGGATCTCTTGGTCCCTGGAGTGT
GGTGTGTGAATGGGGTTGGGTTGCGGAGATTCAAGGATCGTGCCCCACCCATGACCCTGA
ATGCGACCATCCCTGTTGAGCAATGGGGCATCCTAGTGGATCTCCTGGAGCCTGGTGTGG
GGTGGCGTTATTTCCCTGGGGTTGGGTCAAGGTGGAGCTCTGGGTGGTACCTGGTTGTAC
TGCAGGTCAGCCTTGGGACTTGTGGGCTTTGGGCCAAGGGACAACTGCATCCTGCTGGGC
ATCACCCTATCTCCGAGGTCAAATGTCCTTGAGGGTGGCTTCCTGAAGTGGGAAGCCCCA
TTGTCGAGGGACCTGCCCCAGGATTTTGTTGCTCAGGCTTCTTCTGAGCCATGGCATCGC
CTCCAGGGAGACAGAGTCTTGGGCCCAAGCAAAGGAGAGGGCACCATGTCGCTCTGAGTT
GGCCAAGTGTAGCCTAGCTCTGTGGTGGGAGGTGTGAAGAGCATGGATGGTGACCCACCA
GAGAAAGCACGTGGCCCTGCAGCCCCAAGCTGCGATTTCTGGTGCATGCTTGTAGAGGAC
GTCTTGATGTGAGCCCACCACACCCAGGGGCAGACTGCATGACTGCCAGGACTGCAGTGG
CACGTGGCATCTGGGCCAGCCTTCTTTGTTGGCCATGACCTGGCTAATGGCCCTGGCCCG
TGCCCTGGGGTCATGCAGGGGAGCCCTCTTGGAGGGTGGAGGTGCTCTCAGGGCCTGCAG
TATAGCGCAGGCTGGGCATTTGGCCCGAGCCCAGTGACCTGCCTGCCTTGTCCTTCCCAG
GTTTGGTGGCAGGGAAGGACAAGGGTGCCCCATGTGTTGGTGACAAGTCCGTTTTTCACA
TGGATCTCATCACATGCGTCCATGGAGGATGAGCAAGCATGAACTGACCCCCGCTACCTC
CTTACCACATGGAGGTCATTTTGGACTCATGTCCTCCACCTCTGTCCCAGATGGTGAGAC
CGGAGGAAGGCTTGCATTGGACCTGCTGTTCCTGGGCCAGTGGCCATTAGCCCGGTGCCC
AGTCCCTGATGCTCTGAAGCTCAGGTCCTTCATGGTGCACTGGTCTCCTGCACTGAGCTG
TGGTGAGCACATCCGGGTCCCGCTGGAATCATGTGTGAGGTGGGTTGGTCCCCTGGGTTG
GTCCCCTGGGTTGGGTCGATGATGAGAACGTTAAATTGTCCTGAAGAGAGATGATGACTT
AAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGG
ACACTGGGATCCTGAGATCCCTGGCAGGGCCACTATATTTTGGGCTGGAGAACTCGAGGC
CCTGAAGGGCAACTTGGGAGGCCCCAATGTATCCCTGCACCCCTCTGTAAGGCAGCCCAG
TTTAGCTGTGTGAGCTTGGTGTCTGGTTCCCTGGGGATGGGGCATATTGGGGGCTACTTC
TTGAGCCGCCATTCTCCCCCATGTCTTTCAGTGAGCTCTTCTGTCCAGGTGGGGCCATGG
CCTTAAGCGGCATAGGTGAGTGTATCCTATTGGGGTCATGGTCCCTGAATGAGGCAGCAT
GGGGCCATTGAGGGTCAGCCTTAGGGCCACTACGGTTTTCTCAGGGTGCCACCGGAGAGG
GAACTTTTCTCCAGTAGCATCGCTTCCTTGGGAATCTGACCCTAGCAGCACGCATTTCCT
AAAGCCTTGCAGAGGTGATGGAGGTCCAGGCAGAAAGAGTTCCTTCAGCCCCACACAGAG
CACCTCCCAGCTGAAACTCGGTAGACTGGTCAGGCCTCGAGGACTGCCCAGGCCACATGA
GGGGAGCAATACGGGCTCTGGGGCAGCCTGGGAGTCAAGCTGGAGTTCTTCCTCCCTGGA
CAGTGGTGGTGATTGGGCCCAGGTAGACAGGCCCCAGATATTCAGGACTGCACCCCATCT
GTGGCCCTGAGTGGGACCAACCCTGTTGAGTAATGGGCCATCTTAGTGGTACCTCCTTGA
GCCTGGTAGGGGGAGGCACTGTTTCAATGCAGTTGTGTCAAGGCTGAGCTCTGGCTGGTG
CCTGGTGGTGCTGCAGGCGGCCCTGGAGGTTGTGGTCTTTGGGCCAAGGGGGCAGCTCAC
ATCCCGCTGGGGTCACCCCTTCCTTGAGATTCAGTAGCATGGAAGGTGTCCTCCTGAGGT
GGGAAGTCCTGCTGTCCAGGGACCTGTTCTGGGAATTTGCCCCACAGGCTACTTCTGAGC
CATGGGGTCACCTCCAGGGTGGAAGGGTCTTGATCCCAAGGAAAGGAGAGGACACCACGT
GGTTTCTGATTGGCCCAGTGTAACCTGGCTCTGTGTGTGGGAGGTGTAGGGCATGATGAA
GACCCACCAGAGAAAGCACGTGGGCCCGGAGGCCTCCAGGCTTTGATTTCTGGTGTGTGC
TTGGAGAGGGCACCAGGGTGAGTACCCACCATGCAGGCTCTGTGACTGCCAGGTCTGCAT
TGGCTCCTGGTGTCAGGGTCAGACTCCTTGGTTGGCCATGAGCAGGTTGGTTGCTCGGAC
CCATGCCCCAGGGTCCCAGTGCGGCCCTGGGGTTGTTCGGGGGAGCCGGCCCGAGCAGTG
GAGTTGCTCTTGGGGCCTGCAGTAGGGCACTGCCCAGGGGTCTTGCCCCAGCACAGTGAC
CCATATTCCCTGTCTTTCCAGGGTTTGGTGGCCAGGAGGGTCAATGGTGCCCCGTTTCCA
TGATGGGTCAGTGTTCTGCGTGGATTCCATCACATGGGCATCCCCTACCCACCTTCCCCA
CACTGATACGTGAGGCCCTGGTTGGACACATGTCCTTCTGCTGTCACCCCAGATGGTGAG
CCTGGAAGAAGAGTTGTGTTGGGCCCCCACAGGCCCCAGGCCAGTGTCCTTCAGCCTGGT
GCTCATCCCTCCAGTGCATTGAAGCTCAGATCCTCCCCGGCACCCTGGTCTCCTGCACTG
AGCTGTGGTGAGCACATCCAGGTTCTGCTGGATGCATGCGTGGGGAGGGGCTTGCCCTTG
GTTGGGTCAATGATGAGAACCTTATATTGTCTGAAGAGAGGTGATGACTTAAAAATCATG
CTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATGTTGGAAGAGGATACTGGGAT
CCCGAGATCTCCAACAGGTCCACTGTATTTTTGGCTGGAGACCTGGAGGTCCTGAAGGGC
ATCTGGAAGGAGGCCCAACGCTGTCTCTGTGCTCTTCCTTGAGGCAACCCAGGCTACCTC
TGCAGGCTTGGTGTTGGTGCTGCAGTTCTCTGGGGCCAGGGAACATTGGTGGCTCCTTCC
TGATCCCCCATTCCTCCCTTGTGTCTTTCAGTGAGCTTTTCCTCCCAGGCGGGCCCCCTG
GCATTGACTGGCATAGGTGAGTGAATCCTGCGGGGGTCATGGGCCATTAGCCAGGCCGTG
TGGGGTAGCCGAGGTTCAGCCTTTGGGCCACAAGGGTTTTCTCAGGCAGCCGACCTGAAT
TCCCACCTGAGAGAGATGGGTTCTCCAGGAGGGTGGCTTTTTTGGGAATTAGACCCAAGG
AGGATACACGAAGCCCTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGGGTTCTGTCAGCA
CCAGGCAAGGCAGCTTCTAGCTGAGACTCGGTGCTTGGGTCAGTTCTCAAGGACTGCCTG
AACACGAGGGGGTCCAGAGGGGCTCTGGGTGCCACGGGGGTCGCATGTGAGTTCTCAGTC
CCCAGAGTGTGGTGTGTGAATGGACCGTTAGGGTTGGGTCTTGGGCATAAAAGGGTCGTG
CCCCACCCATTACCTGGAATGTGACCGTCCCTATTGAGCCATGGGCCATCCCAGTGTGTC
TCCTGGAGCCTGGTGGGAGACGGCGTTGTTTTCCTGGGGTTGGGTCAAGGCGGAGCTCTG
GCCCGTATGTAGTTGTGTTGCAGGTCAGCCCTGGGACTTGGGGGCTTTGGGTTAAGGGGC
AGCCCACATCCTGCTGTGGATCACCCTATCTCTGACATCAAGTGTCAGGAAGGGTGGCCC
CCTGAGATGGGAAGTCAGCTGTCGAGGGACCTGTTCCGGGATTTTGTTGCTCAGGCTGCT
TGCAATCCATTGTGTCACCTCCAGGGTGGTGAAATTTTGGGCCCAAGCAATGGAGAGGGC
ACCACATGACTCCCGATTGTTCAAGTGTGGCTGACTCTGTGTGTGGGAGACATGCAGAGT
ACGGATGGTGACCCACCAAAGAAAGCATGTGGCTCAGGCTGTGATTTCCAGTGCTTCATT
GGAAAGGGTGCCTGTACGCACGCCCCCCATGCCCACGGGTAGACTATGTGACTGCCAGGT
CTGCAGTGGTGCATGGCATCTGGGCCAGCCTTCTTGGTTGGCCATGACCTGGCTAATGGC
TCTGGCCCGTGCCCAGTGGTCCCAGGGATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTGAGCACA
TCCGGGTTCTGCTGGAATCATGTGTGAGGTGATTGGTCCTCTGGGTTGGGTCGATGATGA
GAACCTTACATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACG
CTGAGGCCCAACCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCAAGATCCCCGGC
AGGGCCACTATATTTTGGGATGTAGAACTTGAGGTCCTGAAGGTCATCTCAGGGGTGCCC
AGCCCTGTCTCTGTGCCCCTCTGGGAGGCAGCCCAGGCTCCCTGTGTGGGCTTGGTGTCT
GGACTCAGGTTGCTCGGGGATGGGGCATGTTGTCGGCTCCTTCATGATCACGTGTTTTCT
CCCTTGTCTTTCAGTGAGCTCTTCTGCCCAGATGGGGCCCATGGCCTTAAGTGGCATAGG
TATGTATATCCTGTTGGGGTCGTGGGCCATGAATGAGGAAGCCAGGGCCATTGAGGGTCA
GCCTTCAGGCCACTAGGGTTTTCTCCGGGTGCCACTGGGGAGGGAACATTTCTCCAGTAG
GGTCACTTTCTTAGAAATCTGACCCTAGGAGCACACATTTCCTGAAGCCCTGCAGGGTGA
TGGTGGTCCAGGCAGAAAGGGTTCCTTCAGCCCAACATAGAGCAGCTCCCAGCTGAAACT
CAGTGGGCTGGTCAGGGCTGGAGGACTGCCCAGGCCACATGAGGGGGGCAACAGGGGCTC
TAGCTCAGTCTGGGAGTTACACTGGAGTTCTCCCTGCCTGGACAGTAGTGGGTGATTGGG
CCCACGCAAACAGGCCCTGGAGATTCAGGACTGCCCCCATCCATGACCCTGAATGGGACC
GACCCTGTTGAGTAATGGGCCATCTTAGTAGTACCTCCTTGAGCCTGGTAGGGGGAGGCA
CTGTTTCAATGCATTTGGATCAAGGCTGAGCTCTGGCTGGTGCCTGGTGGTGCTGCAGGC
AGCCCTGGAGGTTGTGGTCTTTGGGCCAAGGGGGCAGCTCACATCCCGCTGGGGTCACCC
CTTCCTTGAGATGCAGTGGCGAGAAGGGTGTCCTCCTGAGGTGGGAAGTCCTGCTGTCCA
GGGACCTGTTCTGGGAATTTGCTCCACAGGCTACTTCTGAGCCACGGGGTCACCTCCAGG
GTGGAAGGGTCTTGATCCCAAGGAAAGGAGAGGACACCATATAGTTTCTGATTAGCCCAG
TGTGACCTGGCTCTGTGTGTGGGAGGTGTAGGGCATGATGAAGACCCACCAGAGAAAGCA
CGTGGGCCCGGAGGCCTCCAGGCTTTGATTTCAGGTGTGTGCTTGGAGAGGGCACCAGGG
TGGGTACCCACCATGCCCAGAGCAGGCTCTGTGACTGCCAGGTCTGCATTGGCTCCTGGT
GTCAGTGCCAGACTCCTTGGTTGACCCCGAGCAAGTTGGTGGCCCTGATCCATGCTCTAT
GGTCCCAGTGCGGCCCTACGGTTGTTCGGAGGAAGCGGTCAGAGCAGTGGAGGTGCTCTT
GGGGCCTGCAGTAAAGCACAGCCCAGGCATCTTGCCCCAGCACAGTGACCTGCTTTCCCT
GTCTTTCCAGGGCTTGGTGGTCGGGAGGGCCAATGTTACCCTGTGTCCGTGATGGGTCAG
TATTCTACATGGATTCCATCACATGGGCATCCCCTACCCAACTACCCACAATGATATGCG
AGGCCCTGGGTGGACATGTGTCCTTCTGCTGTCACCCCAGATGATGAGCCTGGAAGAAGA
CTTCTGTTGGGCCTCAACAGGCCTCAGGCCAGTGTCCATCAGCCTGCTGTTCATCCCCTG
GTGTGTTGAAGCTCAGACCCTCCCTGGCACCCTGGTCTCCTGCACTCAGCTGTGGTGAGC
ACATGCAGGTTCTGCTGGATGCATGCGTGGGGAGGGGCTTGCCCTTGGTTGGGTCAATGA
TGAGAACCTTATATTGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTA
CGCTGAGGCCCAACCTAGGTGAGAATGTTGGAAGAGGATACTGGGATCCCGAGATCTCCA
ACAGGTCCACTGTATTTTTGGCTGGAGACCTGGAAGTCCTGAAGGGCATCTGGAAGGAGG
CCCAACGCTGTCTCTGTGCTCTTCCTTGAGGCAACCCAGGCTACCTCTGCAGGCTTGGTG
TTGGTGCTGCAGTTCCCTGGGGCCAGGGAACATTGGTGGCTCCTTCCTGAGCCCCCATTC
CTCCCTTGTGTCTTTCAGTGAGCTTTTCCTCCCACGCGGGCCCCCTGGCATTGACTGGCA
TAGGTGAGTGAATCCTGCGGGGGTCATGGGCCATTAGCCAGGCCGTGTGGGGTAGCCGAG
GTTCAGCCTTTGGGCCACAAGGGTTTTCTCAGGCAGCCGACCTGAATTCCCACCTGAGAG
AGATGGGTTCTCCAGGAGGGTGGCTTTTTTGGGAATTAGACCCAAGGAGGATACACGAAG
CCCTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGGGTTCTGTCAGCACCAGGCAAGGCAG
CTTCTAGCTGAGACTCGGTGCTTGGGTCAGTTCTCAAGGACTGCCTGAACACGAGGGGNN
NNNNNNNNNNNNNNNNNNTTCCTGGGGTTGGGTCAAGGCGGAGCTCTGGCCCGTATGTAG
TTGTCGTTGCAGGTCAGCCCTGGGACTTGGGGGCTTTGGGTTAAGGGGCAGCCCACATCC
TGCTGTGGATCACCCTATCTCTGACATCAAGTGTCAGGAAGGGTGGCCCCCTGAGATGGG
AAGTCAGCTGTCGAGGGACCTGTTCCGGGATTTTGTTGCTCAGGCTGCTTGCAATCCATT
GTGTCACCTCCAGGGTGGTGAAATTTTGGGCCCAAGCAATGGAGAGGGCACCACATGACT
CCCGATTGTTCAAGTGTGGCTGACTCTGTGTGTGGGAGACATGCAGAGTACGGATGGTGA
CCCACCAAAGAAAGCATGTGGCTCAGGCTGTGATTTCCAGTGCTTCATTGGAAAGGGTGC
CTGTACGCACGCCCCCCATGCCCACGGGTAGACTATGTGACTGCCAGGTCTGCAGTGGTG
CATGGCATCTGGGCCAGCCTTCTTGGTTGGCCATGACCTGGCTAATGGCCCTGGCCCGTG
CCCAGTGATCCCAGCGATGCCCTGGGGTCATGCAGCAGAGCCCTCTTGGACAGTGGAGGT
GCTCTCAAAGCCTGCAGTATGGCACAGCCTGGGCGTTTAGCCTGAGCCCAGTGACCTACC
TGCCCTGTCCTTCCAGGGTTCGGTGGCACACAGGGCCAAGGGTGTCTGTGTCAGTGACAA
GCACGTGGATCTCATCACATGCATCCATGGAGGATGAGCAAGTATGAGCTGGCATGACTA
CCTCCTTCCCCTCATGGAGGTCATTTTGGACACATGTCCTCCAGCTCTCTCCCAGATGGT
GAAACCAGAGGAAAACTTGCATTGGGCCTCCTGTTCCTGGGCAGGTGTCCATCAGTCTGT
TGCCCAGCCCCATGATGTGCTGAAGCTCAGGTCCTTCCTGGTGCCCTGGTCTCCTGCACT
GAACTGTGGTGAGCACATCCGGGTTCTGCTGGAATCATGTGTGAGGTGATTGGTCCTCTG
GGTTGGGTCAATGATGAGAACCTTATATTGTCTGAAGAGAGGTGATGACATAAAAATCAT
GCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATGTTGGAAGTGGACACTGGGA
TCCCGAGATCTCCAACAGGTCCACTGTATTTTTGGCTGGAGACCTGGAGGTCCTGAAGGG
CATCTGGAAGGAGGCCCAACCCTGTCTCTGTGCTCTTCCTTGAGGCAACCCAGGCTACCT
CTGCAGGCTTGGTGTTGGTGCTGCAGTTCCCTGGGGCCAGGGAACATTGGTGGCTCCTTC
CTGAGCCCCCATTCCTCCCTTGTGTCTTTCAGTGAGCTTTTCCTCCCAGGCGGGCCCCCT
GGCATTGACTGGCATAGGTGAGTGAATCCTGCGGGGGTCATGGGCCATTAGCCAGGCCGT
GTGGGGTCGCTGAGGTTCAGCCTTTGAGCCAGAAGGGTTTTCTCAGGCAGCCAACCTGAA
TTCCCACCTGGAGAGATGGGTTCTCCAGGAGGGTGGCTTTTTTGGGAATTAGACCCAAGG
AGGATACCCAAAGCCCTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGGGTTCTGTCAGCC
CCAAGCAAGGCAGCTTCTAGCTGAGACTCGGTGCTCAGGTCAGTTCTCAAGGACTGCCTG
AACACGAGGGGGTCCAGAGGGGCTCTGGGTGCCACGGGGGTCGCATGTGAGCTCTCAGTC
CCCAGAGTGTGGTGTGTGAATGGACCGTTAGGGTTGGGTCTTGGGCATAAAAGGGTCGTG
CCCCACCCATTGCCTGGAATGTGACCATCCCTATTGAGCCATGGGCCATCCCAGTGTGTC
TCCTGGAGCCTGGTGGGAGATGGCGTTGTTTTCCTGGGGTTGGGTCAAGGTGGATCTCTG
GCCCGTATGTAGTTGTGCTGCAGGTCAGCCCTGGGACTTGTGGGCTTTGGGTTAAGGGGC
AGCCCACATCCTGCTGTGGATCACCCTATCTCTGACATCAAGTGTCAGGAAGGGGGGCCC
CCTGAGATGGGAATGTCAGCTGTCGAGGGACCTGTTCCGGGATTTTGTTGCTCAGGCTGC
TTGCAATCCATTGTGTCACCTCCAGGGTGGTGGAATTTTGGGCCCAAGCAATGGAGAGGG
CACCACATGACTCCCGATTGTTCAAGTGTGGCTGACTCTGTGTGTGGGAGACATGCAGAG
TACGGATGGTGACCCACCAAAGAAAGCATGTGGCTCAGGCTGTGATTTCCAGTGCTTCAT
TGGAAAGGGTGCCTGTACGCACGTCCCCCATGCCCACGGGTAGACTATGTGACTGCCAGG
TCTGCAGTGGTGCATGGCATCTGGGCCAGCCTTCTTGGTTGGCCATGACCTGGCTAATGG
CCCTGGCCCGTGCCCAGTGATCCCAGCGATGCCCTGGGGTCATGCAGCAGAGCCCTCTTG
GACAGTGGAGGTGCTCTCAAAGCCTGCAGTATGGCACAGCCTGGGCGTTTAGCCTGAGCC
CAGTGACCTACCTGCCCTGTCCTTCCAGGGTTCGGTGGCACACAGGGCCAAGGGTGTCTG
TGTCAGTGACAAGCACGTGGATCTCATCACATGCATCCATGGAGGATGAGCAAGTACGAG
CTGGCATGACCTACCTCCTTCCCCTCATGGAGGTCATTTTGGACACATGTCCTCCAGCTC
TCTCCCAGGTGGTGAGACCGGAGGAAGACTTGCTTTGGGTCTGCTGTTCCTGGGCCAGTG
GCCATCAGCCTGTTGCCCAGCCCTGTGATATGCTGAAGCTCAGGCCCTTCCTGGTGCTCT
GGTCTCCTGCCCTGAGCTGTGGTGAGCACATCTCGGTCCCGCTGGATGCATATGTGAGGT
GGTTGGTCCCCTGAGTTGGGTCGATGATGACAACCTTACATTGTCCTGAAGAGAGGTGAT
GACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGC
AGAGAATGCTGGGATCCCGAGATCCCCAGCAGGGTTACTATATTTTGGGATGTTGAACTT
AAGGCCCTGAAGGTCATCTCAGGGGTGCCCAGCCCTGTCTCTGTGCCCCTCTGGGAGGCA
GCCCAGGCTCCCTGTGTGCGTTGGTGTCTGGGCTCTGGGTCCCCGGGGATGGGGCATATT
GGCTACTCCTTCCTGAGCCCGTGTTCTCCCCCTTGTCTTTCAGTGAGCTCTTCTGCCCAG
GTTGGCCCCTGGCCTGAAGCGGCATAGGTGAGTGTATCCTGTTGGGGTCATGGGTCATGA
AATAGGCAGCGTGGGGCCATTAAGGGTCAGCCTTCAGGCCACTAGGGTTTTCTCCGGGTG
CCACCGGGGAGGGAACATTTCTCCAGTTGGGTCGCTTCCCTTGGAATCTGACCCCAGGAG
CACTCATTTCCTGAAACCCTGCAGAGGTGATAGTGGTCGAGGCAGGAAAGGGTTCCTTCA
GCCCAAGATAGAGCAGCTCCCAGCTAAAACTGGTGGGCAGATCAGGCTGGAGGACTGCCC
AGGCCACATGAGGAGGGCAACAGGGGCTCTAGGGCAGCCTGGGGGTTACACTGGAGTTCT
CCCTGCCTGGACAGTAGTGGGTGATTGGGCCCACGCAGACAGGCCCCGCAGATTCAGGAC
TGCCCCCATCCATGACCCTGAATGGGACCGACCCTGTTGAGTAATGGGCCATCTTAGTGG
TACCTCCTTGAGCCTGGTAGGGGGAGGCACTGTTTCAATGCAGTTGGATCAAGGCTGAGC
TCTGGCTGGTGCCTGGTGGTGCTGCAGGCAGCCCTGGAGGTTGTGGTCTTTGGGCCAAGG
GGGCAGCTCACATCCCGCTGGGGTCACCCCTTCCTTGAGATTCAATATCATGGAGGGTGT
CCTCCTGAGGTGGGAAGTCCTGCTGTCCAGGGACCTGTTCTGGGAATTTGCCCCACAGGC
TACTTCTGAGCCATGGGGTCACCTCCAGGGTGGAAGGGTCTTGATCCCAAGGAAAGGAGA
GGACACCACGTGGTTTCTGATTGGCCCAGTGTGGCCTGGCTCTGTGTGTAGGAGGTCTAG
GGCAAGATGAAGACCCACCAGAGAAAGCATGTGACCCTGGAGGCCTCCAGGCTTTGATTT
CTGGTGTGTGCTTGAAGAGGGCACCAGGGTGGGTACCCACCATGCCCAGGGCAGGCTCTG
CGACTGCCAGATCTGCATTGGCTCATGGTGTCATGGCCAGATGCGTTGGTTGGCCATGAG
CAGGTTGGTTGCTCTGACCTGTGCCCCATAGTCCCAGTGCGGCCCTGGGGTTGTTTGGGG
GAGGCAGCCTGAGCAGTAGAGGTGCTCTTGGGGCCTGCAGTAGGGCACAGCCCAGGCATC
TTGCCCCAGCACAGTGACCCACATTCCCTGTCTTTCCAGGGTTTGGTGGCCGGGAGGGCC
AAGGGTGCTCCACGTCCATGTTGACTCAGTGTCTGCATAGATTCCATCACGTGGGCATCC
CCTACCCACCTTCCCCACACTGATACGTGAGGCCCTGGTTGGACACATGTCCTTCTTCTG
TCCCTACAGATGGTGAGCCTGGAGGAAGACTTGTATTGGGTCCCCACAGGCCCCAGGCTA
GTGTCCTTCAGCCTGGTGCTCATCCCCCAGTATGCTGAAGCTCAGACCCTACCTGGCACC
CTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCAGGTTCTGCTGGATGCATGGGTGGG
GAGGGGCTTGCCCTTGGTTGGGTCAATGATGAGAACCTTATATTGTCTGAAGAGAGGTGA
TGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATGTTGG
AAGAAGACACTGGGATCCCGAGATCTCCAACAGGTCCACTGTATTTTTGGCTGGAGACCT
GGAGGCCCTGAAGGGCATCTGGAAGGAGGCCCAACGCTGTCTCTGTGCTCTTCCTTGAGG
CAACCCAGGCTACCTCTGCAGGCTTGGTGTTGGTGCTGCAGTTCCCTGGGGCCAGGGAAC
ATTGGTGGCTCCTTCCTGAGCCCCCATTCCTCCCTTGTGTCTTTCAGTGAGCTTTTCCTC
CCAGGCGGGCCCCCTGGCATTGACTGGCATAGGTGAGTGAATCCTGCTGGGGTCATGGGC
CATTAGCCAGGCCGTGTGGGGTAGCCGAGGTTCAGCCTTTGAGCCAGAAGGGTTTTCTCA
GGCAGCCAACCTGAATTCCCACCTGGAGAGATGGGTTCTCCAGGAGGGTGGCTTTTTTGG
GAATTAGACCCAAGAAGGATACCCGAAGCCCTGCGGGGGTGACAGTGGTCCAGGCAGGAA
AAGGTTCTGTCAGCCCCAGGCAAGGCAGCTTCTAGCTGAGACTCGGTGCTCAGGTCAGTT
CTCAAGGACTGCCTGAACACGAGGGGGTCCAGAGGGGCTCTGGGTGCCACGGGGGTCACA
TGGGAGCTCCCAGTCCCCGGAGTGTGGTGTAGGAATGGACCGTTAGGGTTGGGTCGTGGG
CATAAAATGGTCGTTCCCCACCCATTGCCTGGAATGTGACCATCCCTATTGAGCAATGGA
CCATCCCAGTGTGTCTCCTGGAGCCTGGTAGGAGATGGCATTGTTTTCCTGGGGTTGGGT
CAAAGCAGAGCTCTGGCCCATATGTAGTTGTGCTGCAGGTCAGCCCTGGGACTTGTGCAC
TTTGGGTCAAGGGGCAGCCCGCATGGCACTGGGGATCACCCTCTCTCTGACATCAATGTC
AGGAAGGGTGGCTTCCTGAGAAGGGACAGCCCACTGTCGAGGGACATGTTCCAGGATTTT
GTTGCTCAGGCTGCTTGAAATCCATTGTGTCACCTCCAGGGTGGTAGAGTTTTGGGCCCA
AGCAATGGAGAGGGCACCATGTGGCTCCCGATTGTTCAAGTATGGCTGACTCTGTGTGTG
GGAGACATGTGGAGTATGGGTGGTGACCCACCAAATTTGCATGTGGCTCAGGCTGTGATT
TCCAGTGCGTGCTTGGAGAGGCCACCTGTACACATGCCCCCCCTGCCCAGGCTATGCGAC
TGCCAGGCATGGCATCTGGGCCAGCCTTCTTGGTTGGCCATGACCTGGCGAATGGCCCTC
TCCTGTGCCCAGTGGTCCCAGGGAAGCCCTGGGGTCATGCAACAGAGTCGTCTTGGGCAG
TGGAGGTGCTCTCAAAGCCTGCAGTATGGCAAAGCCTGGGCATTTTGCCTGAGCCCAGTG
GCCTACCTGCCCTGTCCTTCCAGGATTCATTGGCAAGCAGGTCCAAGGGTACCCCGTGCC
AGTGACAAGTCCGTATTTCACATGGATTTCATCACATGTTCCTTGGAGGATGAGCAGGTG
TGAGCTGGCATGCCCTACCTACTTCCCCACGTGGAGATCATTTTGGACACATGTCCTCCA
GCTCTCTCCCAGGTGGTGAGACCAAAGGAAGAGTTGCGTTGGGCCTCCTGTTGCTGGGCC
AGTGGTCATCAGCCTGTTGCCCAGCCCCTGATAAGCTGAAGCTCAGGCCCTTCCTGGTGC
TCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTCCCGCTGGATACATGCACGA
GGTTGTTGGTCCCCTGAGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGT
GATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCCAGATGAGAATTTT
GAAAGAGGACGCTGGGATCGCAAGATTTCCAGCAGCACCACTGTATTTTGGGCTGGAGAA
CTTGAGGCCCTGAAGGGCATCTCAGGGTGCCCAGCCCTGTCTCTGTGACCCTGTGTGAGG
CAACCCAGGCTCCCTCTTTGGGCTTGGTGTCTGGGCTCTGGTTCCCCAGGGATGGGGCAT
GTTGGTGGCTACTTCCTGACCCTGTGTTCTCCCCCATGTCTTTCAGTGAGCTCTTCTGCC
CAGGTGGGACCCATGGCCTTAAGCGGCATAGGTGAGTGTATCCTGCAGGATCATGAGCCA
TGAATTAGGAAGCTTGGGGCCATTGACAGTCAGCCTTCGGACCACTAGGATTTTCTCAGG
GTGCCACTGGGGACTGAGCGTTTCTTCAATAGGGTCGCTTCCTTGGGAATCTGACCCTAG
GAGCACGCAATTCCTGAAGCCCTGCAGAGGTGATGGTGGTCTAGGCAGAAAAGGTTCCTT
CAACCCAACATAGAGCAGCTCCCAGCTGAAACTTGGTGGGCAGGTCAGGGCTCAAGGACT
GCCCAGGCCACATGAAAGGGGCAATTGCAGCTCTGGGGCAGCCTGGGCGTCACGCTGGAG
TTCTCCTTCCCTGGACAGTGGTGGTTGATTGAGCCCACGCAGACAGGCCCTGGAGATTCA
TCACTGCACCCCATCCATGGCCCTGATCAGACCGACCCTACTGAGTGATGGGCCATCTTA
GTGGTACCTCCTTGAGCCTGGTAGGGGGAGGCACTGTTTCAATGCATTTGGATCAAGGCT
GAGCTCTTGCTGGTGCCTGGTGGTACTGCAGGCAGCCCTGGGGATTGTGGTCTTTGGGCC
AAGGGGGCAGCTCACATCCCGCTGGGGTTTCCCCTTCCTTGAGATTCAGTGGCGAGAAGG
GTGTCCTCCTGAGGTGGGAAGTCCTGCTGTACAGGGGCCTTTTCTGGGAATTTGCCCCAC
AGGCTGCTTCTGAGCCACGGGGTCACCTCCAGGGTGGCAGGGTCTTGATCCCAAGGAAAG
GAGAGGACACCACGTGGTTTCTGATTGGCCCAGTGTGGCCTGGCTCTGTGTGTGGGAGGT
GTAGGGCAAGATGAGGACCCACCAGAGAAAACACATGGCCCCAGAGGTCCCCAGGCTTTG
ATTTCTGGTGTGTACTCGGAGAGGGCACCAGGAAGGGCACCCACCATGCCCAAAGCAGGC
TCTGTGACTGCCAGGTCTGCATTGGCTCCTGGTGTTAAGGCCAGACTCATTGGTTGGCCA
TGAGCAGGTTGGTTTCCCTGACCCATGCCCCAGGGTCCCAGTGCGGCCCTGGGGTTGTTT
GGGGGAGCCGGCCCGAGCAGTAGAGGTGCTCTTAGGGCCTGCAGTGGGGCACAGCCCAGG
CATCTTGCCCCAGCCCAGTGACCCACTTCTGTGTCTTTCCAGGATTTGGTGGCCAGGATG
GCTAATGTTCCCCCGTGTCCATGATGGTTCAGTGTTCTGCATAGATTCCATCACATGGGC
GTCCCCTACCCACCTTCCTCACACTGATATGTGAGGCCTTGGTTGGACACATGTCCTTCT
CCTGTCACCCCAGATGGTAAACCTGGAGGAAGAGTTGTGTTGGGCCCCCACAGGCCCCAG
GCTAGTGTCCTTCAGCCTGGTGCTCATCCCCCCGGTGTGCTGAAGCTCAGACCCTCCCTG
GCACCCTGGTCTCCTGCTGAGCTGTGGTGAGCACATCCAGGTTCCGCTGGATGCATGCGT
GGGGAGGGGCTTGCCCTTGGTTGGGTCAATGATGAGAACCTTATATTGTCTGAAGAGAGG
TGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGAATGT
TAGAAGAGGACACTGGGATCCCGAGATCTCCAACAGGTCCTCCAGGCTGGGGTCCTGGAG
GTCCTGAAGGGCATCTGGAAGGAGGCCTAACCCTGTTTCTGTGCTCTTCCTTGAGGCAAC
CCAGGCTACCTCTGCAGGCTTGGTGTTGGTGCTGCAGTTCCCTGGGGCCAGGGAACATTG
GTGGCTCCTTCCTGATCCCCCATTCCTCCCTTGTGTCTTTCAGTGAGCTTTTCCTCCCAG
GCGGGCCCCCTGGCATTGACTGGCATAGGTGAGTGAATCCTGCGGGGGTCATGGGCCATT
AGCCAGGCCGTGTGGGGTAGCCGAGGTTCAGCCTTTGAGCCAGAAGGGTTTTCTCAGGCA
GCCGACCTGAATTCCCACCTGGAGAGATGGGTTCTCCAGGAGGGTGGCTTTTTTGGGAAT
TAGACCCAAGGAGGATACCTGAAGCCCTGCGGGGGTGACGGTGGTCCAGGCAGGAAAGGG
TTCTGTCAGCCCCAGGCAAGGCAGCTCCTAGCTGAGACTCGGTGCTCAGGTCAGTTCTCA
AGGACTGCCTGAACACGAGGGGGTCCAGAGGGGCTCTGAGTGCCACGGGGGTCACATGGG
AGCTCCCAGTCCCCGGAGTGTGGTGTGGGAATGGACCCTTAGGGTTGGGTCTTGGACATA
AAATGGTCATGCCCCATCCATTGCCTGGAATGTGACCATTCTTATTGAGCAATGTACCAT
CCCAGTAGGTCTCCTGGAGCCTGGTGGGAGGTGACGTTGCTTTCCTGCGGTTGGGTCAAG
GCCTCTGCGTTGCCCATACCTGGTTGTGCGACAGGTCAGCCCTGGGATTCGTGGCCTTGG
TCCACAGGGCAGCCCGCATCCTGCTGGGGATCACCCTATCTCTGACATCAAGTGTCAGGA
AGGGTGGCCCCTTGAGAAGGGATGGCCTGCTGTCGAGGGACCTGTTCTGGGATTTTGTTG
CTCAGGCTGCTTGGAATCCATTGTGTCACCTCCATGGTGGTGGAGTTTTGGGCCCAAGCA
ATGGTGAGGGCACCGTGTGGCTCCCAGTTGTTCAAGTGTGGCTGGCTCTGTGTGTGGGAG
ATACGTGGAATACTAGTGGTGACCCACCAAAGAAAGCATGTGAGTCAGGTTGTGATTTCC
AATGTGTGCTTGGAGAGCGCACCTGTGTGCACAGTGTGTTCATGGAGGACGAGCAAGCAT
CAGTTAGCATGCCCTACCTCCTTCCCCACATGGAGGTCATTTTGGACAGATGTCCTCCAC
CTCTCTCCCAGATGGTGAGACAGGAGAAAGACTTGTGTTGGGCCTGTTCCTGGGGCTGTG
GCCATCAGCCTGGTGTCCAGCTCCTGATGCACTGAGGCTCAGGCCCTTCCTGGCACCCTG
GTCTCCTACACTGAGTTGTGGTGAGCACATCTGGGTTCTGCTGGAATCATATGCGAGGTT
GTTGGTCCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGATGATG
ACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTATATGAGAATTTTGGAA
GAGGATGCTGGGATACCAAGATCCCTGGCAGGGCTACTAGTCACTGTATTTTGTGCTGAA
GAACTTGAGGCCCTCAAGGGCATCTCAAGGGGACCCAGCCATGTCTCTGTGCCCCTCCAT
GAGGCAGCCCAGGCTCACTGTGTGGGCTTGGTGTCTGGGCTTTGTTTCCCCAGGGATAGG
GCATGTTGGTGGCTCCTTCCTGAGCCCGTGTTCTCCCCCGTGTCTTTCATGAGCTCTTCT
GCCCAGGTGGGGCCCATGGCCTTAAGCGGCATAGGCGAGTGTATCCTGTTGGGGTCATAG
GCCATGAATGAGGCAGCCTTGGGCCATTGAGGGTCAGCCTTTAGGCCACTAGGGTTTTCT
CAGGGTGCCAACCTATTTCCCACTGGGGAGGGAACATTTCTCCAGTAGCATTGCTTCCCT
GAGGATCTGACCCTAGGAGCACGCATTTCCTGAAGCTCTGCAGGGTGATGGTGGTCCAGG
CAGGAAAGGGTTCCTTCAGCCCAACATAGAGCCGCTCCCAGCTGAAATTCTGTGGGCTGG
TCAAGCCTTGAGGACTGCCCAGGCACATCATGCGGGACACAGAAGCTCTGGGGCTCCCTG
GGGGTCACACTAGAGTTCTCCCTCCCGGAAGAGTGGTTGGTGATTGGGCCCACACAGTCA
GGCAGTGGAGATTCAAGGAGTGCACCCCACCCATGGCCCTGAATGGGACCGACCCTGTTG
AGTAATCGCCATCTTAGTGGCACCTCCTTGAGCCTGTTGGTAGGGGTGCTGTTTCAGTGA
GGTTGAGTCAAAGCTGAGCTCTCCTGGTGCCTGGCGGTGCTGCAGGCCGGCCCTTCTTTG
GGCCATGGGGGCAACTCGTGTCCCACTGGGGTCATCCTTTCCTTTAGGTCCAGGGGTGGG
AAGGGTGGCCTCATGTGGTGGGAAGGCCGGCTGTTCAGGGACCTGTCCTGGAAATTTGCC
ACACAGGCTGCTTCTGAGTCATGGGGTCACCTCCAGGGTGGTGGGGTCTTGAGCCCAAGA
AAAGGAGAGGACATCATGTGATTCCTGATTGGCCAAGACTCCTTGGTTGGCCAGGAGCAG
GTTGGTTGCCCTGGCCTATGCCCCATGGTCCTGGTGTGGCCCTGGGGTTGTTCTGGGGAG
CCAGCCCGGGCAGTGGAGGTGCTCTCAGGGCCTGCAGTAGGGTGCAGCCCAGACATCTTG
CCCCAGCACAGTGACCCACTTGCTCTGTCTTTCTAGGGTTTGGTGGTCGGGAGGGCCAAT
GGTGCTCTGTGTCCATGTTGGGTCGGTGTTCTGCATGGATCCCCATCGCATGGGTATCCC
CTACCCACCCTCCCTGCACTGATATGTGAGGCCCTGGTTAGACACATGTCCTCCTCCTGT
CCCTCCAGATGGTGAGCCTGGAGGAAGGCTTGTGTTGAGTCCCCACAGGCCCCAGGCCAG
TGTCTGTCAACCTGGTGCTCATCCCCTGGTGTGCTGAAACTCGGACCCTCCCTGGCACCC
TGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCAGGTTCTGCTGGAGGCATGCTTGGTG
TGGGGTTGCCCTTGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGAT
GACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTGGGTGAGAATCTTGGA
AGAGGACGCTGGGATTCCTGGAATGACTGCTGTAGTTTGGGCTGGAGACCTGCAGGCCCT
GAAGGCCATCAGGAAGGTCCAACCCTGTCTCTGCGCTCCTCTGTGAGGCAGCCTAGGCTC
CCTGAGGGGGCTTGGTGTCGGGGCTCCTCTTCCTCAGGGGTGGGGCTGGTTGGTGGCTCC
TTCCTGAGCTCCCATTTTCCCCTTGTGTCTTTCAGTGAGCTCCTCCACCCAGCGGGCCCC
TTGGCATTGACTGGCATAGGTGAGTGGATCCTGCTGGTGTCATGGGTCATGAGCCAGGCC
ATGTGGGGTCACCAAGGGTCAGCCTTTGGGATAAGAGGGTTTCCTCAGGGAACCAACCTG
AATTCCCATCAGAGAGGCATGGGTTCTCCAGGAGGGCCGCTTTTTTGGGAACTGGACCCA
AGGAGGATACCTTCCCTGAACTCTATAGGAGGGATGGCGGTCCAGGCAGGAAAGTGTTCC
TTCAGCCCCACCCATGACAGCACTCGGTTGAGACTCAGTGCTCAAGTCAGGCCTGAAGGG
AGTTAGAGGGGAGCTGTTTGTCCCTGGAGTGTGGTGCATGAATCTGCCCTTGGGGTTGGG
TCATGGAGATTCAAGGATGGCGCCTCACCCATGGCCCTAATTGGAATCATCCCTGTTGAG
AAATGGGCCTTTCCAATGGGCCTCCTAGAGCCTAGTAGGGGGTGGTGATTTTCTCCCTGG
GGTTGAGTCATGGATGGGAACCCACCATAGAAAGCATGTGGCTCTGGAGGCCCCCAGGCT
TTGATTTCTAGTGCCTGCTTGGAGTGGGCACCAGGGCCAGTGCCCCCCATGCCCAGGGGC
AGGCTCTGCGACTGCCAGGTCTGCACTGGCTCCTGGCATCTGGACCAGCCTCCTTGGTTG
ACCATGAGCTGCTTGGTTGCCCTGGCCCATGCCCCGTGGTCCTGGTGAGGCCCTGGGGTT
TTTTTGGGAGAGCTGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved