Macaca_mulatta Locus Mono:221:SNORA70
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:221:SNORA70
Macaca_mulatta
Mono:221:SNORA70
18
SNORA70
1001..1125
2125
AAGGCTATTTTCACGTCCTTTGTGGATCTTCAGTGGCTTCAGGCCATCTGGATGTATAC
GCAGGTCGCAGGGGATATGATGGCTTAGCTTGGGCTCCGAGGCCTGACAAGTAATCAGGA
GAATGTAAGTTAAAACTGCAGTGAGATACCACCACACACCCATCAGAATGATTGAATTTT
TTAAAATTAATTAATTTTTTTTTTTCCAGACAGTCTTGCTCTGTTACCCAGGCTGGAGTG
CCGTGGCGTGATCTTGACTCACTGCAATCTCCACCTCCTGGTTTCAAGCAATTCTCGTGC
CTCAACCTCCCAAGAAGCTAGGATTACAGGCCTAGCTAATTTTTGTATTTTTAGTAGAGA
CTGGGTTTTGCCACGTTGGCCAGGTTGGTCTGGAACTCCTGACCTCATGTGATCCGCCCG
CCTCGGCGTCCCAAAGTGCTGCGATTACAGGTGTGAGCCATCACGCCTGGCCAGAATGGT
TAAAATCTTTAAAGTCGTTGAATGCCAGGTGTTGGAGGTGTTACTAATGCCAATGATCAA
CCAGCATTCAGACACATCACTGGTTCAAATCCAAATTGTACCACTTTTTTGGGGGACAGA
AAGTAGAATTTATTGGTGAGTATTAACAGGGGCCAGCAGAGTGGAAGCCATCATGAGTGC
AGGGCCCGCCACTTATCCAGAGGGCCACGACTGGGGATGTATTTGGCCCCACAGCCATCT
GGGATGAGCCGCTTCTCAGCCACCATGTCTTCAAATTCGTCAGCATTCAACTTGGTGAAG
CCCCACTTCTTTGAGATGATGAGATGAGATGAGATGAGATGAGATGAGATGAGATGAGAT
GAGATGAGGCCCCTGCACAGGGCCTCAATGACATGCTCCTTGTTCTGCAGCTTGGTGCAG
AGGGACATGATAACTTGGCCAATGTTAACCCTGGCCACAGTGCCCTGGGGCTTTCTTTCC
AAAGGCACCTCGCATGCCTGTTTGGAGGCTACATTGGGGTAGTGCAAGGTCAGAGACATG
AACATCCATGTTAAAGAAGTTGTACATGTGCAATGGCTGCAAACAGCAGCTTCCTCGGTA
GTGTATGCAGCCTGTTTCTTGTATGGGTTGCTCTAAGAAACCAGGTCTTTCAGATGGATG
TTCGTGTCTCTGACTCCCTATGTTGCCCGGACAGGACTTGAACTCCTAGCCTCTAGCAAT
CCTCTTCCCTCCGCCTCCCAAGTAGCTGGGACTACGGGTACCCAGAGTCAAACTATAACA
ACTTTAGAAAACAGTTTGATATCATCTAGAATGTTGAACATGAACACACACGGGGACCAG
TAATTCCAATGTTAGGTACATGCCTCTAGAAATTCTTGCCCAAGTGCCCTGAAAGACACA
TACAGAAATAGAGCAGCATTGCTCATAATTGCAAAGAAGAGTGTCCACCAAGGGTGAGAT
GGATACTTAGATTGTGGTGTAATCATATAATGAAATCCTATTGATTTACATCAACGTGGA
TGAATTTCAAAAATAAAATCTTAAGCAAAGAGACATCACAAGATTAAAGCATGACTCTAC
TTATTCTATTCCAAAAATGATACACTGTTTCAAGATAAAATAGGCGATAACAGCCATAAA
GAAAAATAAGGAAATGACAGAAATTGCAGGAGAGAGAGAGACAGTGCAATCCGAATTGGG
TGTAAATCTAGAGCAGGGAAATGTGCTGTTTCTTGGCCTGTGTGATGGATACATAGCTGT
CTGTGTGTACTGTTATTTCACAATATAAACTAAAATAGATGAAGGCTAAGGGAGAATGAA
TTAATAAATACATACATCTGCATTTTTTAAACGTTATTGTGCTCCTATAAGCTCTGTAAA
TTTCCGTTCACACTTCTAAGACAAACTCAGTGTTCCTTAGAACTTTCCTAAAGCACTGCA
AGGAATGGTTTTTCAACAAGGCACTGCAGTTTGTTTTGTAATAAATCCTTCTAAAAGGTG
AGGAAGAATAAGTTACACAAAATGGGTCAGAAGTGCAAAAAAAACTAGTAGAAACATGAA
GACTCTTCTAATAAGTCACTCACATATACATAGCCCCGGATCACTCCATTTAGGTTTTGT
AAATTTTATTTATTTATTATTATATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved