Macaca_mulatta Locus Mono:327:SNORA62
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:327:SNORA62
Macaca_mulatta
Mono:327:SNORA62
5
SNORA62
1001..1151
2151
AATCAAATGTAGAATGTTAATATTTGAGAAAATCTGGGCGAAGGTACCCAAAAAATCTG
TATGATTCTTGTAACCTTTCTTTGAGTGTCAAATTATTTTTAAAAAGCCTTTATCCTACA
ACTTTTAAAAACACAAACTGAATCAACAATTAAGAAAATGTTGCAAGTAGTTTTCAAAAA
TAAATTCTAATGGACATTTACTCATTATTTCTCTATTTAGTAAACACTTCTTACCTAGTT
ATTTATAAGCTTTTTCCCTGAGAAATTTCATTTTACTGTGAAACATTATTAAAATGAAAT
GAAAAGAGACTGTAAGCATTTTTAAATTGATAGAAAGTATATTCAAACAAAAATGTTACA
ATTTTTTTATTTTAAGCAAATGAGGGGTTCTATTATTTTTTGTTTTTGATTGAATTAGAA
AATTTTAATTTTAATTACAGTATTAAGAAACATGATTCTTTTCTAAGCTACCAACAAAAA
AACACTATAAAATATTTTTAAGATACTTTATTTTCTTAAAAAAAGACATACTCTGCTCCC
ATTTCCATCACCTCAAAAGGGAACGAAACCTTGGCCCTGTTAAATAAGTTGAAAAGTTGA
TTTCAGTTTCAGATCTTTTTTAATCTTCAAGGGGAAAAAATGATTTTAAATTAATCCACT
AGAGGGCGTCTAATAATTTTACAATCATCCTGCAGTCAAGAAACCCCGACAAGTGCATTC
AGCTAAGTTTATCTTATGATTCAGACTTTTTTTTCCCACATTACAAAGTGAACTTTTCAG
TTTTCTGTAATTCTTTGCAAGCTGACCTTATTTAAAGTTCAGCTTTGAATTAGATCCAAC
AGAGGCTGTCAGTTAAAGTCTTTGGAATGGTTACTTCACGTAGAACCCGAGAATTTCTTT
AAGGTTTTAGCTACTTCTCTCTGTACCATCCCAGTTGGACTTGGAACCGGATGACCTGAA
TTTTACTTTTTCTATGCTCTGGGCCACATTTTCATCTTAATATTTCATGTTTTAAAGGCA
TAATGATATCACTGACTGGCTGATGAAATCACAAGCGTAGGTAGTATGCTACATGAGAAG
CAAGTTTTTCGCTAGCACCACAAAGGTCTCTGGCCCAATGAGTGGAGTTTGACAGTAGTT
CTTGTCACAAGTATAATGTTGTTGCATGCCAGTTTTGAGGAGAGATGAACACATTTGAAA
AACAGTGTGTTTTTTTTTTTCTGTGTTTGTCTATATTTCTTGCTCAGGCCTCTCGGGCAT
TACTTGTTCTTTCCGTTTTCACACCAACTTGGTGAGTTCTGCTATAAGATTCTAAAAAGA
TGGGTTGTGTGTGGTCCAAATTGGTTCATTTGTAACTGGAAAAAAAATTTATAGTTTAAA
AAATATGTTTAAAAAAAAGCCCTGATGAAACTTTCAATTAGCAATGACTTTGAAACATAG
TACTATAATTGAGTTAATGGCTATCTTATTTAACACATGCTTATTTTTTAAGCAATTCTT
TGGTAAAACTAACTATAGCTGGCATTCTCTGTCATAAAAGATAAAGCAGTTATATCCTTC
AATCAAGGAATTTAATATTTGGTAGTGGAGATATAAAATGTATGTGATCCAGGTAATACA
AGATAGACCGATAAATTTTAAGAAAGGTATAATAAAGTGTACAAAAATTCAGAATCTTAC
TTGCCCATAAATTAACTTGCTATTGTCTTAGTTCCATTTATTTTGTGCTCCAAGACCATG
TTCATTTGAATGATTAATATAGAGATCCACTTTGCTTTTAGTTGTTCATTTGTTCTTGGA
TTTTATTTCTTTAATTTTGGTATGTTTCTCCTCTCTTGTCCCTGACCCTGGTTCTCATCA
GCGTTTGTTTTATTTTGCCATAAACAAGAACATTCTGTTTTCATTTTTTTTTTCACAGTC
AATTGCAGTTGTTCATTTCTTCTTGGAATATTATCTTTAACACTCACCTTACCCACACTA
ATTACACCCTTACCTAGTGTTATCCAAAGGTAATTATCTTCAGATGTGTGCTTCAGTTTC
CTCATCTATATATGGAAAAAATAGTAATATCTACCTCTAAGGCCTATCATGACAATAAAT
GAGTTAATACATGCAAAGCACCTGGAATAGTGCCTGGAACACAGCACTGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved