Macaca_mulatta Locus Mono:252:SNORA4
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:252:SNORA4
Macaca_mulatta
Mono:252:SNORA4
3
SNORA4
1001..1144
2144
TTTAAACCTAGAAGGATAGGACCCTAGAGCAGATTTCCTTTCTTAAGTCACTTGGGAAC
ACATTAATGGCAGATTTTTGCAAAATCAGAATCATGTTAACAAATAGTACAAGCACAAAC
ATAGTATGATTTCCACTCCATCACCTGAGGAGCACCTGTTTACCCTCCCATGATAAAGAA
CTAGAAAACTGGACAAAATGTATGAAAAAATTTTGTGGATATTGATCAATAAGCAGTACC
TATGATAGCTGGGAGGAGAAGGAAGGTAAATTCTTATAATAACCTTGGTTTTTCTGCATG
GTGGGTATTTTCAGACCACGGCACAGTGAGTAAAATAAAACAGCTTGGCAATCTTGCTGA
GTACAGGAAACAGATTAAAGTTCAGGGAAGTCAAAGTAGCTAGAATTTTCAGAGCAAAGT
ACCAGGAAGAGGGGAGCTAAACAGAGTCCAGTCTTGTGGAAGTCAAACATCCCCTTAATT
TGTTGTATCAATAAAAATTCAGGCACACATAAGTGAAATTTCCAGAGGCCAGGCAAAGAA
CAACTGAGGAAACAACTAGGGAGCTACAAGTCAGAATATTTCCAGAACTCATACAGTGCT
CAGTTTCTATCAGCCAGAGTAGCCAGATCTTGAGGAATATATGGATTCAGGAGTGACTCT
GAAAGGTTCCTGACTTAAAAATGGTGCCAGAATTCAGTTAAAAAATTACTAGACATATGA
AGTAGCAAAAGTACATGTACTAGAACCAGTTGGTAGAAACAGAACCAGAAATAACCAAAA
AATATGAAATTAGCAAACAAAAACCCTAAAACAGCTATTATAATTTTTAAAAATATACTC
GAAGATTTAAAGGAAAACATGAACATAATTAAGAAAGAAATAGACTATATAAGAAAGACC
CAAATGGAACATCTAAAAGGAAAAAAATACAAAATATGGAGTAAAAAAATCACTAAGATT
TTAAAAATTGACAGCAAATTAAACCCTAAAGAAACAAAGATCTATCAAAAGTTACTTTTT
GTGGGGTGGAAGTTTTTAAAATAACCTTTACCTACTTGGGCTGTTTTGGAAAATAAAGAA
AAGACCACACATAACAGTGGGCTATATCCCTTAGTATAGTTCACCACTATTTTGTGGCTT
ATATTACATAAATGAAAAAGAAAAAAAGGAAATAAAGATCAATGAGCCTGAAGTCATAGC
AATAGAAAGGATTGAAACTAAAGCAGAGAGTAAAAAGAAAAAAAACAAGGAAGATAGAGG
AGGAGGAGGGGAAGAAGGAGAATAAAAGTTTCTGTGGCCTGTGGAACAACAGCAAATGTT
CTAACAGCTGTGCTGTTGGAGTTCTAGAAACTGAAAAGAGAAAGAAAGGAACATTAAAAA
TTAGTGAAAGAAATAATGGCTAAAACACTACCAAATTTGATGAAAACTATATACCATAGA
CCCAAGAAGTTCTATCAACCCAAAGCTAGATTTAAAAAAGACATACATAGACACAAAATC
AAAGTACACTATAATTAAATTGATGAAATCATTGATATAAAAACCTTAAAAGTGCCCAGG
ATAAAAACATATACAGAGAAAAAAATAAAAATTTACAGATTCCTCATCAGAAACTATTGC
AAGTCAAAAGATAATAAATGTTACCATTCAAATGTTTGAAGAAGAAAAAAAATCTACCAA
CCCAACAATCTACCAAAGCTATACTCAGTGAAAATATATTTCAAAATTGAAATTGAACAA
AATCTTCTGTTGACAAACAAAACCTGAATTTCTTTACCAGCAGAAATAAACAGATTTTAA
AAGATCCTCAGACCGAATAAAAATGATACTAGAAGAAAATATAGTACACAAAGAAGGAAA
GGGTGCTGGAAATTTTTTCTCAATTCACTTTTTTTCTTTAAAAAATTTTTTGGAAAGTTA
ATTAACCATTTAAAACAAAACTTATAGCAATGTCTCTTGGAATTTATAGCTAGTAGAAGT
AAAATGTGTAACAATAAAAAGAACAGAAAGAAGGAAACAGATTATACTGCTGTAACTCTT
ACAACATACATGCAGTGGCATAATATTATTTAAAGGTAGACTGTGATAAGTACATGTAAC
CCTTAATCAATGGTTCTCAAACATGAGTATAAACTAAAATCACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved