Macaca_mulatta Locus Mono:335:SNORD73
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:335:SNORD73
Macaca_mulatta
Mono:335:SNORD73
5
SNORD73
1001..1066
2066
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTT
TTTTTTTTTTTTTTTTATGAAGCTGTCTCACAGTAGATGGAGTTGAAGGACAGGAAATGT
TTTTCCCCTACTTGGAAAATAGACTGAATAAGCTGGGTGCAGTGGGATGTGCCTGGAGTC
CTGGCTACTTAGGAGGCTGAGGCGGTAGGATTGTTTGAGGCCAGCCTGGGCAATATAGGA
AGACCCTGTTCCAAAAAATAATAAACATACATATATATATATACACACACAGAGAAAATA
TACTGAACAGACAAAACCTTTCATGATTAATAACACATGGGAATAAGTGATGAAAAAAGT
TTCGGTCCCAGATGATGGCCAGTGATAACTTACATTTTTCTGATGTTCCCATGCAATATA
CAGTTAGCTAAGAGGGTGTAATGGAAAAAGCATAAGACTTGGACTCAGAAGACTCTACTA
AGTGTAATTCAGATAGATCATCTATCCTTTACATGTGAAAGGAAAATAATAGCTTAGCTT
ACAGGAGGATTTATGCAGGTTAAATGAGGTAGGTGTTACATGTGTAAGTTTATTCCAAGG
CTTCTCTACATTTAAAGGAAATGACTTATCCCCTTATATCTCATAACTAGGACTTTAAGA
AAAAAAATTTACTGTTACTGGTTTGCAGGATTCCAGACAGCATTGGAAAAGACATAGAAA
AGGCTTGCCAATCTATTTATCCTCTCCATGATGTCTTCGTTAGAAAAGTAAAAATGCTGA
AGAAGCCCAAGTTTGAATGTAAGTGAGAAATCACATGATTCCTGTAGGGCCAAATACATT
GTTTTTGGGTGGAGGAGGAGTTTGGGGCTATATCATGGCCTTCTTTTTCTTCCTGTCATG
CTTGCATAGTACTGATGACCATTGTTTCAAGATACACTAACAAGTTTTTTTTTTTTTTTT
GCCTTTTAGTGGGAAAGCTCATGGAGCTTCATGGTGAAGGCAGTAGTTCTGGAAAAGCCA
CTGGGGACGAGACAGGTGCTAAAGTTGAACGAGCTGATGGATATGAACCACCAGTCCAAG
AATCTGTTTAAAGTTCAGACTTCAATTAGTGTCAAATAAAAAGTGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved