Macaca_mulatta Locus Mono:255:SNORA20
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:255:SNORA20
Macaca_mulatta
Mono:255:SNORA20
3
SNORA20
1001..1114
2114
GATGGCTCTGTAGATGACAGAACAAATAGAGACTTAAATATGCTACTTAAAATTATGCA
GTTAACTAAAAATAATGCTATGCTTCTCTTCAGAGCAGGGAGATAAAGACAGTGAGAGAT
GTAAGTGAACTAAACCCTCATACTCCATAGCAGGAAATGAACAGATGATACAACAAGTTA
ATAAAAGACAGAGATAAATTGGAAGTCTTTGGAAATATGGAGTTAAACTCAGAAAGCCTA
AAACCAGAAATGGTTAAATGTGATTCCCCCGGGGAGTAATCCTGAGGGTGGAGAGGAGGA
TGGCTGAGAACTTAGCATGTTTTCAGAAGCCTTCCGGATTGAATTGATTTTTAACCACAT
GCATGTATTACACTCACAAAAAATTTAAACAAAAATTAGTTTCAAAACTATCGCTACATT
TTATATGATAACAGCAAATTCCTATATTTTAGGCACTGTTTTAAGCATTTGACATTAATC
TCTTCATTGGTTTTTTCAACAACCTTATAAAGTAAGACTCCTAAATCAGACTCTCTCAGA
TGTAGACCCTGATCTAAGGATTTGAGCACAAATGATTTAAAGGGCTCCCAGGAAAAACCA
GGAGAGGAGCGAGGACACCAGGATGAGAGGGCAAGAAGCCAAGCAAAGGCAGGATTTCAG
GGCAAGTCCCAGCCTCATCCTGATTCCAGGGAGCTCTGAAGCATAAATGACACCTTGGGG
TTTATCCTGCTTCACAGGGTCCATCTATTCCCTTGACTACTCCCAACACCAGTGAGTCAC
TGATTCCAGCTGGGGACTGGGCATAAACTCCAAAACATTTTGACTTTCCGTAAGGGGGAA
GCGACTTCCGTGCCTAAGAATCAAATAACTTCTAAGAATCAAAGTATATATATATTATAT
ATATTTATAATATTATATACCATATAATTATATTTTATACATATTTACAATGTTATATAT
AATATATATATTACACCAAGCCATGTTAAAGACACAGATGGCTTCCCATTTATTTGCTGC
TTATAGTCTCACAGTGATATGAGCAATTATACACATGGGATAAAATAATATTGGGACACT
GGTTAGTTCATCTCTTCTGCATGGACTAGACATTGTTTCTGTCTAGTGTATCTAAATATC
CTTGAATTGGTGAAGGTTTTAACATATTGACAGAAACTAAATGTCTATCAGATGAAGGTT
AGTCATTACTGGAAGTACAGAAAGATGGCATCAGAGAAGCCACTTCTGAGGTTGGAGTGA
TGGTCAGAGGCCATGCCCTATCTAGTCCAACTGGCAGGCATATCCCACTGTGTAGACACA
TGTGGCCATTATATCTCTGAACAAATTGACGTGTCAAGTCCTGTATTTATACTCATCTTG
TAACCTTCTGACAAGATAAGGATTTTCATGGAATCGTCCTTTATAAGCAGAGAAGGTGTT
GACCAAAGGGCAATAATATTAGTGCCCCTTGACAATTATATTTCTCTTTGTAAATTAAAA
CGGGCATTCTGGTTTTATAATCTATCTTCTTCAGTTTGAGTCAGCATTGTGATATTCTGA
TCCAGCCTAGGACACTAATTAAATTGAGTTTGTTGCCCTAGGCTGAGATCTAGACCCTAT
ACGGGACCAAATTCATCTTTGGCTCCACTGATGATACCAACTGTGGCGTGAACCTTCTTT
TGAAAAGTCAACAATGGACATTTGTTCCTGATAGATGAAGAAATATTCCCTAGGACTATT
CCACAGGATGCTAGTTCCCACATATGCTCCATGAAAAAAAAGCGTCCAATGGCCAAAAAA
ATTATTTTGGAGATACTGGATGTTTCATCCTATTTTTGGAAATCCAGTGAGCATTAGAAT
ATTAATGGGTAGAATTTCAGCATTAAAGAAACGTGATTAACATTTTCTATCCAATACCAA
CCAAACTCATTTGACCTTGGAACGCCATCTTTTTTTTTTTTTGACACAAACTAATGCATA
CATATATGGAACTAATATTATTGGGAGGGCCCACTTAGAAATAACCTGAAGGTCACTGTC
TTTGTTGTCAGACATGAGCATTTTATAAATGAAGAAATTTTATACATATGTCTATATATA
TACACACACATATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved