Macaca_mulatta Locus Mono:69:SNORD65
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:69:SNORD65
Macaca_mulatta
Mono:69:SNORD65
4
SNORD65
1001..1073
2073
AGGAATATAAAGGAGTTATAATGACGTCAGAAGTAATCATCCCTAGTTATCATAAAGGG
CCAGGATTGCTATTGCACAATGGAGCAGTGATAAGTATGTCTGAGATTCAAAGGAGTCAC
CAGAACACCTCTTGGGACTTACTTGCTTGATACAACAACCATAGCCTGTCAAGGTCATGA
TATCCAGGAATTTCAAACACCCCATGTTAAAGGTCTGAATGACCCCACCAAATAATCAAC
TTAGATAGCAGGCATGCAGAATAATGGTAAGGGAAATCTAATGGGTAACAACAAAGAAAA
ATGATGATCTGATGTAGACTAGCCATCAGCTATGAGCAGAGAAGGGCATTTCTTCACTGA
CTTTGTTATAATTATTTTTTATTAGAAATGATTATGAGACACCAACTTGTAGAATTAGTG
AAAATATTTATTTAATATGGGGCACAAATCGAGGTGAGTGATGCAAGATGTGACATCTCT
ACCAGATACCATCAGTGCTCCACTCATCTCCTATTGTCCTACTTCAGGGTTTCTCTGCCT
GGGGACATTCTATAACTGCAGGAACATTTCTGGTTTAACAAATGAAGACAGGCTGAAAGT
GCAAGGACTTAATTATCCATCAGAAACCTTCAGCTAGTTAGGTTCTAGAGCTGGTGAATC
AATGTCCCATCTTCCTTATGCCTTTGTGAGACAATTTGGAATATGTGTCATAGAGTCCTC
AGTCATCCTCAGAAATTATCAATTTGTTAACAGTTTTTACTAGATAGTCTTTTGTCCTCC
TTTCCTTTTTCTGATCCCTCACTATGATTTCTGAGATCACCTCCCAAATAGAATATGTGC
AACTAGATACTTCTTTTAGAGATAGTTTTTGCAATAACCCAAATTATGACATCCTCTTTT
TGTTAAATAATAAAATTTTAGTTCATAATCAAAATTTAACACAGATTATGTTCCATTACG
CCTTCTGCACACAGATGTTTATCAAAAATATATTGGAGATCAAATGATGAACTCACATTA
AAAAGCTGTAATAACCAGCAGATTGTGTAATGGCAAACCTACGGTTTTCTGAAGATTAAA
ATAACAAAATTAAATATATATGTATATGTCTATATATGACAGAATTCCAGTGCAATTATA
AAATAATTCATATATTTATGGCTATGTGTTTATAGACACACTTAACACAACTTGGGTCTT
TTACATTGTATTATTTTAGTTACATATTATATAACCATGCAAAATCATGTGACTAGAAAT
ACTGAGGTCTGCAAACTCATGTTAGTTAATGAATATGAATACAACTTGTGATTATACATT
CCCTGTGAAGCAAAAATACACTGGAATGAGACTTTCAGTGTTCTGTCATACTATCATACC
TGTATAAGTGTCTATTTGTTTTCTCAACCCAAATTTACAAATAGTTATAAACTAAGTCAT
ACTAATCTCTCAACATGCCCTTAAGGGGAGCATCGACTTATATTTATTGGAATTTTAAGT
AAGCATAGACCACTTATTTAAGGTTTCAAGCAATGTCTATAACAAATACATTGTATTATT
ACATAATATATCAATAATTAGATATCCCTTTTAACATAATGTAAAATTTGCTGTAGAGTA
TTAAAAACCACGTTTTTCTATTTCAACTTACTGTTTGAAGTAGAAGACAAACATGGGCAC
ATGCATTGTAAAGGTCCATTATATTTTTACCATATTTTCAAAGAGAAATAGTATTCCATC
ACGTTTTCAAAGAAAAAGAAAACACAAGAATTTAGGTGTGAATTTAAAGAAGAAACAAAC
TGCAGTAACATACATTTATTTATTATTAAAAATATTCTGGGATATTGAAACCTCATATAT
ATTAGAAAAAATTTGGAACTTAAGACATGAAGATTTTTTAGACCACACCAGGGATAATAA
TTCAAAATATTCAGAGGTCAGAAGACTGTAAAAAGCATCATTTCTCCTATAATATTTTTT
CTCACACACTCCTGAAAGAAAACATGACGATCTCCATTCTTACACATGAGACAATTGAGA
CTGACGAAGAGTGAGATAGAACACTTCTGTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved