Macaca_mulatta Locus Mono:101:SNORD60
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:101:SNORD60
Macaca_mulatta
Mono:101:SNORD60
1
SNORD60
1001..1086
2086
AATACATTTAAAAACTGGTGGAGATATAATTATTGAAAAATGATAATTCATTGCTATCT
AGGTTGCAGTGAAATAGATACACTCAAATGCTGCTAGTGGTGTAGTAAAACGGACTTGAA
ATGAAAGCGGAAGGTCAATATGATGCAAGAGTAAAGATGTTTCCTTTAACTTCAATATCT
GCTCCTGGAACTTTAAGGAAATAATCTAAAATAAACCAGAAAAGTAGTATGTACAAAGGT
ATCCATCACAGTGTAGTTACCAATAGTAAAACCCTGGGAATGGTTAGGAATTTAAGGTTA
TATCAGCAAGGTATTTTTTTTTTTTTTTTTTTTTTTTTAGATGGAGTCCCTCCCGATCCC
CCAGGTTGGAGTGCAGTGGTGCAATCTCGGCTCACTGCAACCTCCACCTCCTAGGTTCAA
GCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGTGTGACTACCATGCCCG
GCTAATTTTTGAATTTTTAGTAAAGACAGGGTTTCACCATGTTGGTCATGCTGGTCTCAA
ACTCCTGACCTCGTGATCTGCCTCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCCTGAA
CCTCCGCGCTCCGCCAGCAAGGCACAATATTTAGCAGCCATTACAAGTACTATGAAAACT
GTTTGGATGCAGAGGCACCCACATTTGCAAACATCCTGAAAGCCTGGTAGAGTGTGAAGA
CAGAAAAGAAAGCAAAGTGGCAGAAATACAGTGGAAAGGGCACACGACTATCAGAGGGGA
CAAGCCTTATAGACCTTGTTCAGGACCATGGGTTTCATACTAATTGCAAAGGGAAGCCAC
TGGAGAATTCTGAGCAGAGGGTGACATAACCAGAATGGTGGGTTTTAAATGATCCTTCCT
TATAATGTGGAAATCTATTCTTTTAAATGCAAGTATGCAGACAAGGCATTACACAAAAAT
GTATCAGGGTGATTGCATAGAGGGTAGCGTTTTTTCTCCCTTGTCAAAAATTCCCCAATC
CTATTTCTGACACCTCATATGAAAGCTGCACATGCAGTCTTATTATTATTTTGCAAGCCT
GGGGCTTGGGCAAAAAAAGAAAAAAAAATCCCCAATCCTGTTGACATAACATTCCCTACT
TTAAAATAGAGAAAACAGTTATCCTATAGACAGCAGCTGTGTTTTCTGTGAAACATTGTG
TCCCACAAATGTAGGAGACTATGCACAGAGTGGGGAGGCTTGGGAAGGAGGCTGTTATCT
TACGAAATGGGCTAGTGGGTGGGGTAGGAGGTGAAAGTGTGTTATCGACCTCCATCAGAA
GTTCTTTTTCCAGTGGGTGATAAACCATCAAAAAGAGCTTCCTGTTGATGTTACAGATGT
TATAACTTCACTTATCACTGTTTGATCTCCCCTAGCGCGTTACCCTCGGGGCAGGAGTCT
GTCAGCTCGAAGCAGAGATAAGGGGGCCACATGTCCCAGGGCTTGGCAGATGGAGCCCTG
AACCCAGACCTCAGTAGGAAGCATCAGCGTGAATCCATTCCCAGTAGCCTCTGAGCAGGA
GCAGGCAAAGTGCCTTCTTTTTGAAATAGGGCCTCACTATGTTACCCAGGTTGGAGTGCA
GTGGAGTGATCATGGCCCACTGCAATCTCTGCCCCTCAGGCTCAAACGATTTTTTCACCT
CAGCTTCCCGAGTAGCTGGGACTACAGGCACATGCCACCACATCCAGCTAATTTATATAT
ATATATACACACACACACACACATATATACACACACATATATACACACACAAAATTTTTA
TATATATATATACACACACATATATATAAAATACACACACACACACACGCATATACACAA
CATAGCAAAATCTTGTCTCTATATGTATGTTGCCCAGGCTGGTCTCAAACTCCTGGGCTC
AAGCCATCTGTCTGCCTTGGCCTTCCAAAATGCTGGAACTACAGGCTGAAGAGTCGTTTT
GAGCAAATTATCTTCTCATCATCAGCAAGTGTTTGCATGTAGTAAGGACTGGACATGATG
CATGTATACACCATGCATATGTAACACAGCACCTTAAATCACTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved