Macaca_mulatta Locus Mono:149:SNORA1
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:149:SNORA1
Macaca_mulatta
Mono:149:SNORA1
20
SNORA1
1001..1133
2133
TCAATGGACTTCTCACATCCATCTCCTCTGCACGGCCCACGTGGAGGGTCCTGGGGCAG
ATTTTGGTGGCTGTGAATCCACGAATCTAAGAGAGAGACATCACTTCTGAGCTGGCTCTG
GACAGTCATGATGTGCTCAGAGTGAGGGCTGGCACTCCTCACCAGCCCACCTAGCCCAGC
GACAGTGCCCGGAACCTGCTCAAACCCATAAACAGGGCCAATTCTGTAGCCAGAGCTTGA
GTCCAGCCAGTGCAACCACATTCCAGGGGCCCCCAAAAGCCCAGCGTAGAGCTCAAAGCA
GAGGCCAACAGGAACCCAGGGTCCAGCGTTGTAGGTCTTTTGCTAGAACTCCTTTGTGAA
GATTTTTGCTTCATGATCTCAGGAAGGAAGAGCAAATACCATGTGTGTTTATGCTTCCTG
AGTACTTGGGTTAAGCCCTTGATTAAGAATGTTTGGGCTCCTGGTGCTACAGCAGATCTT
TATTATCTGAGAATAAGGATGCCTTACAGCGGTGATTGTCAACATCGGTTCACATTGGAA
TTACCTTGGGAAGGGAGGCTGGAAAAATGCTAAGGCTGGGGTTCTACTCCCAGGGATTCT
TACTTTATCTGGGCATCTGAATTCCTCTCCTCTCCTCTCCTCTCTTCTCCTCTCCTCTCC
TTTCCTCTCCTCTCCTCTCCTCTCCCCTTCTTTTCTTTTTGAGAGATAGGGTCTTGCTCT
GTCACCAGGCTGGAGTGCAGTGGTGCAATCATAGCTCACCGCAGCCTTGAACTACTGGAC
TCCAGCAATCCTCCTGCCTTAGTCTCCTGAGTAGCTAGGACTGCAGGTGCACGCCACCAT
ACCTGTCTAATTTTTAAGTTTTTGTTTTTTTTTTGGTAGAGATAGGGTCTTGCTATGTTG
CCCAGGCTGTGGATTTTTCAAAGCTCCCTGGGTGATTCTAACTGTGCAACTAAAGTCAAG
GACCACACCTTCAGGTGAGTCCACTGAGAAATAGGAACTAAAGCCTCTTTCTAGATGAAA
ATGGGCACTATCGACCGTGGTGTCTGAAAATCGTCAGCGGCTAAATTGAAACACAGGTTA
TGCTTCCATAACAGTGTATATATTGCAGTGGGGACAATGAGACCTGTAACATTTTGAAAA
TTTTTTTAAGAAAATAAAATAAAATAAAAAAAAACCCGGGGACTCCCATTCCATAGTAAA
CAATCGAGTCCAAAAGCGTGCTTCCAACTTGATCTGAAAATGAAATTATAATTCAGGAAA
ACATGCCGATTTTTCTGATCTTCATGCACTAGGGTGAACAAAAAAAGTAAGCTTTGTTGA
TTTCAGAGCAGCAGGGATGGGGCATGCATAATTTTTCTGATAAAATCACGTGATGGTCCA
GTATGAAATCTTTCCCTTCCCTGACAAGATCACGAAGTTTGACTTTCACAGCAGGATCAT
AAAATAGGTCATTTTTGCAAGAAATATTTGAGCATGTCATCAGTTTTCCTAAGGGCTCCT
GTTAATCCTTTGATATTCAAATCATTGGATGTGTCTATCACATCATCATTCTTGTCAATT
TTCTCTTCTTCCATTGTTAGCTTGTGTCCCTCCAGCAGGCTCTTGTCTACCCATGGTTAA
CACATCACGTTTTGCCTCCTATTTTCGTTGTATTGTCACGTGTTGACAAGAGCTGGCAAT
CGGAAAGAGGCTGCTGGACAAAAACCGGGAATTGCAGAGTGTTAAATGGGGCAGGGGTGT
GGAGTGGAGTGGGGAGGGGATGCCTGTGTAGGGAATGATTTTATAACTGGTCCGATCGCG
AATGCACATATTCATATTAAGACAGAGTTTACTTGCCTGTCCGTGCAACCTTGCACACAC
AGGGATGTGGATTTTGAATTCATAGTAACAAGGACCCTGAGCTAAACTTGGCCCCTGATC
AAGATGAAGCACTTAGGGTATAACAATTACAAATTACCACTTCTAATAAGAGAACCATGA
GTCAGTTTCTGAGAAATAAATATTTTCTTCTGGTATACAGAACTGTGGTTGGTGCACAAC
CTGATTTACTCTTTTCTCATTCTTTTTTTCTTTTTTTTTTTTTTTTGAGACAGAGTCTTG
CTCTGTTGCCTAGGCTGAAGTGCAGTGGCACAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved