Macaca_mulatta Locus Mono:265:SNORD46
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:265:SNORD46
Macaca_mulatta
Mono:265:SNORD46
3
SNORD46
1001..1105
2105
AAACTAATTTTCTTGCCATCGGTGTATCTTTAAAATCACTGGTCAAGGAATAATAATCC
TTTTACATGGGCAAAATATATGTTTTATTTATTCACACATTTCAGGGTGAAAACATTATT
TTTCTAATTTCAACCCTTGGGCCCAAATATAACTTCCCTGAGAACGAATCATCTGTGACA
TTAAAGGTGATGAATGGATGGCAGAAATTTGCCCCCTTCCCTGTCCAATCATGGGACAAC
TGAACTACAGAACTTATCTTCCTAGAAGAAGGCATTTTCCCAAGTGGAATACAAGTTATG
GGGGCATGAGAGGAGTCTTCAGGTTCACAGATGCAGCATTTTCCATGCCGTGTTCTTCCC
CACTCGTAAAAGTTTGATTTTTAGCATCTGGCATTAAAAAAAATCAATCCTGCCTAATGA
CACCTCTCATTCCTAATCTTTCTTTCCTTTCTTTGGTGAAAATCTTTGTGGAGTCTCAGT
ACACATTTTTCATTAGCATTTCTTCTGAGTTTCCTTAGATTTTACAAGTGGTTAAGCAAT
TAGTATACTTCTTAAAACTTTAAGCAAATAAATGCTGACAATAACACAATGTGTAGTTAC
TACCACGGTGACAATGAAGCCAACTATATCATTTTCATTGGCTCATGGGAAGTGTGCACA
ATCAGTGTCTACAATGAGCCTGTGAAAACTTAGAGCTTACATTTCACAATATGAAAAGCA
CTTTCCAAACATTTGCTCATTGTACCATAATCTTCTCAAGATTGGCTACACCGAGCAACT
CAAACAGGTCTGTGTCTCAGTCATATTTAGCCTCAGTCCTTACCAGTGCCTGGTACCTCA
CAAATGTCTTCCAGACTTTGTTAAGGGAATGGTGGCTTTCCCTGAACCATTCAGCAGAGA
TTCAAATTTACAGGTTACAAAGTAGCTGCTAAGTGTCAGAGTGAGACACAATGCCAAGGC
TATGGCTACTGGCAGATCATGACCTTGCTTTGAAAAGGGGGTACTGGAGTGATGAAAAAT
GTATCTTCAGGTGTGGCTGTGGCCACCTTGGCCACCTGTGTGTCACTTGCCCATGCAAGG
ACTTGTCATAGTTACACTGACTGTTAAAAAGAAACAAAGGAAGAAAAAGGGAGGTGGGGT
CAACATTGGGAGCTCTTTGGGGATAGGAACAGTAGAAAAAATAGAATCTGTGGTTGCTTT
AAAAAAAATTTTGTGCCATTGTGGCTTCTCCATGGATGGCTCTTTAATTTTCATGTATTA
ACTGTGTAATATAATCCTCCTTGTGGAACCCCATATCTTTTTTTTATTTTTTTGGAGACA
GGGTCTTACCTGTCACCCAAGCTAGAATGCAGTGGTGTGATCCCATCTCGCTGCTGCCTT
GACTTCTTGGGTTCAAGCGATCCTCCTACCTCAACCCCTCAAATAGCTGGAACTACAGGC
ACATGTCACCACACCTGGCTAATTTGTGTAATTTTTTTGTCCAGACAGGGTTTTGTCACG
TTGCCCAGGCTGGTCTCAAACTCCTGAGCCCAAGTAATCTGCCAGCCTCAGCCTCCCAAA
GAGGCAGTCCCGTATCTTCTTTTTAGCTATGTATTTTATAAATGTCTAGACTGTACAACT
TTCATGTGTATTTTTAAAGTTTGATGATGTGAGGGTCATTATCCATGGTAAATGGCCTAT
TTTGGTACCTCCGGTGCAGTTTTATAATTCTGCTGATTATGATAGCATCTTATGTTGAGT
CAACCATAATAAAGATAGTTGCAGGGGGAAAAAGAGAGTCACAAAGAGTTGAAATCTCCC
TGTTGTGAAATCTTCAGGATCATCTACAAGATACAGCATGGTACCATGAGAAGATGAAGC
CATAGCCGCCTCAGACCCTCGGCACTGCAGATTCCTAATGCTGCCAGCTTTGCGTTGTTG
CTGTGGGCATTAAATGAAAGAGTGTGATGGTGGATTTAATATGTCAACCTGTCTAGGTTA
TGGTGCCCAGCTGTTTGGTCAAACACCACTCTGAATGTTGCTGTGAATTTTTATGATTTT
TAAATAATTTTCTACATGTGATTAAATTTAATTCAGTAGACTTTGACCAAAAACAGATCA
CCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved