Macaca_mulatta Locus Mono:241:SNORA8
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:241:SNORA8
Macaca_mulatta
Mono:241:SNORA8
X
SNORA8
1001..1139
2139
GCCCCATCCAAGATCTGTTGAGTTGGAAACTGTGGTTGGGGCCCAGCAATCTATTTTAG
TAAGCCCTCCAGGTGATTCAGATGCAGGCTTAAGTTTGAGAACCACTGTTGTAGGCGGTT
GTGGTTGGCCCCATTCTTGGAGTAGAATTCTGGGTCTTTAAAATGTATTTGTTTATTTCA
TTTTAGTGATGGAGGTCTTGCCATGTTGCCCAGGTTGGTCTCAAACTCCTGAGCTCAAGC
ATCCTCCCATCTCAGTCTCCCAAATTTCTAGGATTACAAGTGTGAGCCACCACACCTGGC
TGAAGAATTCTGGGTCTTTAAATGGCCAGTCAGAGCAAGCTTAGCACTCCTTACAGTGAG
CAAGGTTCTCCTCATTCCCTGAACAACCTTCACTGGATAACTATATTTGAAAGTTGAGCC
ATAGCCGTAGGAAATATTTCTCCAGTAACACAGTTTGTATTTAATAATAATTCAGCAACA
AAATACAGCAACAAAAGGTCATGGCACCCTAGCTTCTCAGGATTAGAAGACTGCAAAGAT
CATGTCATGCACTGCTTCTCAAACTTTAATGTGCATAGAAATATTTGGGACTTTGTTTAA
AAGGCAGGTTCTGGCCGGGCATAGTGGCTTATGCCTGCAGTCCCAGCACTTTGAGAGGCC
ACATTGGAAGAATTGCTTAAGCCCAAGAGTTTGAGACCCAGCTTAGGCAGCATGGTGGAA
TCCCATCTCTAAAAATCTTAAAAATTAGCTGGGCATGGTAATGCATGCACCTGTAGTCCC
TGCTACTCAGGAGGCTGAGGCAGGAGGATCCCTTGAGCCCAGGAGGTCGAGGCTGCAGTG
AGCCATGATTGCACCTCTACGCTCCAGTCTGGGTGAAAGAGTGAGACCCTGCCTCCAAAT
ATAAATATATATATATATATATATATATATATAATGCAAGTTCTGATTCAGGAGGTCTAG
GGTGAGGCTTTAGAGTCTTTGTTCCTTAAAAGCTTCCAGGATGCACTGCATGGTATCTGC
ACTCAGCGGTTTACTCCTGCTAGGGTGTTCAAAGATTAGTGCCATAGAAATCCAGTATCT
GGCTTCATTGATTTTCTTGGCTTTGTGCTTGTTAAACCTGGTATTTCTATTGATAAAGCA
CTTGTATAGGTTTCTCATACTCTTCAGTTTGATATATTCTAAAAGAGTAAGCAATGCTTT
TCTTTTTCTAGGGTGTCAAATTGAGAATGAAGCAGATCCCCCTACTCTAAAAATGACCCT
AAAGTAAATTGGTTGAAGAAATTAGATCCCAAAGATTCTTGGTGAATTTTGACATCTTCA
TCAGTATATTCATATTTAAAAGAGATGAAAGAAACCAAAATAAAAGAATTACGGGCTGAT
AGGACAACTAGATTAAGCATCAGTTCTATTAAAAAGGGCTAACTTGAAGATATTAATAAA
TCTTTTGAAGACAAATTTTGACTACAGCTCTTTAGAGGATCCAAAGTGACCTTGATGGAC
AGTAGAAGGGATCACAACATAAAATTCCTTGAATAAAAATGTATTGACTTAAAAACAAAA
CAAAACAAAAAAAGGCTTCCAAGTGATACCAATGCTGTTTGTCTATGGACCACACATTGA
GTTGTAGGCCTCTAGTCCAAATCTGATGCTCGAATCCCCTACCTGGAACTTCCCCAACCT
GGCTTTGCCTCAGAATTGCCCCCAGGAGCTTTGAAATGCAGACCCATGAGTTCCACTCCA
AATTTCTTAAGTCAGATTCTCTTGTAGGCTACATATGTAGATTTTTTAAAAAGCTCCCCA
GGTGATGCTGATACAATCAGATTTTCAGCTGTCTGATTTGGCATTTGTGAGCCACTGGCC
TACACTGCATTCCTTCCAAGTTAACTGGTCTTGCAGCTTCTGCTTAAGCCTTTCCAGGGA
AAGAGTCACCTCCCTTGGGGGTGCTAAATGAATTTACAGAGAAGCACTAATCATAGTTCT
TATATTTAGGTCTTTGATCCATTTTGAGTTAATTTTTGTATAAGGTATGAGTCCAATTTC
TTTCTTTTGCATGTGGATATTCCATTTTCTGAGCACTATTTGTTGAAAAAACTGTCTTTC
TCCATTGAATGGTCTTGGCACCTGATATGGTTTGGCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved