Macaca_mulatta Locus Mono:321:SNORD42
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:321:SNORD42
Macaca_mulatta
Mono:321:SNORD42
5
SNORD42
1001..1067
2067
AGAGAGATCATTTAGTTTAATGAAAGACTCCCTCCCTCCCAAAACATCCTTCATTTCCA
TTCGTAGGGGTTTAATAAATATTGGCTGCTTTATTCTATGAGTTGGCAAAATTGTGAAGG
GCCCAAGTTACTGTTTCAACCAACCAGGTGTGAAACTCGTGTGTGTGCATGTGTATCCTG
AAATGGGTTTTTCTATATCTAAACTTTTTCCCTCTCCTTAGAGCAAAAAGATTATTAGCT
TTTCTCCAATAATTGTATATGTATCTATAGCTGGCTCCTGCTTTTTCTTCTCTTTTCTTT
CTTTTTTTTAAAGAGACAGAGTCACACTATGTTACCCAGGCTGGAGTGCAGTGGCTATCC
ACGGGTGTGATTATAGTACACTACAGCCGGGAACCCCTGGCCTTAAGCGATCCTTCTGCC
TCAGCCTTCTGAGTAGCTGGGACTATAGGTGCATACCACTGTGCCTGGATTCTTTTCACT
TTCTTTTCCTGTTTTCTCCCTCCTATCCTCCCTCAAGAAATTTTAAAGGTGAATTGACTA
AAAAAAAAAAATCATTTTGTTGTCATGTGTGCACTCTAGAAAATCTAGTCCACATAAATA
ATAAAAAATTTCTGAACAGAAAAAGTTAAAAATGGTATTTTGTTATGTAAAAATGCTAAC
ACTGTATTTTAATTTTCATAATACTAAAGTTAAATTTCTAATGCTTTAAACTTTCTAAAT
TTTTATATTGGGCTTCAGAGTCAAATAACTTATTATTTCCAAAAATTGTGTAAGATTGAA
AATATAATATGGTGCTTAATTAAATAAAAATGTAATTAATTACAGATGTCTTTTAAAAGA
TTTTGATTACGTGAAATTCCTGTAATACTATAAAATGTGTTAATTAAAATTTTAATTTCC
AAGTTTTAAAAATCTTAAGAACTTATACAACAATTAATTGATATGTGATCTTTGGATACT
TGAACAATTTTAAGTTAAAAAATGATATAAAACTCTGGTCATAGCATATGATGGAAAAAT
CTTAATCTTCTGAGACTTGTGATGTCCTCAAAAGAACCACTGATGCATGTGTGGAAATTT
TATAATATAAAGAAAAAGAAAGGTAAAAAAAAGCCCTCCCTAAGATGGCTGCTGACGACG
AACTACTGCTCCCGCTGCCCCCCAGGCTGTTGGAAACCGGCAAACAGATTCTGGACGAAG
TAGAAGTAGCGACTGAACCCGCCGGTTCCCGGATAGTCCAGGAGAAGGTGTTCAAGGGCC
TGGACCTGCTTGATAAGGCTGCCGAAACGTTACCGCCGCTCGAGTTGTTCAGCCGAAATG
AAGATTTGGAAGAGATTGCTTCCACCGACCTGAAGTGCCTGTTGGTGCCAGCGTTTCAAG
GAGCCCTCACCGTGAAACAAGTCAACCCCAGCAAGCGTCTAGATCATTTGCAGCGGGCTC
GAGAACACTTTATAAACTACTTAACTCAGTGTCATTGCTATCATGTGGCAGAGTTTGAGC
TGACCAAAGCCAAGAGCAACTCAGCCGAAAATCACACTGCTAATTCCTCCATGGCTTATC
CTAGCCTCGTTGCTATGGCATCTCAAAGACAGAGTAAAGAAGAGAGATACAAGCAGAAGA
AGGAGTTGGAGCATAGGTTGTCTGAAGTGAAATCTGCTGTGGAAAGTGGTCAAGCAGATG
ATGAGCGTGTTTGTGAATATTATCTTCTTTACCTTCAGAGGTGGATTGATATCATCTTAG
AAGAGATTAAGAGCATTGACCAGGAAATTAAGATCCTGAGAGAAAGAGACTCTTCAAGAG
GTATCAACTTTTTTTTATTTTTTTATTTTTTTTTGAGACGGAGTTTTGCTCTTATTGCCC
AGGCTGGAGTGCAATGGCACGATTTCGGCTCATGGCAACCTCCGCCTCCTGGGTTCAAGC
GATTCTCCTGCCTCAGACTCCCTAGTAACTGGGATTATAGGCATGTGCCACCACACCCGG
CTAATTTTGTATTTTTAGTAGAGATGGGGTTTCTCTGTATTGGTCAGGCTGGTCTCGAAC
TCCTGACCTCAGGTGATCCTCCTGGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved