Macaca_mulatta Locus Mono:13:SNORA25
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:13:SNORA25
Macaca_mulatta
Mono:13:SNORA25
1099214747467
SNORA25
1001..1124
1668
TACTTGTTTCCTGTGACTTTGAAGAGTGCGGCTTAAATAAGTAGGATCCTCTCTAAATT
ATGAGCTGAGTAATTACAGAGAATAAATAAAGTGTATCCCCTATAACCATTCCACTATTG
TTATTATGCTTATGATCTTCTTATTGCAGACTTCAAGGCTGTACATTAAAACACCTCTAT
GTTCCTTAAGACATGAAATACGGGATGATTAAAAAAATACTTCTGTGTTCTAAAAGTGAT
TGTGATGGCTACACAATTATGTAAATATACTAAAAAACATGCAATTGTACACTTTAACTG
GGTGAACTGTATGCTATATGAATAGCATAAAACAGCTCAACAAAGCTGTTACAAACAACA
AAAACACCTCTTCCTTAAAGATCATGAGATTATGGATGAGTAAGATGACAGCAGAGATGA
AAGTACCAAATCTACAGGATAACACAGATAAATTAAATGGTACATATTGACATATTTTAT
ACTCATAAGCAAGCCAAAAAGTCTCTTAAGATGGTGAGAAATCAAATCTATAAAGCTTGT
ATTTCTCCCATGAAACACTCCATATAAAAGCTTCGCCAAAGATCAACAACAATAATAAAC
ATATAAATTATCAAAAGAGATATCTTTTTTGGAAAAAGCTGGCTGGATACAAAAGAGGTA
AAGGAGATATACCAGTCAATTTCTTCTTCATGTACCTCCCACAGTGTACACAAGAAAGGT
GCAACCTGAGGGGACACGCATCATATGGCCCTACTGCGTTCACTGTCCCAGCACTTAATG
AATTGTCTCACTCGATGGTCAGGCATTGCTGCTCTGCAGGTGGCCCCCTCCCACTCTCCT
TGAGGGATAAGGGCTGCAAAGACGAAGTAAGTGACCCTTCAATGCCATCTCTAGTTTTAA
AAATTCACTGCATCTATATTTATAATGATGCAGACAGTAAAGGAGGATGCTTTGAGTAAA
AAGGTAATAAAGGTTGATGCTACTTAAAATAGTCAAGGTATTGGTTTAAAGCCAACTCTG
GGCTCGCATCAGAAGGCAGGAGATGAATGCTATGACCAAAGACTGAAGTTCTCTGTAGAG
TCCGCAGCACTCAATAGTGCTCTATTTTCCTGAGGAGATATAAGACAGCCACTACATAAT
CATCACATAATAATCCATGATTTATTATTATTATTTTTTTGAGACAAAGTCTTGTTCTGT
TGCCCAGGCGGGAGTACAGTGGCATGATCACAGCTCATTGTAGCTTCGACCTCTTGGGCT
CAAGCAATCCTCCCTCCTCAGCCTCCCCTGATAGCTGGAATCACACAGGCACGTGTCACC
ATACTTGACTAATCAAAAAAAATTTTTTGTGTGTAGAGATGGGGTCTCCGTATGTTGCCC
AGGTTGGTCTCGAATTTCTGAGCTCAAGTGCTCCTCCCACTTTGGCCTACCAAAATGCTG
GGATTATAGACATGAGCCACTGTGCCTGGCCTACTCATGTTCATTGATATGGGAAAGTAA
ATAAAGGTCTCAAAGTAGAGGAAGAAAAAAGAAGGAAGAAGAAGGAGGAAGGAAGAAAAA
GAAGGAGAAAGAGAAGAAGGAAAGAAAGAAGAGAGAGAAGAAAGGAGAAGGAGGAGGGGG
GAAAGAAAAAGGAAGGAAGGAGGGAAGGAAGGAAGGAAGGAAGGAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved