Macaca_mulatta Locus Mono:113:SNORA11
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:113:SNORA11
Macaca_mulatta
Mono:113:SNORA11
9
SNORA11
1001..1128
2128
TTGGCCAGGCTGGTCTTGAACACCTGACCTTGTGATCCACCTACCTCAGCCTCCCAAAG
TGCTCAGATTACAGGCATGAGCCACCCGCGCCCAGCCTTAATTTTTGTATTTTCAGTAGA
GATGGGGTTTTGCCATGTTGGCCAGGCTGGTCTTGAACTCCTGACCTCAAGTGATCCGCC
CACGTCAGTCTCCCAAAGTGTTGGGATTACCGGCATGAGCCACCGTGCTCAGCCCTAAAT
CATATTTTACAAATGTTTATATAATCTAGATGATGCTGGACTAGACAAGTGCTTAATAAG
TACTTGCTGATGAGCAGATTAGACGAAGCAAAAGAACTATCACAGCATAAGGGAAACATA
AGAACTTACTTCTGTTTGCCCTGGTTTCACAGTTGCATGGCAAGCAATCATGAGTGAGCC
GCTAGGAAAGGGCCAGTGCTGGGATGCACAGTACTGCAGGCTTTCCACCTCCAATCCCAC
CTCTTCTGCAACTTCTCGACGGATGGTCTCTTCCACACTTTCACCTACAAGCACTCAGAT
TAATTCAGGACAGCCCTGTAGCTAGAAGGGTGATACAGACAGCCCATTTGAGAAAGGCAC
ACAACACTGGCTCCAAAGTTTCAATGAAATGCTCTTGGGAGTGTCCTAAAACTCCCAGTC
ATTCCAACAATAAGAATCAGGTCCAGAGCTGTGTGTTGAACCACAGTGCTTAAGCCTGCT
AGGTTAGTTATTATAATGCAAAGTAAGGGTGACAGTAGGAGGGACTACTGCCCTCAGCTT
TCATAAAATTCCACTTTTCACCATTTGCAAATTTGACCCCAATAGACTAGAGAAAAAAAC
CAACCTGTAAATAAATACTGAATTTTAGCTAATGTTATGCCTGCTGAAATAGGAAGAAGT
GTACTAATATCTTAAATCTGTGCATCAAAAAATAAGATAGATTAATTAATGGATAGATGA
ATAGCTTTGTGATAAAGTGTAGTAAAAATTTATGGAATCTAGGGGTGTGCTCAGAGCAGG
GGGCCTAAAGAATGGCTCCTCTGTTTATAACACACCCAACAGGAATCTGGGGTCATTGTG
ATGAGAGGCACGAAGCTTGTGGCCTCCCTACAAACAAATGCCTACATGTGAAGAGGAAAA
AAAATTATAGAATCTGGGTAGTGGGTGTATGGGTGTTCACTGTATAATTCTTTCAACAAT
CTCCTATGTTTGAAAATTTGCTTAAAAAAATAGTGTGGCTCACACCTGTAATCCCAACAC
ATTGGGAGGTCAAGGCAGGCAGGTCACTTGAAGCCAGGAGTTCAGGACTGGCCTAGGCAA
CACAGCGAGATCCTGTGTCTACAAAAATTTTTAAAAATTAGCCGGGCATGATAGCCTGCG
TCTGTAGTCCTAGCTATTCAGGAGGCTGAGGTGGGAGCATTGCTTGAGCCCAGAAGGTCG
AGGCTGCAATGAGCCATGATTGTGCCACTGCACTCTAGCTTGAACAACAGGGTGAGACTC
TGTCTCAAAAAAAAAAGGAAAGGAAAAAATTTTATATATGTGTGTGTGTGTGTGTTTATA
ATGCCAGAAATTTTATATATATATATAATGCCAGAAGGCAGTTTTCTTGACATGATAGAA
AAGAATGTGCTTGGGAATCCAAACTCCATAGCAACAAGACAGAGAAGATTGTATTAGTAA
GATTGTGTATCTTCCAGTGTCACCTGTATATCCCTTTAACTCCTTACCTATATCACAAAA
ACCTGCCAAGGCAGAATACATTCCCTTGGGAAAGGAGCTTTGGCGGGCAAGCAGGCATCG
GGTCCCATCTGACACCAGTGTGATTACCACAGGAGCCATCTAGGAAAGGGGAATGGAAAC
TGAGATGCTGGCACTTGGGGGCCTGCCAATGAGCTAAAGCAATGTATAATTAAGGAACTG
CACAGGCTTTCTTCCCCAGGACAAAGCAGTGCACAGTCTTCTTGGATTACTGTCCTCTTA
CAGCAATACTTACCTGTGGATAATAGATGATATTATTGGAAGGGCACACACGCTTGCTGC
CAGCCACGTTCTTCTTGGTGGGCTGCCCACTTCTGCTGCAGAACTGATGAGCATCATGCC
AGCGGAGAAGAGCTTGAGCCTAGGGACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved