Macaca_mulatta Locus Mono:48:SNORA25
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:48:SNORA25
Macaca_mulatta
Mono:48:SNORA25
7
SNORA25
1001..1118
2118
TCTTTTGAGATGGAGTCTTGCTCTGTCATCCAGGCTGGAGTGCACTGGCATGATCTTGG
CTGACTGGAACCTTTACCTCTTGGGTTCAAGCGATTCTCCTGCCTTAGCCTCGTTAATAG
CTGGGATTACAGGTGTGTGCCACCACACCCCAGCTAATTTTTGTATTTTTTAGTAGAGAT
GGGGTTTCGCTCTGTTGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAATGATCCACCCGC
CTCAGCCTCCAAAAGTGCTGGAATTATAGGCATGAGCCACTGCACCCGGCCTGACTGAAG
AATCTTAATAAAGATGCTCTTCCAGCTTCTCTGACAACCAGATATTAACAGACAAAACTG
CCTTGGTGCCAACAAACAGCAGTTAGTAATATACTACAGCCTCTTTTTTATCTTTTGATA
TTCTAGGATTAGAAAATGTTTAAAGACATAAGATCTATAAATCTACAAAGAAGGTACAGA
CTGTGCATACAAGCCTGTTGCTGTTCACAAGACTCATGGAAATAGAACTTCTTGATGAAA
GCTACCCTCACTCCGAACGCACTCTCAGCCAGATCAATCCCTCAGTTCTATTGAACCTAC
TTCTTTATCTCAATATCCATTTCCTTCATCTCCACTGCAAACTGCCTAATCGGAGCTGCC
AACAATTCTGTCTTGCCTGGACTACTGTAAAGCCTTCTAATTGATATCCATGACTTTAGT
CTTTGCCTCTGCTAAACTCTTTTCCTCACTGCAGCCCAAATGACCTTTCCAAAACACAAA
CCTGACTGTAACACTCCCCTCTTAAAAAACCTTTCAATGAATTACCATCACTGACAGGAT
AAAGTCAAAAAACCCTAGCTTCAAAGAGCAAAAAGTTTAATCACACAGTAGCCCCTTCTT
ATTCACGGTTTTGCTTTCCATGGTTTCAGTTAACTGTGGCCAATCTTGGTCTGAAAATAT
TAAATGAAAAATTCCAGAAAGAAACAATTGATAAATTTTATAGGTCATTTCAAAGAGGCT
GTGAAACCAAGAGCTCTTAATGCTGTGACCAAAGATGGAAGTTCTCTATAGGATGCCATG
GCACTTGATGGTGGTATGTTTTCCTGTGGAGATTTAAGACTTAGGTGTTATATGACATAG
TAATCCATGATTGTTGCCATGGGAGAGTTTTAAAGATTAACCAAAGTAAAAAGAAAAAAC
AAATTGTAAAATTTGCGCTGTTCTGAGCAGCATGATAAAATCTCATGCCATCCCACCTGG
GATGTGAAACAACCCCTTGTCCAGTATAACCACAAGGTATACACTAGGCTGCCCGTTACC
CATTAAGTAGCTGTCTTGTTACCAGATCAACCGTCCTGGTATCTCAGGGCTTGAGTGCAA
GTAACCATTATTTTACTTAATAAATGGCCCCAAAGTGCAAGAGTAGTGATACCAGCATAT
TACTATAGCTGTTCTATTTTATGATTATGGTTGTTAATCTCTTATGGTGCCTAATTTATA
AATTAAACTTTATCACAGGTGTGTATGTATAGGAAAAAACATAATATATGTAGGGTTTGG
TACTATCCACAGGGTCAGGCATCTGCTGGGGATCTGGGAAAGTATCTTTTGTGGATAAGG
TGGACTGCTGTACTCTCTTGGCCAGGGTTACAGGCATCGCACAGCCTCTACAGATGGCAA
TTTGGCATTATCTATTAAAACTAAAAATACTTATACTCTTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGACTTATATACAAGGATATTTACTGCAGCATTGTTTATGATAGCAATAGACTAGAAA
TCACCTAAATTCCAACAATACAGGACTGATCCAATGAATTATGGTATGTCTACATTCCAA
ATAAACAAAACAAATATCCAAATAAAAAAGCAAGGTAAAGGATAGAAAATATAATATGCA
ACCTTTGTGTGGAAAATACACAGACACACACACATATTTTCAAATGTTAAAGAAAACAGC
TCTGAAAGGATGCCCAAAGAACCTGCTTTGGCAACTGCCTTCAGGAAGAGGACCTGAGCA
GTGGGGATAGCAAAGTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved