Macaca_mulatta Locus Mono:293:SNORA27
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:293:SNORA27
Macaca_mulatta
Mono:293:SNORA27
6
SNORA27
1001..1126
2126
CATATAAATAAATAAGGAACAATAATAAGGTAACTACATGTGTAAATATAAAAGCCCAT
AATATTGCATTTTTTGTTTGTAACTCCTCTTTTTTGCCCATAGGATTTAAAAAACAAATG
CGTAAAACAATAATTGTAAACCTATGATAATGGGCACACAATGTATAAAGATGTAATTTG
TGACATTAGCAACATAATGGGAAAAGATGCAGATGTATAGGGGTAAAATCTTTATAGATA
TTGAAGCTAAGTTGGTATTAATTCAAGCTGGATTGCTATATGGTTTTTGTTTGTTTGTTT
GTTTGTTTGTTTGTTTTAGATGAGGTCTCACTATGTTGCCCAAGCTGGTTTCAAACTTCT
GGGTTCAAAAGATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTGCGTACCA
TTGTGCCTGGTGAGACTGTTTTAAATTTAAGATATTAGCCGGACATGGTGGCTCACGACT
GTAATCCCAGCACTTTGGGAGGCTGTGGGCAGATCACGAGGTCAAGAGATCAGGACCATC
CTGGCCAACATGGTGAAACCCCATCTCTACTAAAAAATACAAAAATTAGCTGCACCTGTA
GTCCCAGCTACTCGGGAGGCTGAGGCAGGAGACTCACTTGAACCCGGGAGGCGGAGGTTG
CAGTGAGCTGAGATCACGCCACTGCACTCCAGCCTGGAGACAGAGCGAGACTGTGTCTCT
AAATAAATAAATAAATAAATGAAATTTAAGATATTAATTGTAATCTCCAAAATGGCCACA
AGGAAAATAAGTGGGTTTTTTTTGTTTGTTTGTTTTGTTTTTTTAGACAGGGTATCACTC
TGTCAGCCAGGCTAGAGTGTAGTGGCACGATCACCGCTCACTGCAGCCTCAACTTTCCAG
GCTCCAGTGATCCTCCCACTTCAGCTTCCTGAGTAGCTAGGACCACAGGCCTGCACCACC
ATGCCTGTCCAATAGAAAAATAACCTTTAAAAATATGGAAAAACCCCCTGTTCACTTTTT
AAAATGGATTTATGTCTTTATTGCTCATTAATTGGGGCAAAGGAAATATCCTTTTAAAAC
TCAGGCAAACTGAGTGTTTGTCTTGTATCCTGTCAGAGGAAAGAAATTGAAAAAGAAAAA
AAAAGGAAAAAATATCAAAAAGGTAACGTGAAAAAAAATCAACACAGCACATTGCAAAAA
ATCAATTAAATACAAAAGGCAATATTAGAGGAATTAAGAAACAAAAATATATAGCCAAAT
AGCAAGATGGCAGGGGTAAGTATTTGTTATCAGTGATCACTTTAAAGGTAAATGGAATAA
ACTCCCCAATTAAATAACAAAGTTTGGAAGAATAGGTCTTTTTTTTTTTTTGGTTGGAAG
AATAGATTGAAAAAAAAAAAAAACCATAATTTATCTATGTGTTGTCTACAAGAGACTCAC
TTTATTTTCTTTATTTTTTTAAGAGACAGGGTCTCACCCTGTTGCCTAGGCTGGAGTACA
GTGATGTGATCAAGGCTCACTGCAGCCTCAACCTCCCGGGCTCTAATGATCCTCCTGCCT
CAGCCTCCAAGTAGCTGGAGCTACAGGTATGTGCCACTATACCTAGTTATTTTTATTTTT
TGTAGATATGGGATCTTATTATGTTGCCTAGTCTGGTTTCAAACTTCTGAACTCAAGTGA
TTCTTCTACCTTGGCCTCCAAAAGTGTTGGGATTACAGGCATGAGCTGCCATGCCCAGCC
AAGACCCACTTTAGATCCAAAGACACAAATAGGTTAAAAGTAAGAAGATGGAAAAAGATA
TAAAAGAGTCTGTAGTGGCTATATAAATATCACACCAAATAGACTGTAAGTCAAAAATTG
TTACAAGAGACAAAGAAGTACATTATATATTCATAAAAGGTTCAACTCATCAAAAAGATA
AAACAAATATAAACATGTATGCACTTGACAAAAGACCAAATATGCGAAGCAAAAGTGGAC
AGAAATGAAGGGAGAAATAGATAGTTCTACAGTAATAGTTGGAGACTTCAATACTCTACT
TTCTTTTCTTTTCTTTTTCTTTTTTTGAGAAAAGGTCTCACTATTATTGCCCAGGCTGGT
CTTGAATTCCTAGGCTCAAGCGATCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved