Macaca_mulatta Locus Mono:331:SNORD21
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:331:SNORD21
Macaca_mulatta
Mono:331:SNORD21
5
SNORD21
1001..1095
2095
TCCCTTGGCCACCCAGGCTGGTGCCTCACTTGGTCACATGCTCCCCAAGTCCACAGGCT
CTGAGTCTAGCACAACAGGACTTGCCCAGGGTTTGCATTCCTTGTTCCTTAAACTTCTTT
TAAGTTTACTTAGAACTCCAGAGCCCTTTAGCCCACAGTGGCAGGGCTTGCCAGATCTCA
GGTTCCAACAACTGAGATGCATAATTTTCTTCTGGCTATGGATGGTCTAAATGCTTCGGT
CATAGGCACTGGCTGAGTTCTGCCCACTGTTGCTTTCCACTGTGACAGGAAGCACTGAAT
TTCAATATAAAGTCCTGTAGTCTCTGTGCTCTCCCTTTTCCAAGCATACAGATTTTTTTC
TCCATGTCATTTGGCAATGCTGGGGGATGGAGGCGTGGCATCTGTAAATCAAGACTGTCT
TTTTTTATCCTCTTCAGGGCCTCTTTTGGTGATAAGAGGTTGAAACATTGTATTGTAAGT
GCTCACCTGATTTTTGCATCTTATAAAGGTGCTTTCTTGTGTGTGTGGATAGTTGTTCAT
GTTGGTGTTCCTGTAGGAAGGATGATCAATTAAAGATATTTGGTGATCTTGCTTCACCTC
CCAAAAAAATGAGACATTTTTGTTAACTCATAATATACTCTGAGTGTGCCGTCTTGATCT
CTGCCTTAACTGAGTAGCATCATTAAAATCACTCTAGATGAAAATAGTATTTGTAGTTGT
ACCAGGATAGATAGAGAATCATTTTCATATGTAAATATTTGGAAGCATTCCCACAATGTA
TTATAATCTGAAGATTGTTGCATATAGTAGTGTGATGCACTGTTAAATATTTCCAGGATG
GCTGGATTTGAAGAGCTGGCTTCAAATTGAGGGAAATGCTTATCGTTTCCAAGTGACAAT
TTGATAGTGGAAAACAAAAAGGAGGGTACGTGGGGAGCAGAAGGAAAAACAGGCATCTCC
TACCTCTATCGCTGCCCACAATAAACCTTTCACTGTTAATATAACGGTGAACTCAAAAAA
CTTTCCAATCCTTCAGTAGCTGATCCAGTCATTTGAAGTGGCTGTGAATTATTTCAAGAA
GGGACTGATGGTGTGTTAATCTGATCATGAGACATGATTCTTCTTGCATTGGTGTACTTA
AAAAGCATATTGGAAACAAATGTCTCCTTCAATAACAGCATGCAGTAAAAGAAAAAAAAA
ACTTACACTTGAAAAGGCTACCTTTTGAAACCACACATGGCTTGTATAAGGATAAAAAAT
CACTCTGAACGTATCGTATTCTGTCATCCCACGTGAACACCCATCTTCTCTTTTCCACTC
TTTTCTATTGTTTACCTTAACTTGGTAGCCTCTAAATCTTTTAATTTTGAAACTCAAAAC
GAACAACCCATGGAGTTATTTTGTTTTGTAATGAGTAAGAGGGGAGCAAGAACTCTCGTA
CTGATTAAAGTGAAAGCAAAAGGAGCATAGAGAAAAGAATAGAAGCCCAGCGTTGTATTG
GGGTGATTTCAGTGACCGGGAGTCTTGAACAAGGGTGGAGAAATGAATTAATGTCTGGCA
GAGAAAATTGAGTGATCTGGGAGAAATAAATGTGTATAGGGATATTAAGATGAGGTAAAC
CCTCCAGTTCTGGGAAACAATCAGTGTTGTTGAAGCTAAACCCATCACTCTTGGCTCCGT
ATGAAAACCTGAACTTGTTCTCTATCAATTGTTAGCTTTTTTTTTTTTTTTTAATTTACA
GAACAAACCCATATGTCCAATCTTGGTCTTCTCCTCTGTTGTCCCCAGCTCCCACCCACA
AGCTGGGCTCAAGCACAAGTGTTTTCCTTTTCCTCTTCCTTTTTTATTAATAGTGCTGAT
TTTGAGGGGTATACTCCGCATGCTTTACAGAAGAGTGACAAAAACAAAAGAAGCAACAGC
AATGCTTCCCCACTGAGCTATTGCTTCATAACTATGTATAATACCTTTTTGGAAAAGAAT
GATAATGTTGATTTCCCTGGAATGGAATGCATTTTTGTCAACTATGTCTTCCTCATGGAG
GAAAAAACTGAGAGGTAAGATGGTTTTATAGCAAGTTCTATTTCTTGAATAAAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved