Macaca_mulatta Locus Mono:10:SNORA64
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:10:SNORA64
Macaca_mulatta
Mono:10:SNORA64
1099214727284
SNORA64
1001..1134
1373
GTTGGATGGATATACCTGAGCGAAGCGAGAGCCACAAAACGCATTTCAGCGCATCTTCC
CACGTTCGCAGCGAATTCATTTCCAAAGAGCTGAGACAGAAGCAGCGCTCAGTTCATGCC
ATCCGAGAGGACGATGAAGTTCAGGTTGTGGGAGGACACCGTAAGGGTTAGCAAACTCAT
AGTCCGCGTGTACGGGACAGCTGTCATCCGCGTCCAGCGGGTGCAGAGGGGAAAGGCCAA
TGGCGCGTTTGTCATGTGAGCGTTCGCCCTAGCAAGGTACGGTGTTCATGGCTAGGCCAA
AGCTGGACAAACCAAAAGGAAACCTGAGTGCAAAGCCATATCTCACCAAACGAGGAAAAG
GACAAATAGGAAGAAACGATTGAGATGCTGAAACATGCTAATCTTACAAATTTCCATTAA
AACTGCTGAAACGTAAACGAAGGGGACAGATGGGGGATGCCAGGTGAGGGGGTTCATGAC
TTTTTTTTTTTTTTGGTGGGGCAGAGTCTCGGCCTGTCACCCAGGCTGGTGCGATCTCGG
CTCACTGCAACCTCTGCATCCCAGGTTCAAGCGATTCTCCTGCGTCAGCCTCCCGCATAG
CTGGGTTTACAGGTGCCGGCCACCACACCCGCCTAATTTTTTGTATGTTTAATAGAGATG
GGGTTTCACCATGTGGGCCAGGCTGGTCTTGAAATCCTGACCTTGTGGTCCGCCCACCTC
AGCTTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCCCCGCCGATGACTTTGGTTC
TTTAGTAGCATAATGGTACTAAGTTTTTCTTTAATGCACTCCCCACAATTATCTTGTTTG
TTGCAGGAATCTGAGATCATTGACTTTTTCTTGGGGGCTTCTCTCAAAGACGAGGTTTTG
AAGATTATGCCGGTGCAGAAGCAGACCCGTGCTGGCCAGCGCACCAGGTTTAAGGTACCT
GGCTGTCCTGGAGTGGGCTGGGCTGGGCTGGGCTTGTCAGGACTCTCTCGGCTCTGCGTA
GTTGCACTTGGCTTCACCCGTGTGACTTTCGTAATGGGGAGAGAGAGAAAAGATCTCCTC
AGGACCTCGGATGGGCCTTACTGTGGCCTCTCTTTCCTTGAGGGGCGCAACAGGCCCTGG
GCGGTGGGCGGTGATTGGGTGTAGGGCCACCAGTCGCCTCACACACATCTCTTCACAGGC
GTTTGTTGCTATCGGGGACTACAATGGCCACGTCGGCCTGGGTGTTAAGTGCTCCAAGGA
GGTGGCCACTGCCATCCGTGGGGCCATCATCCTGGCCAAACTCTCCATTGTCCCGGTGCG
CAGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACTGTCCCTTGCAAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved