Macaca_mulatta Locus Mono:164:SNORD56
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:164:SNORD56
Macaca_mulatta
Mono:164:SNORD56
11
SNORD56
1001..1071
2071
ATGTGCCTCTGAACCTAAAATGAAAGTTAAGAAAAAAAAAAAAAGTAAATCAGAAAAAT
AGAAAACAACAAAAAATAAAACAGAGTGGAAAAGGCAACAATATGGTGAACTTCGATACA
GCTGGCAGTGTTTGCACCTGTCCTGCCTCTACCCTCATGCTCACAATCTTCAGTGCCCAC
CAGCTGGAGTGCATCTTGCCATCTCCATTGCAGGCTGGAAGCCCCGGGGAATTGACATTC
CTTTGGAAGAGTTCTCAATCTTTGAATGACAGGAGTTGGTAAACCCCAGCTGCCTCACTG
CCTGGGTGAGATAACTCTGAAGTATGTATATGTACACCCTGAGGTTCCCCAGAGAGGTTA
AGCTCCAGTTGTCCTCAGTGGTGGTTGGTTTGATAATGCACTTAAAAAAAATCATTTCAA
TGGTTTTTGGGGTAAGGTGGTTTTTTGGTTACATGGTTAAGTTCTTTAGTGGTGATTTCC
GAGATTTTAGTGTACCTGTCACCCGAGCAGTGTACTACCCCCTCCCAACCTTCCCCCCAC
GAGTCCCCAAAGTCCATTATATAATTCTTATGCCTTTGCACTTTTATAAAAAAAGAGATG
AAACACACGTAACACAAATTAATCATTTAAAAAGGAACAATTCAGTGGCAATGTTGTGCA
ACCACCACTTCTTTCTAGTTCCAAAACATTTTCCTTATCCTAAAAGGAAACCCATGTTCA
TGAAGCTGCTGCTTCTCATGTGCTGTGCTTTTGTTGACTGTCTTTCCTTCCCTGCCTCAT
TTCTCTACCACCATCCCAAATAATTTGTACTTGAATCCTTGTCCTCAGTCAGCTTTTGGG
AGAAGCCAAATGAAGGCACTTGGGAATGTCATATTAGGTAAGAGGAAGAAAAAATTCCAA
GAAGTTACATGCAAGTTGATACTCATTTGTTAAAAACTAAAATAAAGACATACTTTTAGG
AACACACATCAGATGCAAAAAGAGTGTAAAAATGCAAGCAACCACAATGATGGCAATATT
TTTCAACAACAGAAATTAACCTCGTGAGTTTTGATATTTAGGGTATAAGTGAAAAGAAAA
ATGCAAGCAAGGCATTGATGACTGTGAGATTCGGGAAGGTGGTACATGAGGTAAGAGGCG
TAGGAAGATGGGCTTGGGAGATCACAGGGTTGGATGTGAGTTGTTGACAGGGTCCTAGGT
TTTGTTGTTGATGGTGAGTTTCTATAAGCTAATGATATTCTTAAAATGACTAATAAAATT
ATTAAATAAAAGCATAGATCAGAGATAATGCATCATACCAAATATTATAATGAGCCCAAT
CTGTGCAAACAAGCAAAACTGACATCAGTGGAATTCAAATTAAGAGAGGACAGCATTTAA
ATTTTCCAAGTTCTGTGTGGTAGGCTGAAGAAAGAGTTTTAAAAAGCGTATTTTATGTTG
CTTTTACTTGAGAAAGGATTTAATACACTCTTCCTTTGTCTTCCCTAGAAGATCATTCAA
AAGGTCATAACCTAAATGGGCATTTAGGTTATGACCTTTTGAATAGGGAGAAGTTATATT
GATAATAGGGAGAAGTAGGGAGAAGTTATATTAATGAGCACTGTTCCTCATGGCCTATGA
TGCAGTCATTCAAAACATCAGATAAGACAGATGTGTCAATATACAGAGATATCCATGCTT
CATTGATAAGTTAAAGAAGCAAGTTGAAGATATGTTTTACATGATCCTATCTTTGAAGAC
AATTTTTCTGTCATACAAAAGTGATATGTAATTTAATATATGTTGTATATATGTGTCAGT
AACCATTTATATATGTACATGAGCATATATGATTGTATATTGGAAATAACTTACCCAGTA
TTGTTAACAATGTTTTTCTATGTGATAGAATTATGAAAAATTTCTTTCTTTCTTTTTTTT
TTTTTGAGACGGAGTCTCGCTCTGTCGCCCAGGCTGGAGTGCAGTGACTGGATCTTGGCT
CACTGCAAGCTCCGCCTCCCAGGTTCATGCCATTCTCCTGCCTCAGCCTCCTGAGTAGCT
GGGACTACAGGCGCCCGCCACCTTGCCCGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved