Macaca_mulatta Locus Mono:88:SNORA51
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:88:SNORA51
Macaca_mulatta
Mono:88:SNORA51
1
SNORA51
1001..1123
2123
TTCAAGTAGTAGTAGTATAATAATGAAGGTTAAAAAGTATTTCCCTGTTTCTCTGGGAT
AAAATAGTCTGAAATGCATGTAAAATAGCCAAATAAAAAATTTGAGTGAAAATAAAAGAG
CAATGAAAATAAATTTTTTTCCCAAAACTTTCTTATATTTCTATTTAATCTTTGTATTAG
TAGTTCTCTAAAGTAAAAAATATAATTTGCAGAGTACTATTTTTTTTTTTTTTGCATGGG
AGGAACTGCTATGCTTTTTTTCCCATTAGTTTTAGTGATATAACTACAAATTTATGGGAT
ACTGATGGGCGCAATTGCTCAAGCCTGTAATTCCAGCACTTTGGGAAGCCAAGGTGGGCA
GATAGCTTGAGCTCAGGAGTTCTAGACCAGCCTGGGCAACATGGTGAAACCCTGTCTCTG
CTTAAAAAAAAAAAAAAAAAAAAAAATGCTGGGTGTGGTGACTCACGCCTGTAGTCCCAG
CACTTTGGGAGGCTGAGGCGGGTGGATCACCACGAGGTCAGAATTCGAGACCAGCCTCGC
CAAAATCCCATCTCTACTAAAAATGGGAGTGAAATCCCATCTCTACTAAAAATACAAAAA
TTAGCCGAGTGTGGTGGCAGGTGCCTGTAATCCCAGCTGCTTGGGAGGCTGAAGCAGGAG
AATTGCTTGAATCTGGGAGGCAAGGTTGCAATGAGCCGAGACCATGCCATTGCACTCCAG
CCTGGGCAACAGAGCGAGACTCCATCTAAAAAGAAAACAACCTTAGCCAGGTGTGGTGGT
GCGCCTGTGATCCCAGCTACTTGGGGGGCTGAGACTGGAGGATGGCTTAAACCCCGGAGG
CTGAGGCTGCAATGAGCCGAGATCATGCCACTTGCACACTCCAGCTTGGGCACGAGAGCA
AGACCTTGCCAAAAAAAACAAAACAAAAACCAAACCAAAACAAACAAAAAACTGTCTTTT
AAAAAAAGGCAGAAAACCAAACCAAAACAAAACAAAACCCAGGCCTCCTGGTGCTATCCC
AAGCTGGGTTCTTCCACTGACTGTACAGAATGAGGAGGTAAACTCCCATGTGCACCTCAG
CCTAGGCCCTGTGCCTTATCTGTATTGTGCATGGGAACACACAGAAAAAAAATTCATGGG
ATACAGAGTGATATTTCAATACACGCATACAATGTGTAATGATCAAATCAAGGTAATTAG
CATATTTATGTCTCAAATATTTATCATTGTGTTGTGAACATTCACAATCCTTTTAGTTTT
TTGAAAATATACAAAAATTATTAATCTCTCTACCCTATAGTGCTATAGAACACTAGAACT
TATTCTGCCTATCTAGCTGTAATTTTGAATCTGTTAACCAACCTCTCCTCCTCTCTGTAC
CCTTCCCAGCCTCTAATAACCACAATTCTGAGTATACTAATTTTATTTCACCTTTTTTGA
ATTAATTTTCATGTCAAACTGTACAGCACTCTGATTAATGAACTCCCTCCTCATATCTGG
ACAGTTTTAGCTATCATAAATAATGTTAAAGTAAACATTCTCCAATACAGATTTCTTTTC
TCTTTTTTTTTTTGAAACAGGGTCTCACTTTGTCGCCCAGGCTGGAGTGCAGTGGTGAGA
TCTTGGCTCACTGCAACCTTGACCTCCCAGGCTCAAGCAATCCTCGCACCTCAGCCTCTC
AAAGTAGTTAGGATTACAGGCACATGCCACCACTCCTGCCTTATATATATATATACATAT
ATATAGCTGAGGTCTTACTATGTTGCCCAGGCTGGACTTGAACTCCTGGGCTCAAGTGAT
CCTCCTGCCTTGGCCTCCCAAAGTGTTGGGATAACAGGCGTGAGCCACCATGCCCGGCCT
CTTACAATTATTTCCTCAGGATGGAGTGCCTGATAGAGGTCAAAGAATATCAATACTTTA
TGGCTTAGGATGAGGTCCTGCCAATTCCTCTGAAGAGTCCCACTTCACACTAGCAACGTG
TGAATGGATATACTTACCTTAAAGAGACTATAGACCATTTCTTTAAATTTCTGTACAGTA
GTTCCTCTAGTTGGCTTATCAAATAGCACTATTTCTTTTCTTGGTTCCAATTCAGTTCCA
AAATCAAGATGAAGCGCTTGTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved