Macaca_mulatta Locus Mono:171:SNORD18
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:171:SNORD18
Macaca_mulatta
Mono:171:SNORD18
13
SNORD18
1001..1070
2070
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATGAGGCTGCTCAGTGGTGTGCAATGTTATAAAATGAAAAG
TACATGCATCTTTCCCTTCCTGGTCCCTCCCCCCAAACGATAATCACTATTATCAGGTGC
TTAATGCATCCTTTTAAGAATAGCAACAACATACACTATGCTTAGACTTAATGTTATGCT
AACACATGTGAATGCACTTATAATTTTTAATTTTCACTTGGCATGTTTACCTTTACATTG
TGTTTTTATACATTTTATTTTATATTTACATGTTTTAAATGTGTGTATGATGAGATTTCA
CTTCCTGGTCTGTGTTTCTGAAACACATGGTTTTGTGGAAGCTCTGATTTGTGTTGGGGG
GAAATTATACAATTTGGTCCATATTGTGTGCATTTTACAGTATTGTGAATCTTGCCCTGA
AAATATTTTTAGGGGTTTTTCCATATTAAGATATACGAAGCTACTTGATGACTGTTTAGT
ATTCCTGATTAAACATTTAGGCTGCTTCCAAGCTTGTTTTCCTTTTTTGTTTTTTTTTCT
TCACTCTAGCAAGTATTCATAGCAATGAAATTTGTAGATCAAAATATGAGCAATTTGTGT
TTTAGCAGACATTGGCAAATTACAATCCATAATAGTAGCAACAACCTGCACTCCCATAAT
TTGTGAGAGTATCTGTTCTCCACCCCATCAGCCAGTCACTAGCAGCACTTCCCATGAGCT
AGTGTTTTAATGTTTACCTTCCTAAGAAAAAAACATGGTAATTCATAATTTTTATTTGCA
TCTCCTTAACTAAGAGATGTATTGAACACCTTTTAAATGTACTTGTTCATATTCTTTATT
GGCTTTTCTATTAATTTATAAATGTCTTATTGGTGGGCTTTTTAAAGATGAAGAAAATTA
GCCTTTCATTTGTCATATTTGTTGCAGATCCGTTCCCCAGATTTGTTTGTTTTCCTTTGA
GCTCTTCTGTGCCAAACAGAAATGCAAAATTTGTATATAGTTATATGTATATATCTTTTC
TTTTATAGCTTCTGGGTTTTCTATGCTGCCTAGACTTTCCCTTCTCCAAGTTTAAAAATA
AATACACTCAAACTTTTAGACAGGCTCTCTTTGATCGGTTTATACAAGGGTAAGCCAGTG
GTACTACCTTGAATGGGATAAGATATAAGATCATGAATGGGAATATTAAGGCCAGCTATT
AAAATGGAAGGGAATAGGCCGGGCATGATGGCTCACACCTGTAATCCCAGCACTTTGGGA
GGCCAAGGTGGGTGGATCACGAGGTCAGGAGATCAAGACCATCCTGGCTAACACGGTGAA
ACCCTGTCTCTACCGAAAATACAAAAAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved