Loxodonta_africana Locus CCAR1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana CCAR1
Loxodonta_africana
CCAR1
GeneScaffold_6353
SNORD98
60055..60119
78545
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCTTCCGTAAGGTTTACA
GCCTGGGAAGCCCTGTCGTGCCGTTCTGTCCTACACGGTCCTGTCCTATACATCTCTCCC
CTGTGTGGTCGCTGTAGGTCCGAATAGACTCCTTGGCAGTGGGTTTGGGTTTTTTGGGGG
GGCGGGGAGAGGTCTTCGCCGTGATTATCTTCAACTACCTTTCCTGTTCCCTGGTTCCTT
CCTTGCTCTAACCCAGACCCAGTGCCGTCGAGTCAATTCCTGGGTAAAATGTTCGTTATT
TAAATGATATTCTTAAATACCTTTATTCGGAATCTCGTGGCTCCAGTTTCCGTTATTGGT
GTGACTGCGACTCTGGCCCTAATCCCCAACCCACTGCCAAAAGAAACACGCAGGCTCTGT
ATCCTTTTATCGTAAAGTTGTGAACTTGTTAAGAATCGGGGTGGCTAGGTCTTCCGTTTA
AACGTGACAGCTTGTAGTCGCAGACCGAAGTGCTTTTCTTGTAAGTCAACTCCTAATGTC
ATCTTTTAAAATTGGTACCTTTGGTGAACTGTAAAGAGTCCCGGTTGCGCAGTGGTTAAG
TTCTCGGTTGCTGACCTAACCAAAAAGTGGTTCGGAGCCCCGGAAGAAAGATGTGGCAGT
CTGCTCCGGTAAACATTAGAGCCTTGGAAACCTTGTGGGGCAGTTCTGCTCTGTCTGTAG
GGTTGCTGAGACGGAATCGCCTCGATGGCAATGGTTTTGTTTTGTTTTTTTTTTAATGGA
CTATCTGATGTGAAACGTTTTTGCTGCATTTCAGTTGTCCCTTTGCTCCTTTTCTACTTG
CAGTTATTTATTCTTAGACCTACAAAGATGTCCTTGACAAATGTTTCTTTAAAACAGCCT
TTTGTGATATTTGTGGTTTGACGACTTTAAAATGTGGATCCTTTCTTAATAGATCGCTGC
TATAGAAGAAAAACAAGAGGTTTTTTTTTCCCCCTTGGATCATGGCTCAGTTTCTGGAGG
ACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACCGCGGTGTCACAGCCAGGTCA
GGCTCCTGAACGCATGTACTGTAAACGTGTGGAGGACGTGTTATGTGATTTAGCCTGTGC
ATAATATTGTAAAATGCTCATTAATTATGTATCTTTTCTTTAAGTTTCTCTGTAAAGCTC
TTTTTAAAAAGATGATCAGCGAGCAAAAAAATGTGTTTTAGTCAACAATTTAGCCAGTTT
TTGTTTTTAAATACCTTAAATTGATTAATTTTTAATTGACTTTAATTATCTTAGAAGTTA
ACAGCCATTCATTCATCAAATATAGACTATACCCTGTTTGGCATGTTAACTCTGTGTATT
CATAAGTTATGTTTAAAAGTAAATGTATTTGAAAGCCATACTTTACTAACAGTGGTTTTC
AGTTGTCTTTTTAAAGTAGAAAAATGAACTCTAAGGAAGGAAATTATCACTAAAATTGTC
GTAAAAGGAGCAAATGAACATTTAAATTTTCAAAACACAAAGTAAACAAAAACTTTTTAT
TGTTTAGGGCTCATCTGTTTGTTTTTGTAAATTTCTTCCTTTTGGTCCTAGGAAGAATTC
TTACCGGTTTTTTACTTTATTGATTGAATCTTAAAGTCTTTAGCTTCTCTCTTATAGCAC
TGCATTTTTTACTTGAATATAATGCACATAGCATTTAGGAATTTCAAATGAGTTTCCAAG
GACCCTACTGAATGATATTTTGAGTTTCTTTCAGTATCCAGAAAAATTGCAGCTTATTCT
GTTAACTTGAATACTTATAAAAAAAAATTATGGTACATCTAATAGTCTTTGCTGCATTTT
ACCTACTTAAAATATCTATTATGTAACTGGAGGTCAGTTGCAGAGAGACTGCAATCTTCT
AACTTAGTGTTCTAAAATTTGGTGGAAATGATTATCTAATTATCTAGGTGACCTTTCTCA
TTCCTTTTACCATAAAAATCCTTGAGTAAGTTCTAAATGAAACTCAACTCTAGATGGACA
TTGTTTTGATTAAAGGAAATGGTTACTTTAGGGACTCTATTTGGGGGATTAAATGGTCAG
CGGTTATTTTGCAGACACCTGAAAATAATGGGAAAAAATTATATTTATTCAGATCCAAAT
ATTTCTCTGCTGTGTTAAAAGTACAGACGGTGGGTTCAGACATAGCAATAATTGTGAGGC
TGGCACAGGACTGTTGTACATAGAGTCACTGTGAGTCGGAATTGACAGCGCCTAACAACA
GTGTTAAAGGAGAAACTGGTACTGACTTAGTTTTAATGAAACAGGAATTATTAGCAACTA
ATATCCAGAAGCTGGTGCTGTGTACCGGCACTTTGATAAACTAAACATGTTCTAGCAGAT
TTTCTCTGCATATAATTTGTTTTAGATTCGTAATATCTATATTGTGTCAATAAAATAGCT
GTTATGGTGATATTCTAGTGTCCATAGTTCTTACCACTTATGTTTGCATGTGTGTTATAC
TCCTGTATTTTCATTGTAAAACTGAGAAAAGGAGGCCAGAGTTTTATGGAACTTGTCAAA
GGCAAAGTCAGTAGTGAATATAGGTATTCTCTTTCCATATTTGGCTCTCCATATTTGGCA
ATAGAGATTTCAAATGTAAATAGTGGGATTTGTGTAAACAGAGCTTATATTTGTGCTGTA
TGAAATTATTTATGGGCTTTGTTGGACTTCTCAGTCAGAATTTTTCAGAATCAAAAGTTT
GCTGACTTATTGTGACTTCAGAAAATAGGCAGTGTTTTGTGTCTAAGCTTAGCTTTTACC
ATAAAAATCCTTGAGTAAGTTCTAAATGAAACTCAATTCTAGATGGACATTGTTTTGATA
AAAAATATAATTTTGGGGTGCTACATTTTTTAGCACCCCAGATGATGAATGAGTTCCGTT
CCTAAGCTTGTCTTTAAGTTGAATTTGTACTTAAATTAGAACGGTTATATACAGTTCATA
TCTAACACCAGTTAATCAGATGTTTATGTTAGTGTATAGCGTACCTTTGAATGCATAAAA
AATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATTTTTTATATAG
AAGGCTTTATGGGGCTTGGTTGGTCACTGCAAGTTGGACATCCGTAACCTGGGACTGCCT
GTACTTCTTGAAAGCTAAATGTTTCCTTACCTTTCTTTTAAAGTGCTCTTTGTAACTAAT
TCTTTACTCATTAGAGTTTCTCAGAGCCAAGCAAATTTCTTTCAAAGTTCAATCTTTTTC
ATTTCCGTGGCAAAGTATGTCTTGTTTACACCTAATTTTAATGGAGAACATTTTAACTTG
TGCTTGACTCCTGAAGTTTTCTCCAGGCAGCTTCAAATACAATTTGAGGAAAATTTCTGC
AAAGAACATTAAAGGACTTTAGGGTAATTGTGTATGTGTCAATTATAGTCTATTTTCTAA
AAATGCAACTGTTAAAATATGCTAGATATGTTAGTGTCAGAGGCCACTGTCAGATCCAAT
AGTCACACAACAGAAAAGGGTTAACCAAATTACTCAACTCAAATAAAATATATTAATTTT
TGTACCTGTACTTCTGACTCAGTTTCTCCTGAGAGCAATATAAAAACTCCCGTTCAGTTT
CCTCTATGTACATGACATAGCATGGTTTTGTTCAGGCAATGGCTTTGTTATTCAATTTTC
TTAGATTATTTTGTATTTGTACTAACTTTTTAAAGAATTCTTGGAAATTTGAAATTTTCA
TTGTGTTCGCACAGATGAAATTTTAGTGTTTTCACACAGATCACACATTTAAAATAATGT
TCAAAACTTCAGTGAAAGCATGAAGACTAGCAGTTATTGCTGAAATCTGTTATAAAATTG
AAGGTTTTTGAATTATTTCTTATTAATTTTAATATTGAGCCTGTTCAAGTAAGGAGAGTT
TGTAATTCCTAGGTATCACGTCTTTCATTTGTAATTTTATTTTAACCGTCATATTTGATC
GAATGTTAAACTTTGACCTTTTTCCCGTTTGAACGTGTCTCAGATTTACCCCTTCTTCAT
TTCACATTTAGGCCTTATGCTTGTCATATTTGAATAACTGCATTTAGCAACAGCTTTCTC
TTGCTCCCATGCCAAAGTTTCTCACCTGTCAGGCCCTTCTGTTCCTTTCCCAGGTCTTGT
TATATGTTATATATCTTGTTACATGGTATTTATCAACACAGATCCCTCACTTCAGTGAGG
AAGCTCTTTTCCTCATCTTTCACTTGGTGGAGATGCTTATCTTTTTTGTCCTTTATTTCG
TTCTGACTGCTTGCTTCTATTTGCTTTTCTCTCTTGCCAACTGGGTATGCTGCAGCTTAT
TTCTCCTGAGCTCCAATGCACCTGTCAGATGTGATCTTCCTAAAGCATAGTTCCTATTGA
AATTACAGCATTTTTCAAAGCTGGATGGAACCTGAGCTAGAGTCTGTCCCAACTCTTTTC
TCTAAGAGATAAAGAAATTGAGGCCCAGAAAGGTACAGAAATTTGTTTTAAGATCTCTCA
GCAAGTCATAGCAGAGTCAGTTTTGGGACTCCAGAATTGCGGTTCATTACGTCTTCCATT
ATTCCCTCTTATTCATCTGCAGAAATATCTTCCAGGAGTTCTAGAATATAGTTCAGACTT
CTTAAGGGTAATATTCAAGGGCTTCTTTTTTTCTACTTTTCCAACCCTGTTTCTCCTACA
CGGTGATGTATTTGTTCTTTTCTTACTGTTCAGCCTGTTTTTCATCTCCTAGGTGAAATG
CCAGTGACAGTCATACTAGAAAAATACTAGGGACCAGAGCTTTTAGATGTGAAAATTTAA
TAGTTTTCTATTGTATAAAGAGACTGTGGGGGAGGGGCAATGAGAGAGGTGTTTGACAAA
TCACTGGCTGAATCTTAAAATGGTCTTTAGCTCAATTACATTGACTAGGGGTATCTTGTT
TTACACTACCTTTTTTGTCAATAATACTACTTTTTAAATTTCATGCTTACGGAATATTTT
ACTTATCATATATATCTTGCATGTATCTCTTCAAAATACGCAAGTATTTTGTTATTATTG
TTAGTTGCCGCTGAGTTGATTCCGACTCATTGCAACCTCATGTGTGCAGAGTAGAACTGC
TGCATAGGGTTTACAAGGCTGTGACCTTTCCCGGAAGCAGATTGCCAGGCCTGTCTTCTG
AGACGACTCTAGGTGGGTTAGAACCACCAACCTTTCAGCTTAATAGTCAAGCACTTAACC
ATTTGCGCCACCCAGGGAGTCTAGGTGCTTGCTTATTAGTCATGCTGTATGCTAGGTGAA
CTTAAAATTATTAGAACCTTGAATATGAAAAAATTTTGGTATGATATAGAATTTCGTTAC
CACCATGTATCTATCAGTTTGTTGTACTTCGGTGGCTTTCATGTTGCTGTGATACTGGAA
GCTCATGTTTCTCATGCTTTTGTAAAAGAAGCAGCCAGATATGTTACTTGACTAAAATAA
AAATATTTACGTGTATATGTATATAATTGCAAAAATATGAAAATGTGGGAATGTATTTAA
CAGATCAGACCTCTTCTCAACCATTTCTTTTGACCATTTTTAAGGTGACTATATTGTAGC
TATAGAGAAAAAATGAACTAATTCAGGAACACAGGTGATTGAAGCCGATATCAATACCCG
TGTTTTAAATGTGAGTCTGCTTTTCCTGCCTCCTCGTTCTGGCCTGGTCGGCCTTTAAAT
CCCCATCACTTGAATTAGCTGCTCAGATTTGAAGATTCCCGGTCTTTTCCATACACAGAA
TGGCTGACCTGTATATGCTTCACTTACACTAGTTATCCCTTGATAGAGTTGCGTGTTTCC
AACCCATAATTTGGTAGAAGAGGAAGATTGCTGCTGGTATGGGACTTGTTTAAACACTGC
TTCTGCTGTATTATAGCAAATCGTCTCTGAAACTTTTTCTAAGAGTAAAAAGTGCACATA
AAATCTACTAAGGTTTGTTGTTAATACATATTTTTTCCTCATCCTCTAAGCCTGCCTGGC
TTGTGGTCTCATCTAGTGAGAGCTGATATGGCAGACTGTCCTGTTTACTTTTGACCGGTG
GGTATTAGCATAAAACCAAAACCAAACCCGTTGCCATCCAGCCTATTCCAACTCATAGCC
ACCCTAGAGGACAGAGTAGAACTGCCTCCATAGGGTTTCCAAGGCTGTAAATCTTCACTG
AAGTAGGTTGCCATGTTTTTCTCCCCCGGATTAGCTGGTGGGTTTGAACTGCCGACCTTT
TGGTTAGCAACCAGGGCCTAACCACTGTACTACCAAGACTCTGTCTGTAAAGATTATAGC
CTTGGAAACCCTGTGGGGGAGTTCTGCTCTGTCCTGTAGGATCCCTGTGAGTTGGAATCA
ACTCGACAGCAACAGGTTTAGTTTGGATTTTTCCTAAAAAATACTTTGTAGGTTTGGTTG
GGTTTATTCTGAAGTATAATTTTATAGAGCACTCATGATATGAATTATTTGATATAAAAC
CTATGACATCTGGGGTGGGACGTGCATCCATTAAATTCAATAAGCATTACTAAAATTGTT
CTTTAAGTTTTTTTTTTTTTTTTTTTTACTAACCAGTGGCAAACCTTGATACACAACTAA
GCACCCATGGAAAATTCCTAGAAGGGACTCATTTTAATTTTTTTTTATTTTTTATTTTAA
TCTCATTTTAGCTGCATTGGGTGTTCAGCAGCCCTCACTCCTTGGAGCATCTCCTACCAT
TTATACACAGCAAACTGCGTTGGCAGCAGCAGGCCTTACCACACAAACTCCAGCCAACTA
CCAACTAACTCAGACTGCGGCGTTGCAGCAACAAGCCGCGGCCGCAGCAGCTGCATTGCA
ACAGGTGAATCTTCAAGAGGTTGTAAAGTGACAGAGAAAACTGTAGAAAATCTGCATAGC
TAGGCTCACTACTATCACTTTTTAATGAATGAAGGAAGAATTTTAGGCCTTTATTATGCT
TTTGTTTTTTTTTTCTTCCTGATCATAAAAATTATGTATACCTAACACATGCAGACAAGC
ATAGTTACATAGTCAGAATTCTTCAGCTTTTAAATGGAGCAGTTTTTATACCTTAATTAG
TTGAACAAAATTCAGTTTTTGGTGGGTCCCAGAATATAAGTAATCACCATTTTGTTTATT
TTAGATGGCATTTAATCGTTCCAGGACATTTCTTTTGAGTGTAATCTTGGCTATATTTGT
ATGTAAGTGGTTTACTTTTTGAGAATGACTAAAACTAATATCCAATTTTTCTTTGAAAAA
TCTGTTGGTATTTTTTTTTCCCAGCAATATTCACAACCTCAACAGGCCTTGTATAGTGTG
CAACAGCAGGTTAGTTTATATTTTCCATCTTAAAAAGTTATTTTAAAGCAGCCATTTGTT
TCAAAATTCATTTGATATAGTGTTTAATTCCTGTCAGCTACCTTCATGTGTGATTTGAAT
TCTTTGGGGGTGGGGGAAATGAGGTATGTAAAAAGGAATGTCTCCAAGGCAGAAAGAGAT
AGGAGGGGGTTCTCAAAAACCCAAGTCCTCGACTACCGGCCAGTCTTTGTCACGTGTGTT
TTAAGGACATATGCATAGGATAGTATGGAAAGAATCCCTCTATTACTGTTTGGCCCTGTA
CTCCTGTCTGGAACCGCTAGCCCTACTTTGCTGAATTAGACCACATGTGAAAATGAAAAG
CTGCCTTTTTCCATCTGAAGCCTAGAAGATTGGACTTCAGCCTTTTTTTTTTTTTTAAAG
CAGTGGACTCTCCTTTTTTTTCCCAAAATGAAATTGTGTGTGGAAATCTTATGTACAGAA
TATAAAAATAGAGCTGTTGAAAATAGGGGAGCGCCCTCCCCTACAGTTCCATCCCTACTC
CCAAGGCACATATGAACAATTCGAAGAACTGTGACTTAGATTAAAAGTAAGTTTCTTCGA
TGTCCTTTCTCTGGGCTCCACCTCTAATCACGTTCCTTAAGGTTTTACATTTATGATAGG
GTGAGGTAGGAAAAACTGAACCCAAGGAGAAGGTATGTCAAGGGAAAGAGAGTTTGCCCT
GAAAATAGTACGCTCAAGCCTAAGGTAGATAAGCTCTAGCCTAAGTACCCGTTCTAGGCT
TTTCCAGGGCTAGGAGATAGTTTTCAGTCCTTCTCAGTACCTGAGCCATTCAGAAGTTTC
AGGAAAGTATAATAGCCAGAAGTAAAGGGATGCAAGAGAAAGGGACCAAAAGCTAGATCC
AAAGACACTGAAGAAGCATGAGGTACCTCAGTTCATAAGCTGTTGTCCCAGAACATAGCC
CAATTTCGTTCTTAAGCCATTTGAGGCTTGAGAAACATTACATTTTCCCTGCGGATTACA
GTGTTCCACTAATAATTTTTATCAACCTCTGAAAAACTGACGAGATTGATTTCAAAACAG
CTATCTTGTTTTCAGAGTACCCTCAGACTTATTTTAGTGCTGTTATAAAATATTAAATAT
TATGATTTATTAGGTTGAACTGTGTAAAAATGGCAATAATCAACTGTTCACTTAATAGAA
AATTGTAATTTAGTGTTATTTAACCTGTAACACGTGGGCCTAGGTAAACTGAGTGTATTA
AATCAGAACCTCATGTAGGTTTTTTTCCTAACTTAAGTCATTTCTAGTTCAGTGTTTTAA
CTTCCCCATTCCCAGAAATTCCTTTTTGCTTTCTGGTAATGTTACACTTTGCTATTGCCA
AGGAAACCCTATGTCAGATTGTTTGGTCTTTCATGGTTCCTATGCCTCTAGTAAATCTGA
CCATCAAAAGTGCTTCTCATTTTAGGGACATATGAATTGAATGGCTACTGGTATTTTTTG
ATGTTACTGAATGATAATACTGAATCATTTTTGTACATGAAAATTAACATGTTGTCAAAC
TAGAAATCTTCCCCTCTAGGGACCTGTGGGATTGTTTTGGTGGATGTTTTCACTATGAAA
TAGCAACAAAACAAAAAAAGATCTTTTAATTGGAATCTGCTAAGTGCGACTCTTATATAT
GGGGTCCACAGATGTTAGAAAAAGGAAACCTTATACATTTAATGACTTCTTTTACTTTTT
ACATTGTTCTTGATTAGAAATATTTAATAGAAATGTTTTCCTTTTATTAAGCATCTTTGA
AACAATTCTAATTTTCTTTCTTTTCTCTGTTTCCAGTACAGCAACCCCAGCAGACCCTAT
TAACACAGGTTAGTTTGGCATTACTTTATTTCTTTTGGATACCTGAATAAAGAGTGGACC
AAAGTTGTGTCCCTATTCTAGTTTTTCTGTCAGGGTTTAAAGATGAATATTTGTTGAATT
CACATAATAGTTTAGCAATATAATGTTAAATAAAGATTTAAAAGTGTGTGGTTTTGTGCG
TTTTCTTTTGTGCTTTTTGATTGTCCAGCTGTGATCCAGTTTTAATGAATAAGTCCTGTT
TTAGACAATACTTATTTTGAGTTTTATGTTTCCTTTGTAGCTAACACTTGCGAGAATTTT
TTTGTACATGTTGCTTCTTTAGCTTTAGTAGGTAGAAGTTATTGTATTACCCTATCAGCT
TAGTTTTTTTTAGCAACGTTTAATAAAAGATTTTGAACTTCTAATGTGATGCTATTTTTC
TATAAAATGCCTACATTCTCAAGAAGAGAAGACTTCAGATCTGAGATTTATTTAAAGTTC
ACTAGTTAGATAAAGCAATTTAGCCATATCTAAAATAATTTTAAATGCACCTGTTTGAAA
TATTTAAGCAAGCAACTTCACTTCTGAGAATTGGTCCCAAAAATGCACTCACATATATAC
AAAATGACCTGTGAGCTGGGATATTCGTTGCAAAAAATTAGAAACAACCTAAAAGTCCTA
AATAGGGGACCAGTTAAATATATTATGGTAAGAATTGGTAAACTGTCTCTATGTAAGAAC
TTCTTATAGTCTGTTGCATGTTTTATTTATATATATATACACACACACATATGTGTGTAA
ATATATATTCCTTTTAAAAGTATAAAAACCGTTCTTAGATAATAGGCCGTAATAAAGCAG
GCCATGGACTGACTTGGCCTATGGCATAGAGAGAAATACTGTACAGCTGTTAAAAAGGGA
AGAAGAATCTCTTTACTTACTGATAGGAAGTGATATCCCAGATATGTGAAGTGGAAAGTA
GTATAATGCACTATGTGTTATATGCTTCCATTTATATAAGGGGGAGGGAGACATCAGTTC
TGTATCTACCTATCTATACGCTTATATTTGCATAAAACATCTTTAAGAGGATCTGAAATA
ATAACTAGTGACAGTGATTGCCTCGTGGATAGGGACCTGGATAGCTGAGGATAAGAGGTA
GGAGAAAAGCTTTTATATCTCTTAGTCTTGGATCTGTTGCTTGTTTATTTATAAATAAGT
TTTAATTGAGAAATTAGCACCACTTTGTTTTTATTAAAGAACTGAAATTGACCCACATCT
ATCATATTTTCGATCCCCAATATTGGGATTTGCAAATTGAATAGAAAAGCTGTAAAAGTT
TGTCACTTGTTAAAATAGATTTCCCAAAATTTGCCCTGAAGACCATTAGTGTCTTGAATG
TTGCAGAGATTTCATGAGAAAATAATTGTGTGGTCAAAGTTGAAGGAATGCTGAGTTTTC
TTTATTATATATGACTTTCTTGAGTATAATGCCAGTGTGGATTGCGAATTTTGAAGAGGA
AGCTAAAATACGAGCTGTTTTTTAAAACTCATTGGACCGTGGGGCCTTTTTTCCCGGCTT
AACCTGTGGGAACACTTATCTAAGTGACCAAATTAAAGAAATAGATCCAATGTAACTTAC
AGTTTTTGAGACTTGATTCTTACCTTTAAACTGTACATGTCATTTTTTAACTTCAAATAC
ATTTTTAACATTTTGGGTTAGTTTTAGGTAGTCATTTAAAATTTTTAGATAGTTTCAAAT
CATTTCCATAGTTTGATGTTGATTATGGTTTTGGGTTTTTTGCTCAATGGTTTTTGATTT
TTGGGTTTATTTTTCCCCTCAACAATTTTTACATGTATAATTCAGTGACAGTGATTTCAT
TCTCCTAGTTGTTAAACTGTCCTTGCTATGATTATGTTTTATAGCCAGCTGTTGCATTGC
CTACAAGCCTTAGCCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATACCCAA
CACCACGGTCAAGTCAGCAACAAACCCAACCTCAGAAACAACGTGTTTTCACAGGAGTGG
TTACAAAGCTACATGATACATTTGGATTTGTGGATGAGGATGTATTCTTTCAGCTTAGGT
AAACTTCATTAGGTGTTGGCCTTCTTGTATTTAGCATTAAGTATATTGATAAAGCACCTG
CTTAATAGTGGCATGGGATTGTGTTTTAGCTATAATTTATCTCTTTTATAATCATTCAGC
TTTTATTGTATTTCTACCCATGACCTGTTTTTGTTTGTTTTTTATTTGTCATTGGTTTGC
CTTTTTTTTTCCTTGTAAGCTTTTTGATGGAGAACGTGATAAGAGATAGCTTTTGGTAAC
TGAACAAACTAGTTATAGTGAAAAGAGTCCTGGTGACGTAAATGAGTTAAACACTTGGCT
GCTAACTGAAAGAGTTGAGCGTTTTGAACCTATCCAGCTACTCCACAGGAGAAAAACCTG
ATGACTTGCTTCTGCCAAGATTACAGCCAAGTAAACCCTATGGAGAAGCTCTACTCTGTC
ATATGGAGTCACTACGAGTCAAAAATGACTCAGCAGCACCCAACATTTATGGTGAATTCC
TTTTTTTTATTGTGCTTTAGTGAAAGTTTACAAATCAAGTCAGTCTCTCATACAAAAACT
TACATACACGTTGCTATGTACTCTTAGTTGCTTTCCCCCCAAAGTGACAGCACACTCCTC
CTCTCTACCCTGTATTCCCCGTGTCCATTCACCCAGCTTCTGTCCCACTCTGCCTTCTCA
TCTCGCCTCCAGACAAGACCTGCTATGGTGAATTCTTTATAAATGTTTTGTAACAGTTAG
GTGACGTTTATCATCTAATAATATTCATGGTTAGACTTACGTTAAGATTAGGGCATAAAG
TCATATGTGTCCTTTTAAATTTAATCTTTTATGTGACATATAATCAGTAACATTGTTCTT
ATAGTGAAAAATTAATAAATGAGAATTAAATGTTTGATGAACTAACATGTTCACAGTAGC
ACTTCAGTAATTTTGTGGTAGTTGCAGGAAATAAGAATTTTCTTAGACTTTTCAAATATA
TTTCTAATGAACTTCTTATATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAATAGGTTTCAGAATGGGAG
AAAATTGTAGAGCAAAACTGAAATTTATTTTAAAAAAGACCAAACTTACTGGACTGGAAG
AACCCTCTGAGAATATCACCCTTTTACCCTGGAACTGAAGCCACTCCACTCCTGGAGGTC
ACCGTTCAGTCAATAATAGACTGGTATATAAACAATAACACCTGTGAGGAATAGGCTCCT
TTGAACAATTGACTATATGAGAACAAATGGGCAACTTCTGTCCAAAAGCAAAGATGAGAA
GGCAGGGGGCGGCAGCAGGGAAACTGGAGGGAGGGAAACGGGGAAGGCAGGATGGAAATG
GGGAGTGCTGACACAGTGCAGGGATATGTGTATAAATTGTTGAATGGGAAACTAATGTGG
TATATAAACTTTCACCAAAAACAAAATGTCCAGAAAAAATAGTAATAAAAGGCAATCAAT
TAGAAAAAAAGCAAAAAAGTTGGTTGACTCTTGAGTGAAAAGGGTAGGTGATTAGGTTTT
TGTGTTTAAATAATCTTTTCTGGAATGTTCCATTGTCATAATATGCTGTATTTTTATTTA
AGGTTTATTTCATTCTGTTTTACTTAATTTTGCTAGAATAATAGCTAGATTTTCCAAATA
AGTGAATATGGGAATGTAAGTGCTCGTGTTACACATGACTTAATAATCTAAGTGGAATCC
ACATGGCTCTTAACTGAGAAATGGATTGAAATAGCTGACATTGTTTCAAACTAATTTTTG
TTTTAAGTTGCTGTTCCTTGTCATAAGGCTTGTTGAACCTCTACGAAGTCAGAATACTGA
CGGTCCTTTATTATACTGTTATTGTATAAATGCTTCTCCATCTTTAAGGTGAGAAAAAGC
ATTATAGGGTACTTGGGAAAGTGTTTTTCTCAAGGAAAAATCTGAAGATAAACTTTTAAT
TAGAAGAAAGTAATGATAAAAAGATTTTTGCTAGAGTATGGTTTTAAATGAGAAAGGTGA
TTGATTATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAACTCTGAGTGACTTGGGCTTTTTCTGTAAGGGTTAATAT
TTCTACATTGGGTAAGCCATAGTAGATACAGAAATATTTATTAATGAACACAAGTTACTT
TGAAATAGTTGCTTAATGGGAAGGGTTGCAACTACTTAAGCAACTGAATTAAATAAGCTA
GGAAGAACTGTATCTTTTGTTTATAGGTTTGTTTTTTTTTTTTCACTCCTCACCCTCAAA
CTAATATGACTATATAATTCCTTTTTGAGGTTTCATATTGTGAACATAATCTAACTAATA
TGGAGTCTTGTGCATTTGGTCAGTGTGTTCCTCATCATCTGTTGGGTGGGTGACAATCAG
AATGCTCAGACTTTAGTTTATGAAGGTAGTGTTTGGTTGGGAGAATTGGTAGGTGATGAG
GGAGCTTATCAGCTGCCTGGGGCTAAAACCCCTGAGTAGGTTGCTGAGCTGAAGAAGGAG
AAAGGGTGGAGATGGCCAGCAGGGGGAGAGGTAAGCAATGGGCAGCAAGGCCTTACTGAC
AATGGAGAGGTTAAGAAAATAGGTAAGGATTGGGCAGATGTCAGAGGCAATTAAGGGAGG
GTCTCTTAAGAAATGAGCATTGTGAGCAAGGCTTTCAATTCCAGCTTCTCTGGGCACCCC
TAGGCAAGGATTAGTCATCTGCCTGAGTCTTTAGGGGACCTAGGCTTCAAGGCAGTGACT
TCTGTGGTAACTGAAAAGGTTGTGCTCTCTCCTTGAGGCAAAAGGTGGAGGAAGTTTCCA
AGACCAGTTAGACCCTCATATAGCAATTGCTTTGAATGGGCAGGTGAGAGAAATCAAGGT
GAGCTGATTTAGGTGTGTTCTGATACTCCATTCAATAATCTGCCTTTTGTGGTTCCAGCG
AGATAGAATCTACTCAGGTCCTTAAGTCTTGCGAGGGGAGAGGAAGGGGTAGATATTATA
CATATTAATTCTAGCTTGAGAGCTCTGCCATTGTAATTTAAAATAAAAAGGAATTCTCAA
GATTCTTTTTTTTTAAATTAAACATAGCTTCCAACCTAAACTCAAATTTATCATTAGATT
TTTACCTTCTTTGAGAATATGCAGGATGAGATAGATTTCATGAAATTGGTATGATCTTTG
TAATCTGTTATCAGTTAGCTTAATATCATGATGAAACCAAAAGTTTCCGTATATTATAGT
TTCTCAGTAAAAAATTATGCCAAAGCTGCCTCAGCCACTTCATATATACGTTTAAACTGG
TTGCCATCAAGTCGATTCCAACTTCTGGTGACCCCATGTGTGTCAGAGTAAAACTTCTTT
TGTAAAGCTCCTTAGGATTTTCAGTGGCTAATTTTTCAGAGGTAGACCACCAGGGCCTTT
TATCTGAGGGACCTCTAGGTGGACTCAAACCTTCAGCCTTTCAGTTGGCATATTAACCAT
TTGCAACACCCAGGGACTCCATAAATAACCTTTATTATGTACTAAAGAGAGGGAACCTTA
TTTTCTCCATAGGCACTCTTGGAGGTGATTCTGAGATGTAACTTCTGTAACTTAGAAGTG
CTGTGCAGGCCTACCGTTGAGGCATATTTGAGTTTCAAGGGATGAGAATTGGGGAACTAG
AGTATATTAGTAATCAACAGAACTGATGATGTGGGCGTCTTCCTAACTGCTGCTCCCTGA
GACCCTGCCTGGGAATGGCTAATAGTCCAGATCTTGTGTTCAGGCTGATTTTGCTATCCA
AAGGTCTGATCTGATGGTTGGAGAAAGTAAAATGGGGTTAGGAAATGATGGTCCTCCAGG
AAGTAAAAATATTACTGAAAACTCAGCAGTTTGTAATCTTAGTTTCAGGGAAATTTATCA
GTTTGATTTAGTCCTCAGCCAGTGGCAGAGCCATGGGGACAGAGTCCAACCCTTAAAGCA
AAGATTTTAGACTCTCAGGGCCCCAGCCAAAGAACAGGATTCAAGGGTTGAAACTCAAAT
TGAAAGTAAATAAGATGGATGGAGACCAGGAGCCAGAGTAGAAGCTCATCTATACAGATT
TTGAGTGACTACTAGAGCTTGGTGAAGGTGGTGGCATTTGGGTTCACAACCACATTTAGG
ATGACAAAACTATAAACCTCATCAGTGTGTGTGATGAATTCCTAACATGTCAGGCAGAGT
TTGAATGAGCTCAGAAACCTGGTAAGGCTAAATCTACAGTGTGAAGATCTCTGACACTTG
CAAGTAGGCACAGGGCAGAAATGCAGGTTTAACTGCTAGTGTTTTGCAGACATATATTGA
AATCTAGGCACTTTAATGTTTTTAATAGGTTTTGTTAGTATGAGCCAGCCTAATTTCAAA
ATGAGTAAAATTAAATAGTGTGTGCGAGAGGAGAAACTTTTAGAGCTTAAGAATTATGGA
AATTCCATTTAAACATTCATACTCTCCATGTTCCTGGACTATCCTATGCTTTTTCCCCCT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTCTCAAATTTGGGGGATTAATTTTTTT
TTTTTATTGTGCTCTAAGCAAAAGTTTACAACTCAAGCCAGTCTATCCTATAAAACCTTA
TGTACACCTTGCTATATACTCCTAGTTGCTCTCCCCCAAATGAGACAGCACACTCCTTCT
CTCCACCCTGAGCTTCCATGTCCATTCAGCCGGCTTCTGTCCCCCAGGGCCTTCACGTCT
CCCCTCCAGACAGGAGCAGCCCACATAGTCTCATGTGTCTACTTGAGCCCAGAAGCTCAC
TCCTCACCAGTATAATTTTCTGTCGTATAGTCCAGTCCAATCCCTTTCTGAAGAGTTGAC
TTTTGGAATGGTTACAGTCTTGGGCTAACAGAAGGTCTGGGGAGCATGACCTCTGGAGTT
CTTCTAGTCTCATTCAGACCATTAAGTCTGGTCTTTTTATGAGAATTTGAGGTCTGCATC
CCACTGCTGTCCTGCTCCCTCAGGGGTACTCCGTTGTGTTCCCTGTCAGGGCAGTCATCG
GTTGTAGCCAGGCACCACCTAGTTCTTCTGGTCTCAGGCTGATGTAGTCTCTGGTTTATA
TGGCCCATTATGGCTCTTGGGCTCATAATCACCTTGTGTCTTTGGTGTTCTTCATTCTCC
TTTGCTTCAGGTGGGTTGAGACCCACTGATGCATCTTAGATGGCTGCTTGCTAGCATTTA
AGAACCCAGAGACCACTCTCCAAAATGGGATGCAGGAATGTTTTCTTGATAGATTTTATT
ATGCCAGTTGACCTAGAGTGTCTCTCTTCTGTATAAGCGAGATGGCCCCAAACCCTTTGG
GGGATTAATTTAACTTCAAAATTGAACTTTTTTCCAAACTCTTTTTTACCCCTGTAAATT
AGTGTTTATTTGCATTTTCATGGCCTTTGACCTAAAAGTTCTGAATTAATCAGGTACAAA
TTTTACCCTTGGTTACATATACATGTGGTCCCAACAGTAGTTGATATGTTCGAGCAAATG
AAATTTCATGGAGCTCAGGGAACAACTTTAAATGTGATCTATACCCACTGTCTTTGAGTT
GATTACGACTCATAGCAACCCTATAGGACAGAGAATTGCCCCACAGGGTTTTCAGGCAGT
GGCTGATGGATTCGAATTGCTGACGTTTTGGTTAGCAGCTGAGCTCTTAACTACTGTGCC
ACCAGGGCTCCATGTGATCTGTACACCTAACATACACACACCTATTGCTGTCAAGTCGAT
TCCCACTCAAAGACTCATAGTGACCATATAGGACAGAGTAGAACTCATAGGGTTTCCGAG
GAGTGTCTGGTGGATTCAAACTGCTGACTTTTGGTTAGCAGCTGAGCAATTAACCACTAT
GCCACCAGGGCTCCTTTCACGTCTAAGGAAACTAAATATTAGGAGTTTGCTGAGAGGCAG
GGCCAAGATGGCAGAGTGGTCAGATGCTTCCTGTGGTTCCTCTTAAAGACCTGAAGAAAC
AAGTGAATTGATTATATATGACAATCCAGGAGCCCTGAACATCAAAGGCAAAGTTGAGGA
ATTAGACTGAGCGGCAGGGGGAGGGAGAGACAGTTCAGAGCAGCGAGGAGTTGCAGGACC
TGACCCAGCAGGAACCAGCACCCTGCAGGCTGGGATCAGCCAGAGCCAGCAGTGAGGCAG
GCAGTGGCCTTTGGAACTCCACATCAGGAGAGACCGAGCAGTGGGGAGTCTACTCCTCCA
GAATCAGTGAAAAGCAGCACTCGGTTGACAAAAGATAAGTATATGCATCTAACCTACAGT
GCGGATCAAAAAACTCCCCTTTGGGAAAAACCTCTCTCCCATTTACCTGCCCCCTTCCCA
CTCTGCACTGGGTCCAAACTGGCTTCAGAGATTGCTGCATCCCCTGAGCCGGAAGTAGGA
CCCGTCACGCATCCTGAGCCATTCTCCCAGCCTTGGAGAGGGAACAAATTAACAAACTGA
AAAAATAATATGCCAGCTCTGCTAAGCCGGGAGCTCAGGGCAGAAACAGCTCCTTTGCCT
AGGCACAGGAATAAGGGGTCCACAGACTTTGAATGCCTTTCACCCCTGCATAGACCTGTG
TGGGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAACCAGAGACTACATCAGCCTGAGACCAGAAGAACTAGATGGTGCCTGGCCACA
ACCCAATGACTGCCTGACAGGGAACACAACAGAGAACCCCTGAGGGAGCAGGAGAGCAGT
GGGATAAAAAAAAAAATGCAGACCCCAAATTCTGGTAAAAAGACCAGATTTATTGGTCAG
ACTTGGACTAGAAGGACTCAGGAGGTCATGCTCCCCAGACCTTCTGTTAGCCCAAGACTG
GAACCATTCCCAAAGCCAACTCTTCAGACAGGGATTGGACTGGAATATGGGATGGAAAAT
GATACTAGTGAAGAATAAGCTTCTTGGCTCAAGTAGACACATGAGACTATGTGTGCATCT
CCTGTCTGGAGGGGAGATGAGAGGGCAGAGGGGGCCAGAAGATGCCCAAATGAACACAAT
GAGAGAGAGTGGAGGGAAGGACTGTGCTATCTGATTAGGGGCAGAGCAGTTAGGAGTGTA
TAGCAAGGTATATGTAAATTTTTGTATGAGAGACTGACCTGATTTGTAAACTTTCACTTA
CAGCACAATAAAAATTAATTTTTTTTTAAAAAAGAAATCTTCCAGATGAAGAGAAATTCC
CAGAACTACCAGAGGTAGAGTACAAAAGATTAATATACAGAACTCTTCAAGAGATCAGGC
AAAATGCAGAACAAGCCAAGGAACACACAGACAAAGCAATAGAGGAACTTAAGGAAGTTA
TAGAAGAGCATAATGACAAATTTAACAGGCTGCAAGAATCCATAGAGAGACAGCAAACAG
AAATCCAGAAGATTAACAATAAAATTTCAGAATTAGCCAATTCAATAGAAAGTCATAGGA
GCAGAATTGAGGCAATGGAAATCAGAATTAGTGAAACTGAAGATAAAGTACTTGACACCA
ACATATTTGAGGAAAAATCAGAGACAAGAATTTTAAAAAATGAAGAAACCCTAAGAATTA
TGTGGGACTCTATCAAGAGAAACAACCTACAAGTGATTGGAGTACGAGAATATGGGGGGA
TAAGAGAAAATACGGAGAGAATTGTTGGCAGAAAACTTCCCTGATATCGTGAAAGATGAG
AAGATATCTATCCAAGATGCTCGTTGAACTCTACGCAAGGTAGATCCCAAAAGAAACTCA
CCAAGGCATATTATAATCAAACTTGCCAAAACCAAAGATAAAGAGAGAATTTTAAGAGCA
GCCAGGGATAAATGAAAAGTCACCTACAAAGGACAACCAATAAGAATAAGCTCGGACTAC
TCGGCAGAAACAGTGTAGGCAAGAAGGGAATGGGATGACTTATATAAAAAATTGAAGGAA
AAAAATTGCCAACCAGGTATCATATATCCAGCAAAACTGTCTCTTAAATATGAAGGTGAA
ATTAGGACATTTCCAGATAAACAGAAGTTTAGGGAATTCGTAAAAACCAAACCAAAACTA
CAAGGAATACTAAAGGGAGTTCTTTGGTTAGAAAATCAATCATATCAGGTATCAGCCCAA
GACTAGAACATTGGACAGAGCAATCAGAAGCCAACCCAGACAGGGAAATAAAAAAAAAAA
GCAAGATTAAAAAAAAAAAAAAAAGCTCAAAACAGGGTAACAGCAATGTTATTATATAAA
AGAACACAGCATTAAAACAATAAAGAGGGACTAAGAAATGTAATAATAGATCTTCCATAT
GGAGAGGAAGATATGGCAACACAAAGAAATAAAAGTTAGGCTTAAATTAAGAAAACAGGG
GTAAATAATAAGGTAACCACAAAGGAGACAAACTATTATACTCATCAAAATAAAATACAA
GAAAAAAATAGAGACTCAGTAGAAACAAAATCAACAACAACAAATATGAGGAAAGGACAA
TATATAAAGATAATCTACTCAGCGCATAAAATTAAGTGGGAAAAAGAAACTGTCAACAAC
ACACAAAAAAAGACATAAAAATGATAGCACTAAATTCATACCTATCCATAATTAGGCTGA
ATGTAAAAGGACTAAATGCACCAATAAAGAGACAGAGGGTGGCAGAATGGATTAAAAAAC
ACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAGTTGCCGGAAATTAAGAATTTTCCTAGGACTTTCAA
AACAATAATACTAATGAAACTTCTTCATTTCTGGGGAAATTAATTTTTCTTCTCCTTTTA
TTGCGCCCTTAAGTGAAAGTTCACAGCTCAAGTTAGTTTCTCATACAAAAATTTGTACAC
ACACTGTTATGTGCCCCTAGTTGCTCTCCCCTATAATGGGATAGCAAACTCCTCCTTTTT
CTGGGAAAATGAATTACTGTGCAAGATTTATCTATAAGTGGCGATGGTTTTTGTCTCCTA
CTGGACTGAGTATTTTCCATCTTTTCTGTATTTCTCTCATCTTTCCAGAGCCCAAAACAA
ATCTTACTCCTAGATTATAAAAGTTAGGAAGGGACACAGTATTAGAATATGGGGTGGTAA
ATTATTTCTTCTACTTCAAACCTGTGTTTATACAAAGAGGGTGAAATATGATCAGTTCTA
AAAGAAATATATCTGGGAGGTATATCTGATTTTTTAAAAATGGCTTTCCAGGCTTGCATT
TCAGATACAAACTCCCCAAAAAACCAGCTGTAGTCAAGTCGACTCTAACTCATGACAACC
CCATGTATGTTAGAGTAGAACTGTGCTCCATAGGGTTTTCAGTGATTGATTTTTCAGAAG
TAGATGACCAGGCTCTTCTCTGGGTAAACTTAAACCTTCAGCCTTTCAGTTAGCAGCCGA
GTGTGTTAACCATTTGTACCACCCAGGTACTCTTATTTTATAAATAAAATACTAAGCATG
TAAATCTTTTTGGGGGAGAAATCTGTTTTAATTGTTATATTTAAGGGAATTCTTTTTTTT
TTTTTTCCTTTGTAGTGCTGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGAGTTTTGGT
TGAAGCTACTTATAATCCTAACATGCCTTTTAAATGGAATGCACAAAGAATTCAGACGCT
ACCAAATCAGGTACATAAAGTATTGAGTTAAGTATTATAGAATTGTGGTAATTGGGTCTT
AGAATTCATGAGTATTTTTCTCTTAAATTTAATTTTATTATTTTTAAGAATCAATCTCAA
ACCCAGCCTTTACTGAAGACTCCCCCTGCTGTCCTTCAGCCAATTGCACCGCAGACTACA
TTTGGTGTTCAACCTCAGCCCCAGCCCCAGTCACTGCTGCAGGCACAGATTTCAGCAGCT
TCTATTACACCACTCCTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAA
GGTATTCCGGGCAGTAATAGATCTTTGCTGTTTATGTTTCCGACTGACGTATAACTCTAG
TTGTTACAAATTATAGTGATAGTATACAAAGAGAAAATTCAAAGATAAGCTCTTGGTGGA
CTTAAAACAAATATCAAAACAGTTAATCCCCTGCCATCCTACTGGTAGCTTAAATGTAAT
GGAGAAAAATATTTTTGAGACTTATTGTTTATAAATATACCAAAAATGTTTTATATACGT
GCAGAGTCTAATGATAGCACTTCAAATTACTCATTGAACCGTATTGGATCAAATGAATGC
ATTGTGTCTTAAATTTTCCTTTGTAAGTTGATTGTTTAGAACTCTGGACATTTTCTTATG
GAAGCAGTGTTAAAAAATGTAATTGTGGCATTTTCTCAAATACATCATACAGGAAAATGA
TAGAACATTACACTGTAACAAGTTACTATTAAATGAACACCATGGAATCACTACTCAGGT
CAAAAAAAAATACATTGCCAGCCTTTCTTTTAATAGCTTGACCCTGCAGGTGTGTCTTCG
TGCTATACAACTTAGCATTGTCTCTTTTTGAACTTTACTTAATGTGTGATTCCATTTATA
TAATCTTTTGTGTAAGATTTCTTCATTTTAACATTGTTTAAAGTTTTTCGTACTATTCTG
TGTGGCTTTTGTTTGTTCATTTTACTTGTGGATAATATTCAATTGTATCGATATTATACG
ATATATATGTTTGTTTTGGAAAACATTTGGATTCTAGTATTTGGCAGTTTCTGAAAATGC
GTGAGTTTCTGCACACACATGCAAACATTTGTATATGTGTGCATATATATACTTGTATGT
GTACATAAATATATACATATATACATGCGTGTGTGTGTGTGTGTGTGCACATACAGAGTT
CCACCCTATACCTTCAGATGAAAGTTCTGGGTCAGAGGGTACTATGTGTAGCATAAACTT
ACTAAATGATGGCAAACTGTTTTCTAGACTACTTGGTTCTTCCATGTATCTGATCGTTGG
CCCTGTGATTTCTGATTTATTTTTTTTTTCCTTTCTCACCTTTTTCTTTCCTAAGAGACT
TTTTCAGTTGTGAATTGGGACTTGAATAACCTTTTTTCCCTACTGCTGTCTTCAGCAGGA
AGTATGGCTCTGTGAGAGGGCTCAGGGAAGCCGTGTTTCTCATGCCGATGTGTCCCATGG
CTCAGTGGATGGTTGACGGGAGTACTGAGAATAGGGTGGAAATATATAGAAGAGAGAAAA
GAGTTGTGATAGGATGGGGTTGATTTCAGTGGAGTTGGGTGTGTGCTAAGGAACAATTGC
TAGAAAGGTAGAGAAATCTCCAGTGGCAACTAGGATTGCTTAAGCAATGCTACCCTTTAA
ATCTTTAGCTTACGTAGAATAATTTAATATAAGAAGCGTTAAGTTAGCTGTTCTTTTTTC
CCCCAAATTTTTATTATGAAAATTTTCAGATATACAGGAAAGCTGAAGTAACAGCATAAT
GATCACTTTTGTGCACTTACTACCTAGATTGGACAGCTGTCAGTGTTCTTCCATGTTTCA
TTTGTCTGTATATGCATATGTGTGCGTATACGAATATATACACTTTTTTGTCGCTTAATC
TTTTGAAGTAATTAGGAGACATTATGGTGTTTTCCCCTTAAATTCTTAAGCACATCCCTC
TTAAAAACGATGTTTTCCTGTATTTGCACAACCCGTCATCACATATAAGCAAAACATTTA
AATATTCTAGTTTATATTGAAATCAACCAGTTGTCCTTAAAATGTCATTTAAAGATTTCT
TTCCCCCAAAACAAGAGCCAGTCAGGTTTTATGCGCCATATTTAGTTGTTTCTTTAGTCT
TTATTTATTTATTTTTATCGTAAGATAGTTTCCTTATTTTTTTTTTTCTCTCAACAGTCT
GTAGGTTTTCTTTTTTACTCTTTTGGTGTGAGGTTTTTTGATGAGCGTAAGTGTTTGATT
TTTAGGAGCTCTCAGTTATCTAGCTTATCTTCTGGTGTTTGTGCATTGCTAGTTATGGTT
TGTATTATATTTATGCCGTGTATTAGGGCCTCTAGCATTGTTCCAATTTTTTCATCCGTA
ATCTGTCGTTTTAGGTTTTATATTTAGGTCTTTGATCCGTTTTGATTTTTTTGTGGATGA
TGTGAGGTATGGGTCAAGTTTCATTTTTTTACAGATGGACATCCATTTTTGCCAGCACCA
TTTGTTAAAAAGGCTGTCTTTTCCCCACTTAATGGACTTTGGTCCTTTGTCAAAGATCAG
CTGACCATAGAGGGGGGATTTACGTCTGGGTTCTTGATTCTGTTCCATTGGGCAATGTTT
CTGTTGTCGTACCAGTACTAGGCTGTTTTGACTACCATGGCTGAACAGTAGGTTCTGAGA
TAACACTGACATTTTTAAGAACTTGGGCTGGTTGACTTGTAGATTCTTGTAAAAAGTTCA
TTGTTCTGGATTTGTCACGGTACATTGTTCCTCTATTAAATAACCCATAAACTAGAAGTT
AAACCTATAGGCTTTTGGCATTATAGATGATATTTTATAAATTATACTGGATTGTATTAG
GAGGCACATGTTGTCAGGTTGTTTCACTGTTAAGTTATGCTAAGTTTGATAACTTGGCTG
ACGTCGTGAACATCGCATCCCTCCATTTTAAGGAGACCTGTATTTCTTTGCAGGTAATCT
GTAATGATACTTCAGCACCCTGTGAATATCTTTTTCTACAGCAGTCTTTAATTTGGTATC
TGTAGACCAGGAGTCAGCAAACTACAGCTGTTGATTAGGTCCATGGCTAAGAAGAAGAGT
GATTTTTACATTTTTGGATGGTTGTAAAAAATATATAAATGTACGTTATGGATCAAGACT
GTGTGTGGATTGCAAAACCTAAAATATTTACCGTCTAGCCCTTTACAGAAAATTTTTGTT
AACTCTTACCTTAGGTGATTCTTGCCTGAATTAGTTATTTCATTATAGGTTTCAGAATGA
TGATTTTTTTAATGATTTCATCTTGCCTGCATTTATTAGCTGTTTTATGGAGCCCTGGTG
GTGCACCAGTTAAACATTTGGCTGCTAACCAAAAGGTCAGCAGTTCAGTTCCACCAGCCA
CTACCTAGAAACCATGTGAGGTAGTATTACTCTGTCCTCTAGGGTCGCTATGATTCAGAG
TTGACTCGATGGCGATGGGTATGGTTTGGGTTTTATTATATAGCAATGACTGTGAGTATG
GCACAGACAGTGCAGTGTTTTAGTCTATTGTACATAGGGTCACTATGAGTCGGAACTGAG
GGCACCTAACAGCATTTGCAGGGAAGAACTTTTCCTCATGAACTGGGAGATTCTGTTTAC
CAACTTGCAAAATAAGGAGTTGGTGTTAAAACTCTTCTCTGATGGTGGCAATGGGTGTTT
TCCTTTGTTACTTGTGTTTTATTTTTAAGTATTATTGTGGTCTCGTGGGGTTTTATTTAT
TCAGCTATTTATCCTTAAAAATTTTTATTTTTGGTGCTTTAATTGTCCAAATATGGCCAG
TGGGAGCCCCTTTAAGCTGACTGTGTGTCCTTTTCAGATGCTTCCATTAGACTTTGAGTA
CTTTTTTCTTTCTTACACAAGATGTCCCACTGAGGGTGTTGCTAAGTTGTAAGCTGCCTA
TATGTTTTCTGAAGTAGCACGGAGAGTGAAAGGGAAATAAGCATCAAAAAAGCATAAGAA
CCCTGCTGACATACACATTTTTTATCCGTAATGAGAAATCAGACTCATATTGAATGAATT
TTTTAGGAAACACAGTATTTGAGAGTTTTTTTCCTATTACATCCTACAGAGCAATAACTC
AGATAAACACTATACTGGACATCATACTGGAAATTAATATCTTTATCATAGCCTGGGGCC
AGAAAAATATGATCTAATATGATAGAAATGTGATCTAGTTCAGTTCTGAGTATGATATAA
AAATATGATCTCATGTATCATGTAATCAAGTAGAAGGCACAGAGTGGAACTTGTACGTAT
GTATGTGTAGAAACTTGTGCATGTTGCCCTTGAACACATATATGAGAAATTTTAGAGGTG
ATCTAGTTCAGCTTTAAACACGATTCCATGTATCATTTCATCAGGTAGAATGAAATTATT
TATCCTGTATCCTTGTTTTTTTTTTTTTAATCCTGTGATTTGTGATAGTTATGTCTACCC
TTCATAGACCTGTAAGTTGAATAATTCTAATGGAGTTTTAGCAAATTTTCAAGGAAAAAC
ATCTTTTTAAATCCTTGTGGCTTGACAGAATGTTGAGATACATAGGATGAGTATTTTAAT
CTGGAGTTGTGAAGGATGTGATTATTCTAATAACTCTTTTTGAAATATTTACATCTGTCC
ATAAGTTACTTTAAGTTTGCATTGTACCAAGGAAGGTTCTCTCCTATCTGAGTGAAATAG
ATAATTGACTGTCATGTTTCAGGATGAAATTGTTATTTTTGAATACTAGGAAGAATTCAT
CATGACAGTACCTATTTTGTCTTAAATTATCAATTATGCTTTTAAAAACTGCTTCAGTGA
TTCCCAATTATTTGGCAGTGTTCATCGGGCCAGTGATTTTTATCTATAAAGTTTAACCAG
ATAATGCTTTTGAACTTTGTTTAAATAAGTCAAAGTTCTTTCTGTATCTTTTTAAGCTGG
TTTATTGCAGCCCCCTGTCCGTATAGTTTCACAGCCACAACCAGCACGAAGGTTAGATCC
ACCGTCCAGATTTTCAGGAAGAAATGACAGAGGGGATCAAGTACCTAACAGAAAAGAGGA
CCGGAGGTATGTCAGTAGGTATACTGTGGAGTCTTGTTTGTGTTACCATTATACTTACTT
TAATAAAGAACTCTTCCATAATGCCAAAAATGTTAGTAATTTTAGAAAACTTTGCTTTAA
GTCGTGAAAGGGAGAGAGAAAGACGGAGATCCAGAGAAAGATCGCCTCAGAGAAAACGTT
CCCGGGAGAGATCTCCCCGAAGAGAGAGAGAGAGATCACCTCGGAGGGTTCGACGTGTTG
TTCCACGTTACACAGTTCAGTTTTCAAAGTTCTCTTTAGATTGGTAAATTCTTTTTCTTC
CCTTTGTTTTATTGAATTACTAACTTCATCATTTTTAATACAAATAAATACCTTTGGAAT
CAGAGGTCATGTTCAAGTTACCAAGAATTTCTGAGCTTCACCTGCTAAATGGAGATAATA
ATGAACTAGCGGAATTATTGTGAGGATAAGTTGAGTTAGTATCTAAAGCACTTGATGGTA
GTGGGCTGTGGTGGTCAACTAAATAATAGCTATAAACTTGTAATGCATACGAAGGGCAAC
TTGATAAGTAACTTTAAGGGAAAGGTAGAGTAATCTGAGGACCTTGGCAAATGTGTATAA
AATAATCAACAGATGGGAAATCCAAGAACAACCTTAAACCAGAAGTATCCCTGGGAGTTT
TCTTAAACAAATAATTTAGCTTAACTAGTATAAAAATGAGCATTATGTTCCTTTCAGAAC
TGTCTATACGGGATCAAAGTGACTACAGCAACTCAAAAGATTAGATAAAAACCTTAGGGG
GCACGGAGTTTATATTCATGAGGGAGGAACAACCTAGAAGAGGAGGGTGAGAGTGGATGC
ACAACTCTAAGAGTGTCATCAATGTCAATGAATTGTATGTGTAGAAATGGTTGAATTGGT
GCATGTTTTGCTGTGTATATTCTCAACAACAAAATATAAAAATATTAAAAAAAACGAACA
ATTAATAGTAAAATAACAAAAATGAATTATCAAAAGCAGTGTTCAAAAGCTGTTTAGCCT
AGACACTGTATGCACTTCAGTGGCCTTGAGGGGGAATTCCTGCATTTCAACAAAGTATAA
TAATTAATATTGGTCTATCAAAAGTTAAAATTTCTGTAATCGTCAGTTCTAGATCTTGTG
AACACATAGTATATTTTATGTAAACCAAAGAAGAGGGAAGTGATGGTTCAGTGGGGAACT
CTTGCTTCGGTGCAGGATACTTGGGTTTGATTCTCAGCCAGCGCACTTCAAGCATAGCCG
CCACTGGTTTTTCAGTGGAGGCTCGTGTGTGTGGCTGTAGTGCTGAACAGATTTCAGCAG
AGCTTCCAGACTGAGACACTAGGAAGAAAGTCCTGGCAACCTACTTCCAAAAAATCAGCT
TGTGATAAAACTGTGTCTGATCCTGTTGTGCATGGGGTTGCTGTGAGTCCAGAGCCAACT
CGATGGGAGCTAACAATGCCAAGAAAATCTCGCTTTAAAGCTTGTTGATATTTCTTATGT
TAGTTGGTGTTCATATGCTTGTGCTTGAGGTCAAATCTACTCTTAATTTATACTAATTTT
CTTGTTATCTTTGTTTGCTCTGATACTTAAAATATCTAGGCTGCATATTTCAGAGAAATC
CTTTGGAAATAAAACTGCTTTCCTAGTCCCAGAGGTATTAAATAGAGCAGCTCTGCTTGT
AACTCATTTATTCCCAGTCTAGAATACTATTCTGAGGTCAGACCTTCATAGTTCACCACT
GCGAAGTAAATGCTCAAGATATCAAATATACGGTTTGTAAATATAAATGATTTTAAAGTT
TCCATATCTCTTTTATGTAGTTTTGGAAATATTTTCTTAGAATGATATGATTATAGGAGA
CCGTATACCAAGAAGTGATTTATTTGTACTTGTCTCTTCTGCTGTATTGTAGATTTTATT
CCCATGGGGTAAAACATGACTTCAAAAGTTCTGGTGATGGTTTACTGGGAAACTGTTTAC
ATATACTTTCTTTTTGTAACACTTCTTTAAAAACAAACAGCAACAACAAAAAACTCAAGT
ACCTGTTCTTCACATTACCATTTTAACAGCAGAATCTTGTTCGAATAAAGTAGATCAGCA
GCCATAACTGACAAGTTTATTCCTGTGTATTTATTTTTAAGTTTAAAATAGAAAGATATC
CCTACATATAGATAGTTCACATTTGACACCACTGTATTTTAAAAAGACAGTGTAGTTGTC
TTTTCATCTTAAAAATTATTGGTGGTTTCCATTTTTCATTATGCTTTAAAAAAGAAACCT
CAGATTTTTACCAGATTGATTTAACTTTGAATTCCTCTCCTTTAAAACCTCTGCTTCTCA
GGAAAAAGGAAATCATACTTTTAAAATATCAGTATGCCAGATAAAAAAGGCAAGAAACTT
ATCCCCTCATTATATAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTTTCTCAAATTAATACAGAGTTCCAAATGCTACAGAACTGCCC
TTTTTTTTTTTTTTTTCTTCCCCCAGATCTTCTGTGGAGCCAGAGCTGAAAGTTAATTTC
ATTTCAAAAGAGTCTTTTCTAATTAATTGTAAGCTACACACAAAAAGTAAAGGAATACAA
GTAACAGGCACCAGTTATTTATTAGAAGCTGTTAGTAAACAAATCTGAAAACAAGACTTT
CATATGTGTCTGTGCAGATCTATAGCTCATTTATAATTGAAGGTCCATTTTCAACTGGCT
TTTATCCATGTCAGGTTATATGTTTAGCTTCAGAATTAAGTGAATGTTTGTATACCCTTT
GGTGTTAAGGCTGTTATTTATTCACTACTTGTGTCTTTTTCAGTCCTAGTTGTGACATGA
TGGAACTAAGGCGCCGTTATCAAAATTTATATATACCTAGTGACTTTTTCGATGCTCAGT
TTACATGGGTGGATGCTTTTCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATT
TCTATGTAATGCACAGAGAAGTAGAATCTTTGGAAAAAAATACGGCCATTCTTGATCCAC
CAGATGCAGACCACTTATACAGTGCAAAGGTTTGTATTCTACTGTGATAATACACCATAA
ATTTCTTAGTATTTATTCATAATAACTGGGTATGTGGAGAGATTGACTCTTCAGGAAATG
GTGTTAGGTATAGGACCTGAATACCTGTGTTTTCTTGTTTGCCTGATTCTGTTTTGATAC
GTTAGTAATTTAATTTAATTTTTTTTTTTCTTAGCTGTTAAACTGTAAAACTAGAGTTAA
TTTCTTTTTTAACATTTTAAACCTCATAAAAATGTGAAAATGAAGTTAATTTTATTAAGT
TTTTGGAATTTTCTATGACTTTGAATACCCCAGACAAAACTTAATGTTGGACGAATGCAC
TGAATTGTAACTTTTAGGGTAGCATTTAGTATATTGCTTTCACAGTCAGTAGTTTTTTTT
GCTATTTTAGAACACCATCTGATCAGCACAGCATCCTTGAAAAGCTAAAGCTATATAAAG
TATCTAATACAATTTCTGCTATAGCACTTTATCTTCCATTTTTGTAACAGATTTTGGTTA
TCTAATATGTAAGGATAATTAGTAGTGCTTCTCACTTTTTTACATTACTTTAGACTTTTG
ACAGGATTGAATTATTTGACTATAATAGGTAATGCTGATGGCTAGTCCTAGTATGGAAGA
TTTGTATCATAAGTCATGATGACTCTTGCTGAAGACCCACAAGAACTCCGAGATGGATTT
CAACATCCTGCTAGACTTGTTAAGGTAAAATGAAACATTTATTTTAACTTTATTTAGTTC
TAACTATATAAACAAAATGAAAAATACTATGTTTTTAATCTTATCTGTTAGTTTAATAAC
TAATTTTACTTTTAAGGCACTCAGAATTCAATGAAGCAGATGTTATTTTATTGCAGGTTA
TGACTGTATCTTATTTGTATATCATTGGTTAAACTGTCTTTTTGGTGTTTTGTATGTGTA
GCATAGTAAAATCTTAGTGGTAACAGGATTTAGTATACCTTTGGATGGTCTTAAAGTTTG
AATTATAGCTTGTTTTTTTAAAAGAACTCAATCCGAAGAAATATTTTAGAAGGATGAGTT
ATGATGTGTAAATCCTATTCCATTGCTGAAATACAGTGTGGAACATGTTGAACTGAACTC
TTCCTTGACTGACAGATACCAGAGGTAGTAAAAATGATATTGGAAAGGTTTGTACCTTTC
CTTCTCAAGTATTTTTTTGTAATTTGACAGGTTGCATAATATATTTAAATGATTGTTTGT
TTTGAATTAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCTATGGCCATTGGAGGCCA
CTGGTCTCCTTCGTTGGATGGACCAGACACAGAAAAAGACCCTTCTGTGTTGATTAAGAC
TGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTGTGCACACAATGGTA
AGTACCACTTCGTTTCTTGACTGGAAATGTTTTTCTGATAGCTCATGTAGATGTTTTTGT
CGATCAGCCTTCCCTTTCCCCCCTTATTTTAGCAACCCTGGTCCTGCAGGTAATCTCCTC
ACAGAAAAATCCCTATTTGTAGCAGAACGTTTATCTGGTGCCAAAAGTGTTTTGGGAAAA
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTTTA
GACCAACCTCAAGTTCTTGCAGCAAAATTTCTTTACTTGATGTGCTACAAGTGAACTAGG
GTCTTTAAAATGTATTTTAGAATTTTTTTTCCAACATGCTTCTTCCCTTGCAACAGGTAC
CGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCA
GCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGC
TCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGT
GAACGCAAGGAGGCTGATGGAGAACAGGCACTGAACGCTAATCCCTTTTTCTATTTCCGC
TTCTCACAGGCACAGGAACACAGGCACAAATGCACACCACACACTACATAACAGACACAC
ATGAAGGAACATAACTGGTAACAGCGACTGGTAATCCAGCTTTCAGCAGTAGTATGTTCT
TTTCTCTTAAAAATTCTGTCTATTAATACTAACTTAAAAAAGAGTGCTGAGACCTCAAAG
GAAAATAAGTTGTGCTTAAATTGCACAGAACTTTGTTTTTATCATAGGTCTAGTTGCTGG
AATCTGGGACCAGTTGTTGAGCAAGATTCAGTATTAAGCCATTTTAAACACCTTGCCATT
TTCTAAAATTTAAAAAATTTTCTCTTTCACGGTCATCAGTTCTAGTCATGGATATTTGAA
ATTGGACACCCACAAGTCTGAGAGATTTGAAATTTCAGGCTATGTGGCAACGTCACGGGT
ACATTTGAAAGGTCTGACTAAATCAGTTTTTGGGTGGCTTGAAAATTGGGACAAGATCAC
ACACTGTGTGGTTAGTGGAGACCGGCAGTGTCTGTGCATCCCTGATATCCTTTGTGTTGT
AATTTATCACCCTTTTGTGTTTCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTTGT
GATCAGTTAAAGTGGTAGAATGTATGTACGTGGACTTGCCTAAATAATAACTTTAGGAGA
AGACAATCTGAAACATTTGTGACCTTGCACAGATCAGCAACAGACTTTTAAAAATAAATG
ATTTTTATTTTAATGTTTCAGAATAGTAATTGTATTCTTAATTTTGCATATCAGGATGAA
GAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACGCCCACCCATTGGTCTAAACTT
GATCCTAAGACAATGAAGGTAACTTATTTAATTTGAAATCTCTTAAAAGAATAGAGTAAC
ATTGGTGAGAATGAGGACAGTGTCTCTCTCATCATCACTGCCAAATAAAAGCCATTTGAG
ATGTTACATTTATTAAGATAAATTTATAAAGTAATGTTTTGTTTATATATCAGTATGACT
TTATAAATGAGTTTAAGAGCCTCTTTTGAAAATCTGTGGTTAACTTGCACTCGTTTTTCT
TTGCTCCCTAAGGTCTCTGGACCTGTTTTCTTTCTTTAGGCTTGAATCTCTGGGCATATA
ATGTGAATATAGATGTGTGGTCAGAAGATTGGAGGCTGGTCGTATTGCTTGCTTTTGCAG
CTTGTTATTTCACCAGTGGTAGCTGGCCTTTTGCAGCTTGTTATCTCACCAGTGGTAGCT
GGCCTTTTGATTGACATGTATTCTCAGCAAAAAACAGTTTTTCTCCTTGGTTATGAAACT
TTGGTTTCTTAACCCACGTTGCTTTTTTTTAGTAGAGAATAGAAAATACATATCATAAAA
ATTTTTGTTTGTCTTTCACCTCTTCAAGTCATCGTCATCAATATCAGATTTGATAATAGA
GTATTGTAGATTCAGAAAATATAGGCACTTAGATTAAGCCTGTGTACCAGGACTACTACT
CGTTTTCTTATATTCAAGACTTTACTATTAAGTTACTTATTTTTAAACTTGTATTTCTTT
TTATTGTAAATATAATGTGTGCTTATTTTAAAAATTGGAACATACAGAAAAATACAAGAA
AAAATTACCGAAGCCTGTCATTCAAACGCAGCCATTTAAAAAATTTGATGTGTTCCAATG
TTTTTTCTGAATACAAGCTTTGTGACTGGTTGGTTGGTTATAATCATGTATGCACGTAAG
TTGTTAACTCATACTTTTCAATTACCATTAGTTACAAATGTTGTATACTGTTCCATCTAG
CTGGTATACTGTGTTTTCCTTTATTACCCTTTTATTGAAAATTTAAATTCTTTTTGGGGG
GAGGGGACATAAGAAGTAATATATAAAATTTTTTGTGTTTAGGATATTTCCTTCGGGTAG
ATTCCCAGAAATTAGAATTACTGGGTCAAAGAGTATTTTAAAAAACAGTAATAGCTTAAG
CATCTTGAAACATACTTCAAATTATTTTTTAAAAATAGTAATAATTCTACCAGTTTGCAC
TGTTCTAAACATTGTACGTGCTTTCACCAGTTTTAATTCAGCAGAAGATAATTGCACAGG
TACTTCGTTTCCTATGTCAATATTCCATTTTTTTCTCTGTTTTTATGCTTCATGTATTAG
GTAAACGATCTCCGAAAAGAATTAGAAAGTCGAACTCTTAGTTCAAAAGGATTAAAATCT
CAGTTAATAGCCCGATTGACAAAACAGCTTAAAGTAGAAGAACAAAAAGAAGAACAAAAG
GAATTAGAGAAATCTGAAAAAGAAGAGGAAGAAGAGGATGATAGGAAATCTGAAGATGAT
AAAGAGGTATAGAGTAAATCATTTAAATATACTGTAATGGTATTAATATTAGTTTATAGG
AGGTTCTTGGAATGTGAGACTTAAGTCATATATAGATTTTTTATTAAGGTACAATTTATA
TATCTTAAACACAATCCAGAATGTGAAAAATTTTATAAGACGTTTTGCCGGAATTTTTCA
AAAAATGCCCGTGTCATGAAAGACCAAAAAAATAAATAAAAACAACCCTAGATTAAAGAA
GATTAATGAGATATGACAATCAAATGCACTGAGTAAAACTTAACTGGATCTTGGATAGTT
TCTTAAAAAGCCATAAAGAGTATCTGTGGGACAGTTGGAGAAATTTCATGATGAATATGG
CTGTGACATTAGATGATAGGGAAGCAGTGTTAAACTTCTTAGATACGATTTGTGATTGTG
TAGATCACCATTTTCTTAAGAGATGTGTAGACTTATGATTTCTGTTTTATTAATTGGGCT
ATACTTACTTTGATGGTGAAAATGCCCCAGAGTCAGCCAGGGAGACCTCCTTCAAGTTGG
CTTTTGTACCCTTTTGATATGTCCCCATCATTTTTTTGTGGACTTCATTAACTTTCTGGT
ACAACATGTGTCAGTCTTATCTTTTACTATCCCTGCTCTAGCTCTGGAATCCACCATTTT
TTCTGGAAGCCGAGATGAGCTCATTGCTATAGGTTTGGGGCTCCCAGCTCCTCTCAGTGA
GCAGAGCTGTGCAATAGATGTATCTTCATACACACGCGCGCGCACACACACACACGTACA
TATACATACTTAAATCTTTTTTATTATATGATGTGTGTTTGATATGGTTATATTTTGTAC
ATGGAAATTTAACTATGATTTTAAATTTGAAATATCTAGGAAGAAGAAAGAAAGCGTCAA
GAGGAAATGGAACGCCAGCGTCGAGAGAGAAGATATATTTTGCCTGACGAACCAGCCATC
ATTGTACATCCTAATTGGGCCGCCAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTG
AGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTAATGCTT
TAATTTTATTTGAATTAGGATCCAAATAGTTTACGTATTATGATTGGGTAATACGTCTCT
CTGAGTGCCTCTTCCTTGTATCCTACAGACTCAGTTTTGCTGACTGCCTTCTTGTGGTAT
GGTTTAAATATTCCTCTGTCCTGTAAATTGATGGTCGTTTCTAATGTCTTAGGTAAAAGT
TTGATTTGTTTTTTCCCCTAATAATGTAGTGGTGTTTTCTTTTATCAGGAGACACATGAT
ACACATGTTTAGTTGCCTCCTTGGGGATGTGAAGTAGTAACACTATTGTTTTCTCTAGAA
TTAAAAATCCGTTTAATGGAACTGAAAATTTTGTGACTGGTTGAGGTGTAAGATAAAATG
TTTGTCTTGTTAACATTTGTGTATTTCTTTGTACCATTATTTGAGAGCAGCTTTATAACA
TGTCATCGTACAAAACACTTGAAGACTTTATCCCTAAATATGAGTGAGTGCTTCATTCAT
CTAAAATTGTAATTGTGTCCCTTATTGCATCTTATCAACATGTTTTTATTTTATAACATA
TTTGAAAAGTCAGTCATATTCATTTGACCCATACTTGTTAAAAAACAGTTGCCATCAAAT
TGATTCTGCCTTAGAACAACTCCATGTGTTTCAGAGTAGAACTGTGCACCATAGGGTTTG
TAGTGGCTGTGATCTTTTGAAAGTAAATTGCCAGGCCTTTCTTTCAAGGCACCTCTGGGT
AGATTTGAACCGCCAGCCTTTCAGTTAGTAGCCATGCACTTGACCATTTGTGTCACCCAA
GGTCTTAGCTTCCCACCAAATGGGAAGAGGAAAATGAAGGAAAGTACTTAGAAAAGAGAC
CTTCGCAACAAATATAGAGGATTTTTGTGGCAGTTATAAAACATAAAGTACATACTTACT
GGTCTTGAAATAAAATGTCACAAATATTAACGTATTCTAATTTTTGATATATTTATGATG
TCAATGTGCTAATGTCCTTAAATATTAGAGGCTATATGATTTTACTTTATCAGCAGTTGT
GGTAAATTTAAATAACTGTCAATAGTGCCTACCATGTAGTAGTCGCTAAAGAAATAAGTG
AAAAAAAAGCCTTTGATGTTACTACCTGCTGGTGAGAGTGTACCGTGTGTCTGCCCGGTG
CTGAAAAGGGTCTCAGGTTGATGCCGCTCTGAGGGAGACAAAGGGATTGGAGAAACGGCT
GGTGGCATCAAGGTCTTCTGCCTTTTTCCCGTGTGGAGCATATCCCTGTGGTTAGTTTCA
TTTTTAGTTTAGCATTAGAAAATAGGCATCATTTTGGCGTATAATTTAGAAGAAACTATT
CTATAACTTAGAAAAAAAATATAAAGTTACAAATCTTAGGTTGGTTTGATAAAGCTGGAG
ATATCTTTGTTTTTTAGTGCTTGTAAAGGTATGTAAAAATAGAATTGTGCTTTTCTAATT
ATCATTCTAGGCTTTCTTCAGTCATACATACTTTAATACTGCTTATGATCTCTAGGTTAT
GGAAAATAAATAACTAGGGAAAAGATAAGCTTTTTTATATTCACTTACAAAAATGGAGGT
ATTTGTTTAGTTTACGTTAATGGTTAAGAGAATGTCAATTTTTCAACATCTTTAATGGTC
ATTTTACTAATTTTTTAAAATTTAAAATTATAAAAACTGAACATTAGAAAAATACATTAT
AAAAATAATTTTGATAAATCACATTTATTCTTTATGATTAGGAAAAGTTTAATTACTGTA
ATTTTTTTAAGTGTTTTACCAAATATATTGACAGCTTGCCAAAGATTACATATTTTACAG
CTGTGGTCTACCATTCTCAAGTTCTAGACCCTTTTAAGAATCTGTTGAAAGCAAAGTATC
TTATGCTTAGAAATACACACATAGAAAATTTAGTATATAATTTTAGGTTTGTGAATGTGC
TAAAGCCTGTTACCTGTGAATCCCTGAGTAATAATGTATGCTCACTACTCAGGGTTTTGA
ATTGTTCCCCTGACCTGAAGTGCTTTTCTCCTCAAATAACCATATGGCTTACTTCCTCAG
AACATTCAAGTCACTTTTCTAATGTCACCTGATCAGGGAGGCTTTCTCTGAAAACTCTCT
CTTGTTATTCTCTATGTGCCTTATCCTGCTTGTTTTTCATACTACTTGCTGTTTATTTTC
TTATTCCATTCACTTGATTGAAAGAAATTTTTATTTGCTTTGCTCACTACTGGGTTTCTA
GTGTCTAGAACAGTCTGTGGTACATAGTAGGCATTTCATAAAAGTTTGTTGAATAAGTGA
AGAAAGTTCATCTATTATGAAAATTAATGATTTTGCTAGAATGGTAGGTATCATTTTTTT
CTGCTCATTTTCAAATTTTCTACAGTAAGGCCGTTATTTTTCATAACTCTTAGCCAAAAC
TATACTAAGCATAGTATTTTTAGCTTCAGAAGGTTCTTTTGAAGATTTTGAGGTTTCTCA
ACCTCATCAACATAAATTATTATAACTGTATTTTAAGTGCACGTAATTGTTAAATTTGAC
TAGTTTTTATTTGATAAATTGGTGACTGTGCTGGATTTATTCCAGGGCTTTGAACCATTG
AGTCATGGCCAATGAAGCAAAACCAGAAGAGACTTGAATTTTTAAAACTTTGGGTGATCC
AGAATGGGAAAAATTACAGGTGGAAGCCCTGGTTGGAAGAGGCATAGTGAGCCTGATACA
TGAGATTGGATTATTGCCTGGACTGCAGAAAGTGACCCACATTGAGAGCAGCGTGGTCCA
CTGTCACCTCTGAGGGACGCACCGCTGTTTCCAGCTTTGCGCGAAATCCAGTGGCCAAGA
GGTTTGGTGTGCAATGCGTATGCTGCTCTTGTTTTCTAAGAGGGGTTTCTAGCAGGGTTT
TGACCCGTAATCTTTCCCATTCTGGTTACCATTCCAGTTCACCCAAATTAAAAAAATATA
GATCTGTTCCAGAGTGGCTTCCTTGGCCATGACTGAACTGGGCAGAACCAGTTCAAAGCC
CTGGTTTATTCAGTATTTCTGTTAAAGTTGGCTGTGTTAACGTTGGTGTCTTTTTATAGG
TTTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATAT
ACAAATCATTAGTATCTCTTCCTGAAAAAGAGGACAAAAAAGAAAAGGATAAGAAGAGCA
AAAAAGAAGAAAGAAAAGATAAGAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAAC
CAAAACGGAGAAAATCAGGCGATGATAAGGATAAGAAAGACGACAGAGATGAAAGGAAGG
TCTGTAATTATTTCTGTAAGCAGCAGCCTGGTTTAGAAGTTTTTAATCATCTAGATTGCA
AAAAAGATGCCAGTGAATTCTGTCATAATGGTAAAATTTAAAGGCCAGACAGAAAAATTT
TAGTGTAGTATTAGAAATTTAAATCCTTAAATTGTCTGTATAAACATCTATAACTACTTT
TCTGGTCGTTTATCCTTGAGGTGTGTTATAAGAAATTTACATTTTGAAACTATTTCAAGT
AAATTTAATGAACTTGATGTTTTTCATTTTCAGTCAGTGTTTGGTAAGGTGACTTTTATT
TTAATAATTCATTTGTTGAGAATATACACAGCAAAAACATAATACCAATTCTAGTTCTCC
TGTACCATTAGTGACATTACTTGCATTCTTTGAGTCGTGCAACCATTCTCACCCTCCTAT
TCTGAGTTACTCCTCCCCCATTAGCATAGGCTCACTGCCCCCCTAAGGTTCCTACCTTTT
TTTTTTTTTTTTTTAATTGTGCTTTAGGTAGAAGTTTATGGAGCAAATTTGTTTCTCATT
CAAAAATTTATACACAAATTGTTTTGTGACATTGGTTGCAGTCCCCACATTGTATCACCA
CTCTCCCGCTTTCCACCCCGGGCTCCCCGTTTCCATTTGTCCAGTTTTCCTGTCCCTTTC
TGCCTTCTCCTCTTTGCTTTTGGGCAGATGTTGCCCATTTGGCCTCGTATACTTGATTGA
TCTAAGAAGCACATTCCTCATGTGTGTTATTGTTTGTTTTATAGACCTGTCTAATCTTTG
GCTGAAAGGTGAACTTTGGGAGTGGCTTCAGTTCTGAGTTAGCAGGGTGTCCGGGGGCCA
TAGTCTCGGGGGTTCTTCTAGTCACCATCAGACCAATAAATCTGGTCTTTTTTGTGAATT
CGATCATCTGGTCTACATTTTTATCCCGCTCCATCCTGGACCTTCTATCATGATCCCTGT
CAGAGCAGTCATAGTGGTAGCCAGGCACCACCTAGTTCTGGGTTCAGACTGGTGGAGACT
GTGGTTCATGTGGTCCATTAGTCCTCTGGACTAATATTTTCTTTGCGTCTTTGGTTTTCT
TCATTCTCCTTTGCTCTGCATGGAATGGGACCAGTAGATGTATCATAGATGGCTGCTTGC
AAGCTTTTGAGACCCCCAATGCTACTCACTATAGTAGGATGTAGAGCATTTTCTTTATGC
TTATCATCTTCATTATCTAGTGCTGCTATAACAGAAATACCACAAGGGCATGGCTTTAAT
AAAGAGAAATTTATTCTCTCACAGTCTAGGAGGCTAGAAGTCCAAATTCAGGGTCCCAGC
TCCAGGGGAAGGCTTTTTCTCTCTGTTGGATATGGGGGAAGGTCCTTATCATTACTCTTC
CTCTGGTCTAGGAGCTTCTCAGCACAGGGAACCCAGGTCCAAAGGACGTGTTGCACTCCT
GGCGCTGTTGTCTTGGTGGTATGAGGTCCCCCGTCTCTCTGCTCACTTCTCTCTTTTATA
TCTCAAAAGAGATTGACTCAAGATACAACCTAATCTTACAGATTGAGTCCTGCCTTATCA
ACATAACTGCCTATAATCCTGCCTCATTAACATCCAACTCATGGTGACCCTGTGTACAAC
AGAATGAAAAACTTCCTGGTCCTGTGCCATCCTCATAATCATTGTTATGGTTGAGCTCAC
TGTTGGAGCCACTCTGTCAGTGCATCTCGTTGAGGGACTTCCTCATTTTTGCTGACCCTC
TACTTTACCAGGCATGATATTGTTCTCCAGGGACTGGTTCCTCCTGGTAACATGCCCAAA
GAATGAGAGACAAAGTCTTGCCATCCTTTGTTCTGATGAGCATTCTAGCTGTACTTGTTC
CAAGACAGATCTGTTCGTTCTTCTGGCAGTCCATGGTATATTCGGTGTTCTTCGCCAACA
CCGTGATTCAGAGGCATCAGTTCTTCTTCGGTCGTCTTTATTCATTGTCCAGTGCTCTCA
TGCATATGAGGCGATTGAAAACACCATGGCTTGGGTCAGGTGCACCTTAGTCCTTAAAGT
GGCATCTTTGCTTTTTAACACTTTGAAGAGATGTTTTGCGGTAGATTTGCCCAATGCAAT
GCGTCGTTTGATTTCTTGACTGCTGCATTAACATCATAGAGATAGGATTTATAACACACA
GGAAAATCACATCAGATGACAAAATGGTAGACAATCACACAATACTGGGAATCATTGCCT
AGCCAAGTTGACACCACATTTTTGAGGAACACAATTCAATCCATGACTGTTATGCCAGTT
GATCTAGATGGTCCCCAGCCCTCAGCCCCAGTACCCTGGTCCCTCAAGGTGTTTAGATGT
GTCTAGGAAGCATCTATGACTGTGCCCCCTTTGCGCTCTATTATGTATATAAATATACTG
GCTGTTCATACAAGTATGTATGTAAAAATATCCACAGCCTGGACCATGGTCTTGGGGGTA
CATCTAGCTGAATTGACATAACATAGTTTATAAAGAAAATGTTCTAAGCACTGCTTTGGT
GAGTTGTGTCTGGGGTCTTAAAAGCCTGTGAGCGGCCATCTAGTATACTCCACTGGTCTC
ACACCTTCGGGAGCAAGGAAAAATGAAGAAAACTAAAGATACAAGGGAAAGATTAGTCCA
GAGGACTAATGGACCATGTCTACCACAGCCTCTACCAGACTGAGTCCAGTACAACTAGAT
GGTGCCCAGCTTACCACCACTGACTGCTCTGACAGGAATCACAATAGAAGTGGAGAAAAA
TGTAGAACAAAACTCTAACTCAAAAAGAAAGGCCAGACTTGCAGGCCTGACAGCAACTGG
AGAAACCCTGAGAGTATGGCCCTGGGACACCCTTTCAGCTCAGTAATGAAGTCACTCCTG
AGGTTCACCCTTCAGTCAAAGACTGGACAGGCCCCTAAAACAAAATGAGACTAAAGGGGC
ACACCAGCCCTGTGGCAAGGACTAGAAGGCAGAAGGGGACAGGAAAGCTAGTAATAGGAA
ACCCATGCATGGTTGGTCATGGGGTTGTTAACCAATGTCATTAAACAGTGTGTGTACTAA
CTAGTTCTGTAAACCTTCATCTAAAGTACAGTTTAAAAAAAAATTAAAATCTACAGCCTA
ACATATATATGTATGGTGAAATGACTTTTGGTTAATTTTAAAGCATTTTAAATTACAGAA
AGAAGATAAAAGAAAAGATGATTCTAAAGACGATGATGAAACTGAAGAAGATAACAATCA
AGATGAATATGATCCAATGGAAGCAGAAGAAGCCGAGGACGAAGAAGATGGTATGAGCAT
TCAAAGTGACTTCTGTTTAGGACTAAGTAAATATTTTTGTTTACTGAGTTTGTATCATTG
AAATCTAAGCATTTTAGTTATTTACAGTAGAAACATTTTCTTCTAGTGAAAATCTGGTTG
TATTATGTTATTCTTTAATTTTTACATGAAAAGATTGCTTTAAAACATTTATTAAATACC
ATATGTCCCATACCTAATTAATTTTTACCCAACTTGAAGAAAAAAAAAAAAACCTTGCTT
GGATGTGGTCTTTAAACTGAGTCATAAAGACACACTAGTCCAGTTATTTCATAGAATATA
TTCTTTAGAAAATTAATTTGGGCCTTGTGTTTTGTTTTTAATTATGAGAACTATCATACA
TGCAAAAGAGTGCATATAACTTTAGAGTTTAAAGACAAATAATAACAAACACCCATATAT
CTATCACCAACGTTAAAAAGCAGACCTTTACCAATAAGGGTGACATTCAGAATGTTTTAC
TACAGATGTCACCCATAAAAGGGCTTGTAATGTTGAATGCCTGTCAGTCTCCATATAAAT
TTGTGGCTTTTTTATTTTTAATTATCTTTTTCTGAAATGAGAAAACTACAAGAGATTTTA
TTAAATCTACAGTCTAAGAGGATTATTATTAAAGTATATTTGATTTATCTCTGCGTTTTT
TTCTATTATAGTATTTTTTCTCTCATTGATGAAAACATTCAAACATAACAGAAAAAGTTG
AAAAGAATAGTGCAGTAAACACCCCTGTGTTCAACAACTGTGATTCAATAATTGTTAATA
ATTTTGGCTTTACATGTTCTCTGCATGTGTGTGTTTGATCCATTTGAAAGTGTAAATTTT
TCATCTTAAGAGTAAAGACTTGGTCTTAAGATTACAGTTCTTTTTTTGTTTCCCTGGTAT
CTCCAATTTCTGTTTGCTTATGTTATCATGATTTTATTTTGTTGTTGTTCTTTTGTTTTT
TTATTATCTCATTATTTTGTCAAGATTCCTGGACACCATTCTTTCCAGAAGACAAATGGA
ATTGGTAGAAAATAAAAACGAATGCACAGTGCCAATTAGTGTCTAAAAAGATGTTGAATC
AGAAGAGCAGATCATGAGACCATTTTTACTTATCAAATTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTAGTAGGGGGACAGCAAGCACTTTCATTCCTCTA
GGGAGCTTTATAAATACACTTTGTCTGGACAGAAATTTGGAAATATGAATTAATCCTACC
TTTTAAAATATCAGTACTGATGTTCATTGCATAATTGTTTATAAAACTTGTCTCTATGAA
GGTGCCTATTGTAAATGTTTCGTGTAAGTGGAATCATACAATATTTGTCCTTTTATGTCT
GGCGTATTTTACTTTAGCATAATGTTTTAAGGTTCATCCATGTTATAACGTGTTAGAAAC
GTCATTCTTCCTTATGAGCTGTCTGTTACACTAGGTGTATATACCACATTTTGTTTACTT
GTTCATCTCTTGATAGATACTTGAGGCTGTTTCCACCTTTGGGCGATTGTGAATAATGCT
GCAGTGAACACTGAGTGTATGACCGTCTGTTTCACTCATCACTTTCTGTTCTTTTGGGGT
ATTTACCTTGGAGTGGAATTGTTGGATCATGTAGCGATTTTATGTTTAACTTTTTGAGGA
ACCACCAAACAGTTTTCCACAGTGACTGCACCATTTTGTGTTCCCACTGATAGGGGGTAT
GAAGTGTCTAATTTCTCCTTATCCTCATCAGCACTTGTTGTTATTCATCTTTTTTATTAC
AGCCGTTCTAGTGGGTATGCAATGGGATTTCGTTTTGGTTTTAATTTGTATTTCCCTAAT
GACTAATGACGTTGAGCATCTTTTTGTGTGCCTGTTAGCCATTCATCTATCTTTGGAGAA
ATGTCTCTTCTAGTCCTTTGCCTGTTTTTTAATTGGGTTGTTTGTCTTTTTGTTGTTAAG
TTGTAGGAGTTCTTTATGTATTCTGGATATTAAGTCCTTATCAGATAAATATTCCCAAGT
ATTCTTTCCCACTCTGTAAGTTGTCTTTTCACTTTCTTGATAATATCTTCTGGTGCACAG
AAGTTTTTAATTTTGATAAAGTCTAATTTATCTGTTTTTTCTTTTGTTGCATTTGCTTTT
GGCCTTGTATTTAAGAATCCATTACCAAATCCAAGGTCCTGAAAGAGTTTAGCCCCATGT
TTTCTTCTAAGATTTTTATGGTTATAGCTCTTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTATCTTTTGCAAGTGGATGTACAGTGTCCCTGTAGCATTTATTGAA
GAGACTAGTCTTTCCCCCACTGAGTGGACTTCACACCCTTGTTGAAAATCGGTTGACCGT
AGATGTATGGGTTTATTTCTGGACTCTTCATTTCTGTTCTTTTGGTCTATGTGTCTGTCC
TTATGCCATTACCACACGGTTTTGATTAAGTTTTCAAACTGGATTGCTTTGGCTATTTGG
AGCCTGCTATTCCATCCTTTGAAGACTTCAGTAATAGAAAAGTACTTTTGGTCTCAGCCC
CAAAACCCAGTGCCGTCGAGTTGATTCCGACTCATAGCGACCCTATAGGACAGAGTAGAA
CTGCCCCATAGAGTTTCCCAGGAGCACCTGGTGGATTCGAACTGCCGACCCTTTGGTTAG
CAGCCGTAGCACTTAACCACTACGCCACAAGGGTTTCCCCTTTGGTCTCAGCAGTCACTG
AAAATATCTGTATTAATAAATTTTTTGCTGCCGTTATATTTGTTTTACAGATCGGGATGA
GGAAGAAATGAACAAGCGAGATGACAAGAGAGATTCCAACAGATACTGCAAGGAGAGACC
CTCTAAAGATAAGGTATTTATTGAATTAATAACGTATTCTTAAGAATGTCACAATTCCCA
TATCTTACATAATCCAGACTTACTAAAACATAACACAGTCGTGAAGTTTACTAGTCCTTG
TGTATCTGTCTGTATGTTGCCACTAAGAGGAAAATTAAATCAGTTGTTTTTGGTATTTCC
GGCTATGTCAGGTAGCCAGTGTGCCTGATTTCTTTCTCCCATGTACATTCACCAAATCAA
CTTATTCTAGTTAAGGTGAGGCAAAGGTCTTTTCAGATTGTTGCTATTATATGGACACAG
TCTCAGTTTTTCACTTTTCAGGGGTAAAAATATTTATACTACATCTTCTACTTCTGCATT
TTCTTTAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGGGATCTCTTGATGGCTT
TTGTTTATTTTGATCAAAGCCATTGCGGTTACCTGCTTGAAAAGGATTTGGAAGAAATAC
TTTATACTCTTGGACTGCATCTTTCTCGGGCTCAGGTAATAATATCTTGTGAATTATTTG
AAGTGAAAAGCATTTTTAGTAACTACTGAAAAGCAGTAGAATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
TCATCCTTTTTATGGCTACGTAATATTTTTATGGTATAGATATACCATCATTGGCTTAAA
TTGGTCTTCTATTGCTGGATGGTTTCAGTTTTTTTGGAATGGTACAAGTTATGCTGTGTT
AAACATCCTTGTACATGTATTTTATGTATCTGTATTTCTATCTTTGTTACACTTTTTAAC
AATGAAACTTTTTTTCAAGTGACTCATTGGATCTTATCTTTAAAGAAAAGAGTTAAAATT
AAAAGCACAACTGCCATAATTGAGTGGGTGTGGATACCTGACACTCCTGCCTTTGCCTTC
CTTTATGGCGCCTTATTACACCCCCAGGAAATCTAGAACGTTACGCAGCATAGTTTGAAA
ACAGTTGCTATGAATGTTCATCGGTGCACATTAGACAGAGGCAAACAATGTTGTTTTAGG
AAAATAAAAAAAATTCTCATCTTTTTAATTTTATACTTTGAATTTTCATCTTTTTACTTT
GTTTACTTGCTGGCATTATAGGTAAAGAAGCTTCTTAATAAAGTAGTGCTCCGTGAATCT
TGCTTTTACCGGAAATTAACAGACACCTCGAAAGATGAAGAAAACCATGAGGAGTCTGAA
GCATTGCAAGAAGATATGCTAGGTTTGAGTCTATTATTTTAACATCTTGCTTTTTATAAA
TGTATTTCTTGTTAATTAAAGAAGAAAATATAACTTAGTAAAAATATGGTATCTTTTATA
TGTTTTAGGAAATAGGTTGTTACTTCCAACACCAACAGTAAAACAGGAATCAAAGGATGT
GGAAGAAAATGTTGGCCTCATTGTTTACAATGGTGCCATGGTGGATGTAGGAAGCCTCCT
GCAAAAATTAGAAAAGAGTGAAAAAGTAAGAGCCGAAGTAGAACAGAAGCTGCAGTTACT
AGAAGAAAAAACAGGTAAGGAACAACATTGGATGTTAGTACCCTATTGGGGTATATATGT
GCAAACACACATATATATGCCTTAGTTTTTAGTCTAGCTACATATGTAATTTTAGTTTTG
ACCATTTCTGTTTCAGGTTATAAAATTCCTTAGCTTTATAGGGATTAATTTTATGTCCTC
ATTTGCATTCTGAGGTTCCTATGTGGTTATATTGCATTCTTCTCAATCCTCATCTTGTTG
CACTTGGCTTTTACCAGTTTTTGGCACTTTCTTTAATCTATACAATCATCTAAAAATGGA
ACTTGAGTAAAAACAATGCTTAGTTGAAACTTAAAGGAGTGTTGTAAGTATGCTTTATGT
AACTCATGAAATAAACATTTATAGCCATTTTACGAAATTTTATTAGCTTTTTATTTTCCT
AGCTTAAATATTTTTTACCTCAAAGTTAAATTGGAAATTGTCGTGGAAAAAGTAAGTGAA
TTTTAGATTTTTTTTTTTTTAAACAGATGAAGATGAAAAAACCATATTAAACTTGGAGAA
TTCCAACAAAAGTCTTACTGGTGAACTCAGAGAAGTTAAAAAGGATCTTTAGTCAGTTAC
AAGAAAATTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACAACTGAATAAGAC
AATCAGAAACTTATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTTGTAAAATACACAAACCCAAGCTGTACAGAGTTGGGAGAGAGAT
TCCTTTCGTAGTTTACTATAGGGCCAATATTTTATAGACAGTAAAATGAGCTGTCTGTGG
AGTACCTCTGTTTACTTTTTTTTTTTTTTTTTAGTTATATTTAAGACTCTAACAAAATGG
ACTTTTTCTTGTCTATTGTTTTACAGGATAATGTGAAGAACGAAGATAAAGATCAGAAAT
CAAAAGAGAATGGTGCAAGCGTATGATAAAATATGTGCATTGATGAGGAATTGTGTTTAA
ATATGTAATATATAAAATCATGATACAATGGTGTTTGAAAGTGATGCATGTTTGATTTTA
GTGGTATAAATATCTGTTAGTTCAAAAGATGTATAAAGTTTTATGAATGTGAGAGTCTCT
GCTTTTCAAAATTGCCTGTAATTCCTAGCATTCAAATTATTAAACACTCCTTGAGTGAAA
TAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAG
TTCATCGGTTTAATTCACAGTAGTATTTAATTACCAAATGTCTTTTATTAAGATGTCTAG
AAAATTTAATTTTATTTATAGAATCATTGTTTTTAGGTTTTTATTTCAATTTTTTATCTT
TTAAAATTTCAGTGTAGGCCTCTGCTTCCACCAACATGGAGACTTTGTTGTACCAAGTCC
TGTTTTTATTGCTTGAATTCCCCAACCTGAAGGTGAAGAAGCTGCCCTGGGTGCACATGC
CGTTGGCTGTGACGGCGTGCACTCTGGTGGTGGTGTCTTACTTCCTCATAACCAGAGGAA
TAATATATGATGTTATTGTGGAACCTTCAAGTGTTGGCTCTATGACTGATAAACATGGGC
GTCAGAGGCCAGTAGCTTTCTTGGCCTACAGAGTAAATGGACAATGTATTATGGAAGGAT
TCGCATTCAGCTTCCTGTTTAGAATGGAAAGTTTAGACTTCATAATCATGGACCGATCCA
GTGCACCAAACATTCCAAAACCCAATAGATTTCTTCTTCTATTCATTGGATTTGTCTGTG
TCCTGTTGAGTTTTTTATGGCTAGAGTATTCATGAGAATGAAACTGATGGACCGTCTGAT
GGGTTAGAATACCCTTTGAGAAGAAATCAGTGGATACTGGATTTGCTCCTGTTAATGAAG
TTTTAAAGGCTGTACCAATCCTCAAATGTGAAATGTGGAAAAGGATGAAAAGCAGCAGAG
ACAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 1015..1075, 6791..6963, 7404..7448, 9278..9307, 11204..11397, 50535..50649, 50748..50940, 55616..55745, 55861..56022, 58783..59008, 59608..59657, 59660..59723, 60250..60416, 61196..61406, 62214..62297, 63600..63785, 64659..64850, 67919..68158, 71338..71449, 74450..74532, 74888..75034, 75981..76101, 76208..76393, 76886..76964, 76966..77023, 77026..77053, 77156..77193, 77486..77545
1001..1012, 1015..1075, 6791..6963, 7404..7448, 9278..9307, 11204..11397, 50535..50649, 50748..50940, 55616..55745, 55861..56022, 58783..59008, 59608..59657, 59660..59723, 60250..60416, 61196..61406, 62214..62297, 63600..63785, 64659..64850, 67919..68158, 71338..71449, 74450..74532, 74888..75034, 75981..76101, 76208..76393, 76886..76964, 76966..77023, 77026..77053, 77156..77193, 77486..77542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved