Loxodonta_africana Locus UBAP2L
snOPY snoRNA Orthological Gene Database
Loxodonta_africana UBAP2L
Loxodonta_africana
UBAP2L
GeneScaffold_3885
SNORA58
23941..24076
35933
TTTTGTTCTGTATGAAAGAGTTTTAAACAAGATTCCTTGCCTCCACTGTGATAACTCTG
GGTATATGACTGCTTGCTACTAAAAGGCAACCAATTCTGTACCTCCAAGTGCCCATCCCA
GATCACTTGCTTTTAATCTGATTTTCAGTGTTGTTACCACCTAGGTGGTAAAATTTTCTT
AGTCACACATTTCAAAGCACTTTAAGAGAGAAATGGAATTTAATAGGAAGATTATCAGGA
AGATTTTTATTTACTAGTCAATTATGTGGCTTTTGAGATGACTTTTTAACATATTTACAT
GTGATTGGGTACAGTATATGTTGCTGTCCCTACAGTTTATATCTGCATTATAATGCATTC
TCCAGAATTGAAATCACGTGGAGTAGAAAGCAGTCAATATTTGGGTTGAGTGGGAAATGG
CTATTTCCATATTAGAAACTTATAGGACTAATTTTAAAGTATAACAGTTTTTCTCCAGTC
TTAAAATTTTTTCTCTTTTTGGATTCGGATCCCGGAAGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATCCTTGGGACCAGATGCCTGTTTAAGAGGTTTGATCTTAA
TCTTCTATTGTGAACGACTTTGTTGATACCATTTTACAGCAATTTTGAGCAGTTGTGGCA
TCTAGGAATGAGAAAATTGATGGTGTGTTGAAACCTGTGTGTTTCAGGTTTTGAATATTT
CATGCTTTAATTGTTTGATGGTTTTATGAATACTTTTGAACCCCTAGCCCCAAACCAGAG
GTGATTTTGAGAGTAGAATACCAAAAGGCTACATATCTTACTTTTAAAGTCTGGTTCTTT
TAAACTGCTTTATCTTCTCCCTTTTCTTTTCATCTAGTTTCTGTTGGGGGCGGGGGCCCG
TGCAAGATTGCTTATGATGGTTGCTGATCTTTCTCTTTCAGTTGATCGATATCACAGGCA
AGAACCAAGATGAATGTGTGATTGCTTTGCATGACTGCAACGGAGATGTCAACAGAGCCA
TTAATGTACTGCTGGAAGGAAACCCAGACACGGTAGAGTGCTAATAAAGGGTTTTAGAAA
GTGGGTTTCCATTTGGGAAGTTAGTAATATTCTAGAAGTAGCAAATGGGGTAACTCAATA
GAGTACCTTATTCTCCAAGTAGAGCAGGGAATTTTGATGGAGATTGTTTGCTGCAGGCTG
CAAATAGTAAAAACTTATGTACAATGCATCCCCTTCATGGAGATAACAGTAGTAGGAGAA
AACAGATGAAATCAGTCTGTTCTAATTGGCCTGGAATAAATTATTCATTCCAGGCGAGTG
ACTGTTTTCAAGGCTGAGTTATTCTGAATTAGAGGTGCTATTTGATAGCCTTGGTTATTA
ATCGAGGAAGAATTCTGTTCATCTATTTTATCGCTATTGAACAAAGTTACAAACTGCTCC
TTTCTGAACTGAGGCACATGCCCTATCAATGTCAACTTAACATCTCACAATACCATTCCA
TTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATATTTTCTATGGACACTGCTCTGATAGTCTGTGTGTTGTTTTATATTTC
AGTTCGGGGTCAGGAAAACGGATTGGATGGTACCAAGAGTGGCGGGCCTTCTGGAAGGGG
CACAGAAAGAGGCAGAAGGGGCCGTGGCCGAGGCAGAGGTGATCAGTTTGGGGAGGAGGT
GGATACTGGGGGCAACATTCTTTTTTAAGTTCTTTTAGGGGTCTGCTTTATTTAAAATAA
ACTCAAATGGAGTCTGGTTACCTTAATTGTTGAGTTGATACTAGAGATTGCTGAACGGGA
AGTGGGAAGGAAGGTAGACATCATTTTTTTTTTTTTTTTATCTTTATTGCTGATATTACT
GTATTTGCTTGAAGACCCAACCATTTGTGCAACAAAGCATTGATCTGTTGACAGTAATGA
TTCTTCTGTGTTATCTGCTCTGCTATGTGGGCTGAGAGAGCACCTGATAGTATCAGTCAC
TTACCATTGCAGAGCTGCCTCATCTGGCTAGGTAGTTTTATATCAGGTTCTAAAATTACT
TCTCTCTCTTTTTCTTTAGGTGGCTCTGGTAGGCGAGGAGGAAGGTTTTCTGCTCAAGGA
ATGGGGTAAGTTACATAGACCTCATGTCAAAGTCTCCCTGCCCCACCAAGAATCACCATA
TCTTAAAGTGGCTAATATTTTAGTATCCTGAGGATAATAAGGCAGCCTTAGCCAAATTGT
GATCAGAAAGATTTCTAGACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
GGAAAACTTAGAGAGAAAGAGAAGGCTTATGAAGTTTGCTAGTGTTGAACTCAAATGTTT
CACTCTAAAAGCCTTGTGCTCTTTTATATGCCACATGGCTGCCCATCAGCTCCAAGTGTC
TTCTGTAGTGGTTCCGTAAGTGTAGCTTTGCCTTTGAAAAGATATACAGGAAATTAAGCT
ACTACTTGTAGAGAGGAACAGGGCCCAGAATCAAAGCCCACTGTCAGTTTATTTGTTTTT
GGATACCAAAGATAGGGATATGTTTTTCTCCTTTCATTTTTGGGAAATCTCAGTATCTGG
GCAAGAAAGAAGTCGCTAGGCTTTTTAGTTCCCTTTGTTGGACAGCTTTCTGGGTGTGGT
GGAGCATCATTAAGGGATTTAAACCAGATTGCTTTTTTGTTAGCTGATTTGGTGTCTGCC
TCCTGGGCAGGGTGTAGATGTTTAAGGATATGTTAGGCTCTTGTGATAGGCCAATATGTG
TTTGGGTAAAAGATGTGTGTGTTGCTTTAGATAAAAGCAGCCTGTAAGCTCTAGAGTGCT
TTCTTGTGAGATTAACGACCTCCTTCTGGCCGAGCCAGCACATAGAGAGCCTGAGGCTTT
TTTCCCTGATAAAGAAAGGGGGATGAGTTAATAGCAGGGCCTGAAATAAGCTTTTTGGCT
CCTTATCCATTTCGTTTTGCCTTGCCCCCTTTCAAAGATCCGTGAGCTTTATCTCTGGTT
CTTCAGGAGGATCTTTGGCACAAAGAGCTCATCCACTGCTTACAGGATGTTATACCTCAG
GTCTTAAATGTTGCCTACTTTGTTCACCAAGCTGCCGTCTCCTAAACTCATTTTGAATAT
TTCCCATGGGTGGAGGCTGAAGTTGAGTTATGGCAAGATAAATATCTTGTCTAATTCTCC
TGACCATTTGGTTGTGAAGTGTCCTGTTTCTGTTTTAAGTTACCATGCTTGGAGGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAACAGTGGTATCACCAGAGAGAGAAGAATGTGGTCTATAACTGTCT
ATAGACTGACACTGGACTTGTTTGAGAACGTAGTCATTAGGTAGTTTGGATTTCCCTGGT
TCAGTTTTTTTGTTTGTTTGTTTTCCTGGTAAAATTTTAATATGATCCTAGGAACATCAG
TACAAAGAATATATTTTCATTAGGGAATTAAGCTTCTTATTGTTGAATCTTTAGAAGAAT
TACAGAAGGATTTTGTAGTTGTTACAGATTTTGGTTTTATTTTTCAAGAGTTAATTTAAT
GAATATAGTTGAAGAAAAGGGGATGTTCTTGGTCCTTCTATAGACAGATTCTTATTTCTT
CCTGTGGGTCCCTTTAGCTGAAGGGGAGAATCTTGGGTCCCAAATTCTTTAAGAAAGGGC
GGTTTCCCTAAATATTCATACACACGTAGCAAAAAAAGGGAAATGTGGAAGGTGGTTTGA
TTGTTTATGGATCTCTCCTGTAGAGACACCATCCCAAAGTGAGAGTGAACTCCTCCATTG
TCTCTGCTGTGACATTGGCAGGACAGATTTCACCATCGGTATGATTAGAATTAAGATGAT
AACTTTATTTTTGATTTTTCAGTCTGGTCTAGCGGTTTCCAAAGAGACTAGATGTATAGG
GGCTTTCCTTACAGCTGTCACCTAGCTAAACCAGTAAGATCTATAAACTCAATTCGTGGG
TATACATTTTTTATTCAATTCCAATAGCAGGTAGTTCTCAGTGCCCTCAGTTTGGGTTTC
AAGCGCTTTCTTTACTGCCCTTTTACTAACCATCATGTGGCATCCCTTGGTGTTCCTCTA
TCACTGCTGCCATCTTTCTTCCTACTGCCTGCAGTTTTGTCTTATACAAAATAAGTAGGT
ATAGTTCGCATGTTCTGATTTAAATTGGCTGCTGCCATTTCACTAATTGTGAGGGCTGAG
GGCATTAAAGAGATTGCCTGGGGTGCTGGGCCTTTTTTTTTTTTTCCCCTTGTTACAGCT
GTGTAACAAAACCTAAAGATAGGTATAATCTTCTTAAAACCCTGGTGCTCTGAGGTATCC
CTTCCTAAGGGTTTTTTCCCTCCCTCTGAAGCCCAAGAATCCCTTCTGATTACTGTACTA
AATTGTGGTCACACTTTTGGCTGCCAACCCCAAATGTTAATACGTTAATGTGTTCTGCAC
ACGCTTTGTACTGGCATATGAAATTACTTCACTGTTTTCTTTATTCCCAGGTGCATGGAG
GACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTCTCTTTTTCTTTTTTGTCCAG
CACATATACTGACCTGCCTGTAAATTCATTATGTCTATGACGTGACTCTGTTATATCTTA
TGGGGTTCCTTGGTTCCAGCTTCTCACTGGATAAAATCATTAAGCACGTGTAGAAGAGGC
TTAGAAAGGCAATTCATTCAGCGTTATTTAGGATAGATAGTTTCACTTCTTAGGAATTTC
CCTTTTTCTTGATACTGAATTCCCCTTACCCCTGCCAGGTTTCTAAATGTAGCCTGCCTG
ACACTGGGAGTGACTAATTTCTGTTTTCCAGCTTTCTGAGACCAAGATATTCACTGCCTC
TAATGTGTCTTCGGTGCCTCTGCCCGCGGAGAATGTGACAATCACCGCTGGTCAGAGGTA
AGCGTGCGGTGAAATCAGTACCTTATCCCTGAGGGACCGGCTGAGATAGCTGTAAGGAAG
ACTGGCACTGGGCATTTACAGACTTCTATTATGTTGATTAATAATGATAACCAAATCACA
CTGGGTTCTCTTTAGTTGATTGATAGATTTATGAGTTGCTACTATTCAGTCTATTTAATG
GAGGTATATATGTTAAAATTTTTGAAACTGCTTTTTCCTAAAATGGTTCTTTATTTATAT
AGGTAAGCCTGTCAGCATCAATGGCATTGGTTAAAACTTAGCATAGTATAATTTGTTTTG
TAATAAGTGAGGTAAAGAAGAGCCAAAAATGGAAGTCTTTTAGTTTATTTCTGAATTTTA
TAGAACTGTTTGATAGCTGCTTCTCTTGTTTTATAGTCATGGCCTTTGTCCACTGAGCCC
ACCGAGTAGAGTGATTTTTTTTCCCTTGGATTGTCAGGATCCAGCTAATAAACTTTAGAA
TTTGAACCTTGGTATTGGGGTCAGTGGTGGGAGATCTACTCTTCAGGAATGTCTTTATCC
CTTGCGAGCCCCTTGGATCACTTCTAGACCTGGGCATGGTAGCTCTTGACTCAGAAGGTC
CTAAAAACAATTGTGATAGATTAGGTGTTAGGGATGTCGTTATCACAGGTCACCTGAATT
TTATGATAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAAACATTTAAAATAATTATTGT
GGTTGGCAGCATCAATGGAACTCAACTAGATACTACAGTAGCTCTTAGACATCATTTATA
TTGATAAATTAAGCATTTCTGGACTTCGTGTTTTTTCAGTCTGCTTAGAGGAAGTACCGG
AAAGTGCTTTGTTTTGTTGTAACCGTAGTCTGAATGAGGTGTGAGGAAGACGGGAATGTC
AGTCATCATTCCTCAGGGCCTCTCTCCCTTCCCACTAGAATCGACCTTGCCGTTCTCCTG
GGAAAGACACCGAGTTCGATAGAGAACGATTCATCTAATCTGGATCCATCTCAGGCTCCT
TCTCTGGCCCAGCCTCTGGTGTTCAGTAACTCGAAGCAGAGTGCCATATCACAGCCTGCG
TCGGGGAACACGTTTTCTCATCACAGCATGGTAAGTAGAAACTTGGTTTAGCCTAAGCAA
GCCTGCCTTCTCTCAAAAACACATCCACACACATGCATTCGAATTCATTTCTTCCAAGGA
CAGTCAAAGGTTTGAGTCGGGGCCAAATACCCTTTGTGCTTCTAGCAGCCTTGAGTGTAG
AAATGTTAAGTTGGGTAGTAGGTGATAGCTCTAGGGGAGGAATTGGCTTCAGACGGACAG
AATTTTAATAAAAATGAGTTAATGTAGTATTTTGAATACCCTTTATACTGAATACTGGTA
TTACTCAGAGGCGTCAACTTGTCATCAAATTCCAGTCCTTTTGTAGGCCTAATTAAACTT
TAATGGGAGGTAGTAGCATTTCCTCATTTTTTGATGGAATAGAAATTGCCGTATATGTTT
ACTTAAACCAGTATTTCTAGACTGGGCTTTTAAAACCCTGGGGTCTTCCTGAATCTGCCA
CTTATTAACTGTGTCTCCATTTCTCTGTCTGTACATGGGGATAAATATGCTTGCTCTGCC
TATCTTGCAGGGCTTTAGAAGATAAGATGATGGATATGGGCTATAGGAATGTGACAGTAG
TGGTATTTATTAAGAACCTAAAGCACTGATGGCATGTGACTTGTTGATTCAGAATATTAA
AAAAATCCAAGGTTTTTAACCACAGCAAAGGAATCGTTTAAGCTAAACAGAAAGATGCAA
AGACTAATTTACCGTCTTACAGTCGGGAAACCTAAGAAGTACTGCTGTTTCTTTTTTTTT
TTTTTTTTCCTCTTTTAGTTTAATTTCCCTGTCTGTCTCTTTTTGGAGGAATACTGTAGT
TCTGAGAAGTAAGAGACCATGCATGCATATAGTTGTATTTTAAGGTTATAGGATGTATTT
TAACTAGAAACACTACTGAGGTAGCCTGTAACCCACAACTGTCAGTTTTTAACTATTAAT
TTGATAGTAAATTGGTGGTTGATTATTTTGCCACCTATGAATGGTGACAGGTGACAAAAG
GCAGGGGAGAAGGGAAAGGGAGAGGAGCGTTGAGATTAAAAAGAAAGGAGCAAAATGGGA
CAAAAGTTGTAAGGTGTACCGAAGATCAGGGAATAACTACTAACTTCTGAGATACGTGAC
TGGAAAACGTAGTTAAATGTTCTGTGTTTTTTATAATTGACTTCTTACTGTTTGAAGTTG
TGAAGACTTAAAATCAAATCCAATTTCTAGTATCAAAAATATATCCATAACATACTTCTG
CTTTATCTTAACATTCTATTTAACGCATGCCATGTGGTGTGTTAACTAAATAACTATTCC
GTTGTTAATCACTGTGCTATTTAATGTAGTTTCTTTACCAGTGAGAATAAACTGTTAAGA
GGATTAATTTCTCACCTTGGTGGTGCAGTGGTAGAAATCTTGCCTCTTATGTGGGTTTCA
TTCCTGGCTGGTGCATTTCTTGGGCAGCTGACACCTGTCTCCGTGGAGGCTTGTGTTCTG
CTGGGATGCCAATCAGGTTTCAGTGGAGCTTCCAGACTAAGATGGACTAGGAAGAAAGGC
CTGGCAATCTACATCTGAAAATCACCCAACAAAAACACCATGGATCACAATGGTCTGAAC
CGCAACCAATCATGAGGATGGTGCAGTACTGGGCAGCATTTCGGGCTGTTGTGTATGGGG
TCTCCCTGAGTTGGGGGCCAAGCTGATGGCAGCTAAGAACAGCAGAATTTAGTAGAGCTA
AATAATATAGGAGTTTCCCTATTTATTTTCGTTTCTAATAAGTGGATATTAGATCATCAT
CACTATACCTTTGATACAATGCTTTGTACTTGCAGAGTATTTGATAATTAGCTATGTGAA
AGCATCTCTCTGCCATAATTCCTCACTTTCAACCAGACCTCTGGGTTTTGTTTAATGTTA
TTTTGTTTGTTTAATCCTGGGATAGAAACTGAAGTGGAAAAAATAACTTGAGTTTGACAG
ACTGGCTTTGTATTAGAAAGCACTGCTTGATGATGATGATGATGTAAGATTAAATAGGTA
CCCATGGAAGACTAGATTGCATCTTCCTTAGAGGTCTTGTAGAATAGTTCGAGACACATG
GCTCATGTTCTAGACTAGGCTGATAGCTTTACTTGGTAATGGGGAATAAGGAAAAACCTC
AAAAAACATTAAAAGCTGCCTGCTTATTATGTAGTGATTGCCTTCTAGAACTTGGAAACA
CACAGAGAAAACAATCAAATCATGTCAACTTGTTATTTGGTTGTCTAGTTCAGAAGTTAG
GGGGCCCTTTAACTTTTATATGATCAAATATTGATTGGTTTAAAAATTTAAAAGGAAAAT
CAAACCTCCAGTCATTCAAGCTTTATCTCTGAGAAGCAGAGAGAAGGAAGGGCCTGTGAT
TTCATAGGTTTTATGGTTCTCATTTTTCTGAGTGTTCAATACATGCCAGGCACGTATTAA
GTGCTTCATATGCATTATCTGTTTAGTCCTTCTACAACGTCATGGGTACTACTTTTATTC
CTGTTTTCAGCAGAGGAAACTGAGGCACAGAGAGATTAAAAGAAAATTTTCCAAGGTTAT
ACAGGCAGGATTTGAATCCAGACAGCCTGACTGCAGAGCTTATATGTGCTAATGGACTGT
GCCGCATATTCAGTTATTTTTTTATCTGTCTACACTCTCTCACTCTGGATAAGTGTCTTT
CTGAGTAGGTGAACAAAGTGGCTGGCTGTAGATCTCTAATTCCTATGTTGATCTACAGGT
GAGCATGTTAGGGAAAGGATTTGGTGACGTCGGCGAGGCTAAAGGTGGCAGCACCACGGG
CTCCCAGTTCTTGGAGCAATTCAAGACTGCTCAGGCCCTGGCTCAGCTGGCAGCTCAGCA
TTCTCAATCTGGAAGCACCACCACCTCCTCTTGGGACATGGGCTCGACCACACAGTCCTC
GTCGCTGGTGCAGTATGGTGAGAAGGATGGAATGTGACTTGAATTCTTCAAGCATTAGAG
TATTACTGTCAATGACAGAGACTGAAGAATATGTCCTAACGTGAGGAGACGGGCAGCCAA
CTGGCTGGTTTCCCACACTGATTCCTCCTAGCTAGATAGACTGTGTCCGGAAAGTTGGGG
AATGTTAAAAATTTGAAGCTATATGCCTCTGTCTCATCATATTTAGCCATACACATAATT
GTAGTCTTCTGTTGACGTTTGAATTTTTGGATTCTTTTTAGATTTATTTTTCAGTGTTTA
AAAATAACATTGCCTTTGGAAGAGTTCATGAGTTTGGCCATTATAAGACCTTACATTTTC
AGCAGGGGCAATTTTTAGATAGCTATCTTCGATTTGATTGACTTAAGAACAAATAAATGA
TCCTGGAGTTTCATTAGCACCTCTGGCCTCATGCATACTGGGTTTTCTCTTGCAGATTTG
AAGAACCCAAATGATTCAACAGTGCATAGCCCATTTACAAAGCGCCAGGCCTTCACCCCA
TCTTCAACTATGATGGAGGTGTTCCTTCAGGAGAAGCCAGCTGCAGTGGCTACCTCCACA
GCTGCACCTCCACCCCCCTCTTCTCCTCTGCCAAGCAAATCCACCTCGGCTCCACAGATG
TCTCCTGGATCTTCAGATAACCAGTCCTCCAGCCCACAGCCGGCTCAGCAAAAACTAAAA
CAGCAAAAGAAAAAAGCCTCCTTGACTTCTAAGGTACTTGAACTTTGACATATTAAGGCA
AGAAGATGTAGGAATTGAGAATTTGTGAAGTTACAGTGTGGAAGTTTGAAGGGAAGTTTT
TTATTAGTCTGAAGTCTTATTTTCCCTGTTCCTTCTCCTTTCTCTTTCCTATAGATTCCT
GCTCTGGCTGTGGAGATGCCTGGCTCAGCAGATATCTCAGGGCTAAACCTGCAGTTTGGG
GCATTGCAGTTTGGGTCAGAGCCTGTCCTTTCTGATTATGAGTCCACCCCCACCACGAGC
GCCTCTTCGAGCCAGGCTCCAAGTAGCCTGTATACCAGCACAGCCAGGTAGGGGAAACAT
CAGCCATGAGATGTCTTTTTATTAGGCTTTTATCATTTTTTCTAAGTCTCTTGTTGATTT
TTAGAATACTGGAGAGACTAAGCTTCTGAGTGGTTGAGGGGAAGGTAGCCACTTAGGATT
TTGTTGACCACTTCAAAGTATATTAGGGTTATCTGTAAGTCTGAATAAATAGAAACATAC
CCTTTGCCTACTTTTAGAATGTTTAAGCCCAGTTCTGAAAGATATGTACAGTCCCTCTGA
CCGAGAGGACTTTGCATTTGCCACAGCTAAAAATGCTATTGGCACTTAATTCACCCCAGA
CTCATGCCTGTGAAGACTGTAACTTTGAACTCCTAGGAAGGAGGAGGTAGCGTTGATATA
TTACATGGATAAAAAGGAACTTCACTAGTAGAGCCTTTCCTACTTCCTCTGGTAGCAGGG
AGGGCCGTCTTAAGCAAAAGAAAATACTGGAGGAATTTCAAGGGAATAGCCTGATCTTTT
CAATCCTGGACTCTACCCTGGAGCTATTAAATCAAAATTGCAATCAAAGCTTTTGAGTTT
TTAAGAAGTTCCTCTCAGGAGAGTTCTACCAGTAACCTTAAATCTAATAGGGTTTTCAAG
AGAAGCCCGGAGCTCAAAATTCCTTAAAATGAGTGTGAGCAAAAGTTGACTCTCATGCTC
AGGGTTCATGTTATGTTGAGAAAGGGAGCTAGAGCAGTGTGTCCTTCCACTGACCTTTAG
CCCATTTTTCTTGTAATAGCAGAATGTAAGGGAATGACATGTTTTTCTGTACCTTTAAGG
GGTGAAGGTGTTTTTAAACTCCATTCTTTATTTAAACCCCTGGTGCTATAAGATGTGGAC
ATTTTATTTGCTGCTGGAGAAATTCTTACATATCGTAATCAGCTCATTCCAGTAGTAGAT
CTCCACTGTTAGCTTTGTATCAGTGGATCTGCTCTATTGCATTTCTCTGAGATTTTCCTT
CTCTCCATTCCCGACAGTGAATCTTCATCCACAATTTCATCTAACCAGAGTCAGGAGTCT
GGTTACCAGAGCGGCCCAATTCAGTCGACAACCTATACCTCCCAAAATAGTGCTCAGGGC
CCGCTATATGAACAGAGATCCACGCAGACTCGGCGGTACCCCAGCTCCATTTCTTCATCA
CCCCAAAAGGACCTGACTCAGGCAAAGGTAGTGGCATCCTGAGCCCCTCCCTGGGCATTG
GTTAGGAAGATAGTGGGCAGCATCCCTTAGTATTGTTTATTTGTTGGCAAATGCTGCTAA
GAAACCTCAAAACACTGGAAAAAAAAAAAAAAGCACCTTTTTGGTTGGTGAAATAAAGGT
TCTTTTCTGCAAGCCTGGAGGTTCAGAACCAGAAAACCATTCTTTTTGCACTAAAGATTC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATCTGATGGCTAGACC
TCTGGGTGCATATCAGTAGACCTCACCTTGCTGTGTCTTGGTATGGTGAGGGGGACAGCA
TATGCCAGAGGAGATGTGGAGTGACTGCCAGATACAGCCAGCAGAATAGGTGGTTTGGCT
GAACTGTCTTACTCCCACAGCCTCCCCCAGGGACCACTGGATTTGGACTTTGGGCCTTTC
TTACATCTGTCTTGGGTTTGGGATGTCTTCAGCAGCTTGCGGGGTTGGTTGCCTTCTGTC
GCCTTGGGTCACTCAGGGCTGGTCTACTTTGATTTGCTGATTTTGTTGTTTTTATTTTTT
ATTAATTTTATTTTTTATTATATTGTTCCTTTGGATAGTCTGCATTGTGTTAATCCTCTG
GTTAACTTGCAGTTTCTTTGAAAGGTTTATTGACCGAAATTAGGCTCAGTTAGTGCTTAA
TCTGCCATGTTTACTTGAGTTTCTCTGTTTCTTGTACCAGAATGGCTTCAGTTCTGTGCA
GGCCACGCAGTTACAGACCACGCAATCCGTTGAAGGTGAGTGTTCTCCAGGCTTTTTCCT
CTCAAAGTGTTTTTTCCTCCTCCCTCAATATTTTTGCATTTCTTAGATTGTAGTGAAAGA
GCTTCTGGCTCAATGAGCAGAACATCTGATTGTAGTCTTAGTTTGGTTCTACCTTGCTGT
TCAATCTTAAACCACCCTGAGTTTCATGTTCTCTACCTTTAAACAGCGATAATTGCTTTG
GCTGTCTCCATTGGACAAATGAGAGCAGTGCTGTGAAATGCCTGGACTTTTCTTTAAAAA
AAAAAAGAGATTCTACCTAAACACAAATGGTCCACTATTAAATAACTCACCCTTGTCTTT
GGGGAAAACTTGAACCATAGCTTTTTCTTCACTTCTTATGTGAGACGGTCCATTTCTTCT
GATGGAGTGAATTCCGTTCTTCTCTATTTCCAGGTGCTACGGGCTCTGCAGTGAAATCTG
ACTCGCCTTCCACTTCTAGCATCCCTCCTCTCAATGAAACGGTATCTGCAGCTTCCTTAC
TGACGACAACCAATCAGCACTCATCCTCCTTGGGTGGCTTGAGCCATAGTGAGGAGATTC
CAAATACTACCACCACACAACATAGCAGGTGATTTGGGGTGAGGATGGAGGTTGGGGTTG
GTGAGTAGTAGTAACAGAGCTCTCTGGTTCTGTCTTATTCCGTCTACTTGGCAGAGACCA
CATTAGCCCTGCTTTTGTGGTAAGTGAGTGAGACAAAAGATGTGGGAAGCAAAGGCAGAG
AAGGCTTATTTTCCCTTTTCAGTATCCACTCTAACTGCTTACTACCCCTGGCTGGCCATT
GTGCTTACCAAATGATCTCAGGCCTCCTTGGCCCCATTTTCTGCCTTTTTTCCTTGCATG
CGTTCCTCACTGAAGCTCTAGCTCAGGTAGATAACTGTATCCTATGGCTGATGGCAACTT
CTTTTCCTTGTAGCACGTTATCTACTCAGCAGAATACCCTTTCCTCATCAACATCTTCTG
GGCGCACTTCGACATCCACTCTTTTGGTAAGTCTAATGCTGTAAAAGAGGATATGTGGTT
TTCTTACATTTAGTAGCTATTCTAACCACGCAGTTCTCCCAAGAAGGGGTTCTTGGAGAT
TTCTTCATGAGGCGGCAAAATGATAATTGATCTGAGATTGCAGGAAAGGAGCAAATTGTG
TAGCGGGAGCCAAGAGAGGCAGAAAAATCTAGAAATATTGCAGAGCTGTGATGCATTCCC
AAAAGCCCTGAAAGTGACTTCTGAGTCTTTTTTTTCCCCCCACTAAAGATGGGTAGGGCT
CTGTATGCTGTGATAAATTCTGTACCAACACACTTTTCTGCCTTTCTCATTTTTCAGTGT
AGGGTTTGTGGTATCAGGTTTGCCAGGAGCCTGGGGGAAGATACCAGAGCTTAGGTTCTT
CAGGAGCCTCTCTTTCCTCAAATATACTATGTCAGGCTTAAAACCATTAGAATTTGTTTT
TTTGTTTTTTTCTCTGGCCCATGAACTTGTGTCTTGGGCTGTGCTGGTGAAGAAAAGTGG
GAGAGAAGGCTATGATGATAACGTTTAGATCTCAGCTATCCCTGTCTCCTTACCGGCCAC
TACACCCTCAAAAAGCACAGTGTTGGTTTCTGGGATTTGTGTCCACGTCCTCTGCTACCC
TCTGAACAGGATGATGATGTGAAGTGGGCCTCTGTTACCGGGCTTACCAAATCAACCTTG
AATATGGAACTGAAGACTATTCAGTAATTCCTTCCAACTCCTTTGGCAGAGGACGCCTTA
ATACTCTACCTTGGCCTTTTTAATTGGGAAGTTGCCAGGATGATAAATTAATCAGCAGAA
GGGATTGTTTTATGTTTGCTGACCTGTGATGCTAATTGTGGTTTCCTTCTTCCCTCCCCT
ATGCATCCCCCTTTTTGAAGCACACAAGTGTGGAGAGTGAGGCGAATCTCCATTCTTCCT
CCAGCACTTTCTCCACCACGTCCAGCACAGTCTCTGCACCTCCCCCAGTGGTCAGTGTCT
CCTCCAGTCTCAATAGTGGCAGTAGTCTGGGCCTCAGCCTAGGCAGCAACTCCACAGTCA
CAGCCTCGACTCGAAGCTCAGTTGCTACGACTTCAGGTAGCCCTGAGTGGAAGGGGGATG
CCATTCCTCTGGGGTAGGGGAGAGAAGTAATTGTGTGACAGGATCAAAATGTAATTTCTG
TTTTAGGAAAAGCGCCTCCCAACCTCCCTCCTGGGGTCCCGCCGTTGTTGCCTAATCCAT
ATATTATGGCTCCCGGGCTGTTACATGCCTACCCGGTAAGCGGAGCTGAACGGTCTCCAC
CCAAAGATGATGGTGGGGGCTACTCTTTTTATATCTCTGTTTCAGGTGGAGAACTGTAGT
TAAGATAAAGTATAAATGAGTGGTTGCCACATGTTAGCAAATAGATTTTTAATCTTTGTA
GTTTTGGCAAAAACAACAGTTTTTGGGAAGGAAGGACTAAACTGAGAGTAGGCTCTCTAT
TGTGTATCTGCTCTGGGCTTCAGAAGTCAAGGCCCAGAATGTTTGCCTGACATCCTTTCA
GTTTCTTAGAGGGTTATTGTCTCAAGTTGGGTTGATTCTCTAACTCGGAGAGTCTTTGCT
GGCTCGAACCTGGTCCAAGCAGAGTTCTCTGACTCAGCCTGGGACTGGTCTGAGATTGGG
TAGCTGACATAGTAGTACCTTTTGGTATCGTCTTTCAGCTTCGTGTATTTAGTGTCTATT
ATGACAAATGGTGTTTTTGGAAAAAATTTTAAAAGACACCTGTTGCCCTCAGAGAGTGTC
TAGATGGGTGTCATTACAGATGAAACATCCAGGTGACGTTTTTACACGTATTTTTAACAA
CAGCAAATTACCTTGGTACCCATATGTTGTGAATAAACAAGCAAAATGTGAATCCTTTCT
GGAGCAGATCAGTTTTAAGCCAGATTTTGACAGAAATTGGTAGGCTAGAGAAGAAAGCAG
GATGTTCACGTGTGACCATGTCTGCCTCATTGCTGCCCAAAGACCAGCTAGTTGAGTCTG
TAGTAGTAGTTTAACAAAAGCTTTAAGACCTCTCACAAATCACTTAATTGTTTTGTCCTT
CACTTCTTCCCTCTTAAAGGAATTTGGAGGAAATAATCTATGTCCTGTTCTTCCTAAGAA
TGAAGGATGAATGAGTCACTGATTTATCTTGCCTCTTAGTGTCTTGGCTTGGCTGTCATC
CTGACCAGCCCCCATTAATATTGTTAAATCTCTGTGTCTTTTAGCCACAAGTATATGGTT
ACGATGACTTGCAGATGCTTCAGACAAGATTTCCTTTGGTGAGTATGTGGGGGTAAAGCT
TTGAAAAGAAAGATCTCAAAAATTAGTGTTGGGGAGTATTATCGCACATGTTCGGTTAAT
AAGTCACAGACTTAGCTCTTTTCCAGTCCATCTCTCCATATGTATGTTTTGACTTAGGAT
ATATCAAAATGTAGGGGGTTAGAGAAGGGTGAATTTTTAGTAAATAAAGGCTAACCTAAT
TTATGGCCCTATGGAGTACTGTAGAGTTCTCAGGATACATTGTATATGTTTCACAAACTT
TGAATTCCAATAAGAAAGATCTCTTTGCTCAGTAGAATAAGTTTGACTTAGACTACTAGA
GATATCATCTAGAGGATTGAGGATACTACTGGTCCTGATGGACCTTGATGTACTCTTCAG
CGGGCATACTCGTAGACCTTGCTTGACTGTGCTCATGGCCAGGCAGGGGGGACAGTGTAT
GCAAGAGTAATTTGGAGTTTATGCCAGCTCTGGCCAGCTTCATCAGTGGCTGGATAAATT
GCAGTACTCCGACATTCTCCTGCTTCTCCCCCTGTGGAGTTAATTGTGGTGGGGAATGAG
TGGCATTGAGTCTCTGCCCTTTTATTTCTCTCTTTAGGATTACTACAGCATCCCATTCCC
CACACCCACCACTCCGCTGACCGGGAGGGATGGTAGCCTGGCCAGCAACCCTTATTCTGG
TAGGACTTGAATGGGGCTGAACAAAGGGAGGTTGTGTTGGGATTGTTGACAGAAACCTGA
TTAGTAGCAGGAGGGGACCCGATTCTCACCTTTATTTAGATCTTTGGTGGAAGTAGAAAA
TGGATGTGGTGCATCAGGGTTGATAGATTCATAATCCTGTTAAAGATGAGCATGTGGCAG
CTTTTTCCTTCTCATCCCACTTTTTTTTTATTGTCTCCCTGTTATTTCCAGATGATGACT
GGACTTAGTTTTCCCAGCCATTCTCCAGCTTTTCCCAGGAAGCACAGTGGCTGACCTGGT
CTTTTTGTGCTCATCTCTACCCCTGTGCCCTACTCACAGTGGCAGTCTCATTGCTAGGCC
TTGGGCCTTCTTTTTCTGCCTGACTTATCTGTAATTGTTCTCATTGACGTGTCATTTTCC
CTAATCTGTCATTGTCCTTCATTACCTTTCCTGGTCATATTTCTGACACCTGTATGGTTA
TTTCTCTCATAATAGCAATTGTAAACTTTTTTTTTAATGCTCAATGTTTCCTCCAGTCTC
AGGAGTTCATGGGTGGTGCAAACAGTTAACATGCTTGGCTGCTAAACAGAAGGTTGGAGG
TTCGAGTCTACCCAGAAGTGCCTTTGAAGAAAGGCCTGGCAATCTACTTCCATACAACCA
GCTGTTAAAAACCCTGTGGGGCACAGTTCTGTTGTGACACACATGGGGTCTCTGTGAGTC
GGAATTGACTCTCAGAAATTGTTTTTACATACACAAGGATCCTTGGTGGTACAGTGGTTA
AGCACTTGGCTGCTAGCCAAAAAATCAGCAGTTCGAACCCACCAACCGCTCCACGGGAGA
AAGACGTGGCAGTCTGCATCCGTGAAGATTGTAGCCTTGGAAACCCTGTGAAGCAGTTCT
CCTTACTCTGCCCTGTCAGGTTGCTATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTTTTTTTTTTTTTTTTCAGTGTGTGTGTGTGTGTGTGTGTGTGTATATAA
CACACATACCTCCTCCCCAAAAAATATATGTATGTGTGTGTGTGTATATACATGTTTACA
TATCTGTATACTGCCATCCTCGTTAGTATAGTGATGAGTGTCCCCGCCTGTCGCACGAGA
GAGCGGAGTTTGATTTCCTGATGTGGAGAGCTGAGGTCGACATTGTTTGGAGCCCTGGTG
GCCTGATGGTTAAGAAATTGGCTGCTAACCAAAAGGTCGGCAGTTTGAATCCACCAGCCA
CTCCTTGCAAACTTTATAGGGCAGATCTACCCTGTCCTACAGGGTCTGTGAGTTGGAATT
GACTCAACGGCAGCAGGTTTGGTTTTGGTTTTGTATGTGTATACTTACGTCATGTGTGTG
TATGTGTACATATATAACGTTTTAGAGTTTATAAAATCTTTTCACATCAGTTGTCTCATT
TTGAGAAAGGGAGAGGTTTATTTTGCCTCTCTATTTTCTCATTCTTGGAAATTCAGGAGA
CAGCTGTTACATGTCTCAAAAGGCCTACTGTTGTAAAAAAAATTGCCTTATAATTTCCCA
AGTCCATCCATCATGGGGTATTCCCTGTGAAGGATGGGAAGGAGTAAGGTTGGCAATGCC
ACAGCATTGCATAGTTATTCAGCATTCATCTTGGATTAGCACTCTGGTAAGTGTATGCTG
AGCAATGCTAAGTGTAGCAGCAAAGACGTGTAATTCTAGGGATTGAACTTTAACAGTCTT
TAAATTGAATCTCCTGGACTCATATAAAACCAGAAGAGGTAATTCCACATTGGTCTGGGG
GGTGAAAGACGCAGATGCATTGAGCCTCTCCTATCACAGGTGACCTCACAAAGTTCGGCC
GTGGAGATGCCTCCTCCCCAGCCCCGGCCACAACCTTGGCCCAACCCCAACAGAACCAGA
CGCAGACTCACCACACCACGCAGCAGACATTCCTGAATCCGGCGCTGCCTCCTGGCTACA
GTTACACCAGCCTGCCATACTACACAGGGGTCCCGGGCCTCCCCAGCACCTTCCAGTATG
GGCCTGCTGTGTTTCCTGTGAGTACCTGGCCTTGCTGTCTCCTTATGGTGGAGACCCATA
GCCCTGGACACTAGCCTAGCTACTTTCAAAGCTAGGTGACTCTTCAGTAATGGATGAGAA
GGAACTGTTTCCACCTCTGACCTGTTTCTGGCCTGGGAGAGGGACTGGGGCTGGGATTGG
TGGAATTAGGATGGCGATTACCTGTTTTTAGAACTGGCCAAGTGGGGAACGTGATACCGT
ACAGCTTTGCTTCCCTTATACTCCTTCATTCTCTGCTACCACTGTCCCTCTCCCTTCTTC
CAGACTTTTTTGTTTTTATCTCATTGGTAGATTCTTGAATTCTCAGTGGGGAGTGTATTC
ACTAAGCATCAAGATAGGTAGCCATCTGAATGCTCAGTTCCTGAAGTAGGGTGGTGGGGC
AGGTGGTAGGTACCCTGCCGTCATTTCACTGTAGTTCTGGCCTTTGCCCTACAGGTGGCT
CCTACCTCTTCCAAGCAGCATGGTGTGAATGTCAGTGTGAATGCATCGGCCACTCCTTTC
CAACAGCCAAGTGGATATGGGTCTCATGGATACAACACTGGTAAGCCGACCTTGGCCCTG
GCTGTCAGTGGTGTCTCTAGGTTAATAATCAGAAGAGTTTCAGGGGAGGAAGACTTGGTG
CTTAAGAAAATGGGGTTGATGTGGGTGTGCTGTTCTTTGTATGATTGTTAATACTTGACT
GAATCGAGCATCTGTCCGAACAGCACCAACAGAAGAGTTTGATGGATGTATTTTCTGAAA
AAAGGATTAAGTGGGTTCTTATTTAGCAGGCTGATAGGTTTGGCTTAACTATCTTTGTAT
TACAGCTTTTCTCCTGCGGCTCCTTTTTGATTCCTTAGCTAGAAGACCTAACGTGGAAAG
AAAGGAGGAGGCGTGACTTCCTCAGTAGAGTGAAAGTTGGGCTGGTAGAGTTGGACCATT
AGTGGTTCCCTCATTTGTATGGCTGGTCTCCTCTGCAAAGCCCATTTGTACATCTGATGG
CAAGGAGGGAAGCGCAGGAATCCTCTGAATAGGCACTTGACCTGAAATGTACTTTGCCTG
TCCTTGCTCCCATCCCTGACGTCAAAACTCCACTTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGAGTTTTCAGAGGTAGGAGACTAATAATATAAGTGAAGGCATATCTAATGGTC
GAAAAATCTGGTTTTTTTAATCTCCCTTAAGACGTCAGGAACCAGCTATAACAGCCCTTT
GAGAACCCCTAGTTCCCAACCCCCACAGAGGGCTCTTGTCATCCCATTCCTTACAACCTC
TAAATTCATTTATTTTTATGTATTTGATTCCTTTTAGGAAGAAAATATCCACCCCCTTAC
AAGCATTTCTGGACGGCTGAGAGCTAATTTGGCCCATGGCTGGGGGCTGTGTTTTGTGTG
TGTGTATAAATTTGCACTGAAGTCTTGTTTCAGAAAACAGACCACTGAGGAGAGCCTGCC
GAGCTGAGGCCATGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATACCTTCTGGGCTT
TTGAACTTGCCCCTCACCCGTTTCCCTCTCCCCCACGTGTCTGACCCTGTCTTACCCATT
TCGAGTTCAAGCGGTGCAGCACCTCCGAAGCATCAATGCACACACCTGCTGTTGCTTTTG
ATTTCTGGAAGGCATGTAGTTTCAACTTGTAACAAAAATAATTTGTAGTCTTCAATAAAC
TGTGGTATTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCATGTCTTTCTGGACAACAGG
AGGCAATGTTGTGCTGTGGATGAAGGGTGGAGGGTGGCCTTTTCCATCGAACCCCAGGAT
AGCCAAAGGACTGGTTAACTTTTCAGTCTGTGGTGATTTAGTAAGACTAGGGGGGTGGGA
GGGAAAGCAGCCTCAGTTTCCAGCCTGTTGATTGGTTGGTCAAGAAAGCGATTTATAGAA
AATCCTTGATTCCCCTTGCTTATTTTAATTTCTCATCACTTTTCCATTTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCATTAGTGACCAGCTAGTT
GATGACTTAGGTTCTGTGGAAACTGTGCTAGCTGGAACATGGTTCTTAGTCCCTTGATGG
CTTAATGGCTTTTGGGGCACTTATTAGTCATTTTGCACTTAGGAGTGTAGCTAAGGATGT
ATGGGAGAGGTTTGGTCAGACTCTTCTTGACTATGGGCATTTTAATCCCCACTCAGTCCA
ACTAGGACACTGTCAGCCCTTTGTTTACAGGGGTAACTTGGACAGTGAGACTCTCCCCCT
TGGTTAATTGGAAATCCAGGTATTTAGCTTTCCTTGGAGTGTCCTGTGGAGTGTACCCAA
CTTTCCCAGTGGCTGCCCTGCTAGGAGAGAGAGCTCTTGCTTCCTCTTGCTGTCATCCAC
AGTGTGTTGGTATGATCATCACTATTTGGGAATGGAGGATAGGCAGGGGATGTTGACGTT
GGGAGGAAAGCAAGAGGAGCTCTGTAGTCGGAGGATCTTTGCTTTATTTTTTAGCTTCTT
TAATGCTTACACTGAGGCTGTGCAGGCTACTACACAGAATATTCCCTTTTTTTCAGCATT
CCCAGTCCTTAAAACCCCATATCCAAGTTAGCGCCTCTGGACTATAAGCTGATTTTAGCT
AGCCAACCCACCTGGAAGGAATGAGACCGGGTAGGGGCACAATTGGAACGGAATTCTTCC
CGCCACCCAGCTTTAAAATCCAGCCAGCCATTTCCCTCATCCTGTATGGACAACCTAGCC
TCTGGGCAGAGGGCCACCAAGCGGCATCAGCAATCTGTTTGAGGCTCTGCACTAAATTGT
TATATCTTTTGGTTTGCCTTTGAGAGTTCTCTTTATTATACTATTTCACCTTCACTTCCA
GGTTCTCCACCAAAACCCTCATTAAGCTTAGCTTTTTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCTTTTCCTCAAGTTGTAG
TGAGGAGGTTTTTTTGTAAACATGCGAGTAGGTTAGAGCTTTTATCTCATGAAAAAGCTC
AAATTGTAAACTGAAAATGACATTTGGATTTTGTGTTCCACCTAGGCTGTAGGACATAGA
GGCTTCCTACGCCCCTTTCAAACGTCTCCACTCCCCAGTTGTGCTGAGGCTTAGATTGTG
TAAAAGGGAAGTCATCTTTGTGCCAACCTTTCAAATCATAAGTGTATAACCTAGCAGCTC
CAAGATTCTGGAAAAGCTGCGAGTGAAGCTGCTCTTGGGGTTTGTCTTAGTTCTCTAGTG
CTGCTATAACAGAAATACCACAAGTGGATGGGGTTGAATTGGACTGCTCCTGTAATATTT
ATCTGATGCTGTGGAGGCATGGATTTCAAGCCCCAAAGTGACTCTTCATGAAGAGCAAGA
CCACTCACGTCTTCAGGAACAGGACTGAATAGAATTTGGGTGGATTGATTTGAAATGAAT
ATTAAAAGTTGATTTCATACCTGTTAGGCTTTGGCACAGAAGTATTTTGAAAACTGTATA
TGCTAGTGAGGTTTGGCGATATCCCCTTTCCTCAAAAACACGACTCACTTCACTGTCACA
TACATACTCATGCCTGGAAGGGGCAGGAAAATACTCAGGGAGCTTTTCTGTCATGAGCTT
TTATCCCTCAGGACTGACCTGAAGCTGGAAAAACAAACCAAAATTCCCTTGCAGTAATAG
AGCTAGAGAGGCTGCAGACATCACCTCCTCCCAGGAATAGGGCCAGGCAGGAAGCTGAGC
TAATCCTCCTGTCTGTTTCCTCCTCCCTCAGGTGTATCAGTCACCTCCAGTAACACGGGC
GTGCCAGATATCTCGGGTTCTGTGTACTCCAAAACCCAGGTAGGTGCCTGGCTCTGACAG
AAGTGTGAAAAAAGAGAGATGGACTTAGATGAGGTAGAGTTTCAGTGAGAGAAGCTCAGT
GAACAAGAGCAACCCTAGGAGAAGGATTAGTCCAAAGGACTAATGGACCACAACTGCCAC
AGCCTCCACCAGACTGAGTCCAGCACAACTAGATGGTGCCTGGTTACCACCACTGACTGC
TCTGACAGGGATCACAATAGAGGGTCCCAGATATAGCTGGAGAAAAATGTAGAACAAAAT
TTTAACTCACACACACACACAAAAAAGACCAGACTTACTGAACTGACAGAGTGGAGAAAC
CCTGAGAGTATGCCCCCTGGAAACCCATTTGGCTCAATAATGAAGTCACTCCTGAGGTTT
ACCCTTCAGCCAAAGATTAGACAGGCCTATAAAACAAAACGAGATTAAATGGGCACACCA
GCCCAGGGGCAAGGACGAGAAGGCAGGAGGGGACAGGAAAGCTGGTAATGGGGAACCCCA
GGTTGAAAAGGGGAGAGTGTTGACCTGTCATGGGGTTGGGAACCAATGTCACAGAACAAT
ATGTGTACTAATTGTTTAATGAAAAGCTGTTTGTTCTGTAAACCTTCATGTAAATTACAG
TTTTAAAAAAAGCAACCCTAGGAGAAAACCAAAAAAAAAAAAAACCTGATGCCATCAAGT
TGATTCTGAGTCATAGTCATAGCGACCCTATAGGACAGGCTAGAACTACCCCATAGGGCT
TCCAAGTAGCAGCTGCTGGATTTGAACTGCCAGACCTTTTGATTAGCTGCCAAGCTCTTA
ACCACTGGGTCATCAGGGCTACAACCCTAGGAGAGGTGGCAGGACACCCATCCTACTAGA
AAATGACTGGTTTTCTCTAGACTTCGGTGCCTCTAAGGAGTTTTTAAATTTAGCCCGCCG
GAAAAAAAAAAATGTTATAGTAAGGCAAGTTGTGGCAGATTGTTGTGATGTGTCATGTGA
TTTACTGTCCTAGCCCTTTACCTCCCTGCTCCCAACCTTTCTCATAACTTTCTGAGAGAG
GGAGGATGGAATGAAGGGAAATTAGTTCATCTGTTCTTTGTGAGTAAATCTGTAACAAAG
AGTGGGAAAGCAGAAGCCCAGTAACTAAAGTGAGGCATTTGAATGATCCACAGGCTTGTT
TGTATAACTTGTGTTACTTTTACTGATAGAAAGTATTTGGGGGAGTGCTTCATGGCCAAG
GCCTTCAACCTTCATGTGTATTAGTTTCTTTTGAAATATCTAAGAAGTTCTGATTTTCAC
GTAGCTCCATGGTGGGGGAACTAAGAGTAGTCAGCAAATTTCAGCTTTCATCTGTGTCAT
TAGCTTTACAAAGTGCTTTCACGTTTATTCTCTCATTTGATCCTTACAACCGTGAGATCA
GTAGCATCCCTGTTTTATGTATCAGGAAACCGAGGCTGAGAGATTGAGTAACTTGCCCAG
GATCATTGAAGGGCAGAGCTGGGACTCAGACCCGAATAGCCGACTTTAGGTGCATGTTCC
TTCTATGATGCCACTGCTGCCTTCTGAAGGTGGGGAGCTGGGGCTTAGAAATGTCAAGGC
TTACTTTGCTGATCCCTTTTACTCTGTCTTTTCCCACCCTCCTGGATAGCAGTCCTTTGA
GAAACAAGGTTTTCATTCCGGTACTCCTGCTGCCTCCTTCAACTTGCCTTCAGCCCTAGG
AAGTGGGGGAGCCGCATCAATCCGGCCACAGCTGCTGCCTACCCACCTGCCCCCTTTATG
CACATTCTGACCCCCCATCAGCAGCCGCACTCCCAGATCCTTCACCATCACCTGCAGCAG
GATGGCCAGGTAATAGCAATTCCTCTTCTCTCCTTTCCCTTCCTCTTCCTTCCTATCCCT
TAAAACTGCCTTCCTTTTCCTTCTCTTACCCTTCTTCACCACCACCTTCACCCAGCCCTC
CCCAGTGCCAGCCATGGGCACACAGCACATACAGACACAAGCGCACATAACACGAGCGGC
CAGCAAAGGAGATGTCAGAGAAGGGGCCAGGTACCTTTTTTGCCCACTTCCTTTGGTGCC
TTTCTCCTCCACCTCCTCACATGACACAGTTGTCTTCATCCCATCAGACCTGGGTTACAC
CTCCCCTCCTGCCTCTCCCAGTCTTCCCCTTTCCCCTGACATTATAGCTTTCCCTTATGA
TGGTGGAGTTCTATTGTCAAAGTTTGTCCCTTTATTTTCCATATATCCTGGTTCTGCCTC
AGCTACCATATTTGCAGATGATTCTCTGTTGCCAGCGCCAGCAGGAGGAGCAGGTAATGA
AACTAAATGATGATATGCTTGAACCCACTCCTTTTCAGTCCCCATTTCACCTCCATAGCT
TCAGGGAACTTGAAGAGGAAATAGATTGCGCGGTCACAAGTCGGGATACACAAACACGGA
CACCTTGCTGAGCTCTCTGGCCTCCCATCCTGTGTCCTTTTCCCCTTCCTAATGCCCCTC
TTTCTTTTCTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCTCATTTCATCTTTCCGCCTATTT
AAAGGATGAAAGTGCCTTGCTTGTCAGAGAGGGCCTCTAACAGCTATGTAGAGCAGAACT
CCCCATGGCTGACAAGTGAACTTCCCTAGTAGTCTCTAAACAAGGGGCATGGGGGAGAGT
TCAAGACAACTTCCCATATCTCCACCTAAAGATGTCACAAATCTGTCCCACTAACTAGAC
ACCTTTTTCCTCTCCATGATCCTCCCATACCCCTGCAGACGGGCAGCGGGCAACGTAGCC
AGACCAGCTCCATCCCGCAGAAGCCCCAGACCAACAAGTCTGCCTACAACAGCTACAGTT
GGGGGGCCAACTGAGGCCCTGGCCCTCCTCTTCTCCCGGCCCCATCTTCTGAGAGGGCTC
CTCAGCCTGGCTACTATGGAAACAGCATCAAAGAGAGAAAGGAATGTGGGGGGGTTCCAC
CACCCCCCACCCCCAGCGGCCTACCCCATGCCTCAGCTTTATGTCTGTTCCATTCCCATA
CCATCCCCACTCTGTTGTATGTATTATAGGATTTGTATTTTTTCCTTTTGTTTTTTTTTT
TTCCTCTCTTCCTTTCCTCTTCCTCCTCCCCCCTTGCATTCAAGATTATGAAACTTTGCT
GTGGGCCCTGCCCTTCCTTCTCCTCCTCCTGTTCACCCTGGTGGTGTTTGGGTGAGGTGG
GAAGAGGGGGCCCCCAAATATATATCAGCCCAACAGCCCTAAGCCTCCTCCTTTATTATT
AGGAAAACAAAACAACAAAAAAATGGCGTCATGAATATGAACAGCATCGTCAGATGAATT
AGTTGAAGTGTTTTTTTGTTTTTGTTTTTTTTTTTTTTGTACTGTGTCCTCAAATTTAAT
GGATTAATGTGTCTTGTATATATAAAAAGAAAACCTCTACCTTCAGCCTCTGCCCATTCT
TGCTCCGTCTAGGATATCCTCAGTCTCGTCGATGACCGGCTTGGTGAATAAGTATTACCG
TACCAACTGGGCCTCCTCTAGCAGGCCCCGAAGGCAGTGGAATAAAATGAAATCTTTGCC
CTTTAAGAACTCCTCTGACCTTAATGTGCTAGTATCTTGCCCTTGAGGGAATTCCCTTCC
CTTCACCCCTAAGAATCTCATAGCCTGATGCCTGGGAAGAACCACCACAAGTCTTCATTT
TCTCCAGAAACTACATCTACAGCAGATTTCAGGCAATGAGGGGAAAAGACAGAGGAGATG
GGGGGGTGGAAAGGGTCTTAGAGGAGCTGAGACCATTTCAAAGAGGGAAATGGCATTGTG
GGGTCAAAGTATAACTTCAACAGGTCCAGGCAAATGAAAGAAGTGAGAGCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1111, 1715..1883, 3362..3457, 3859..3904, 5735..5847, 11210..11262, 12931..13017, 13021..13022, 14078..14249, 16978..17176, 17635..17912, 18054..18226, 19217..19406, 20200..20254, 20673..20847, 21193..21265, 22160..22355, 22446..22534, 23504..23557, 24157..24238, 26139..26356, 26814..26919, 31591..31658, 33289..33368, 33371..33488, 34838..34933
1001..1111, 1715..1883, 3362..3457, 3859..3904, 5735..5847, 11210..11262, 12931..13017, 13021..13022, 14078..14249, 16978..17176, 17635..17912, 18054..18226, 19217..19406, 20200..20254, 20673..20847, 21193..21265, 22160..22355, 22446..22534, 23504..23557, 24157..24238, 26139..26356, 26814..26919, 31591..31658, 33289..33368, 33371..33488, 34838..34930
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved