Loxodonta_africana Locus ENSLAFG00000015568
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000015568
Loxodonta_africana
ENSLAFG00000015568
GeneScaffold_378
SNORD70, SNORD70
1790..1878, 2878..2964
20335
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAAATGTAAGTGATCTTGA
AACTAAGAGTTTAGTAGTTAGTACTTAGAGCTTTTCTTAAGCATTGTTTTTCCTGATTTG
TATATTATTAAACTTGTAATTTTTTGTTTTGAAATCTGCTTAAAAACTAACATTGGTGTG
AAACTAATTATGAAAGATGTTTCATTTGGAACGGGCCATCAGCTAATTTCTGTTAGTTGC
TGACTAGATTGGGAATCACCCCATAATTGTTTTGTAAGATTTTTGAAAACACAAATTAAT
TGTGAATTACTAAGAGTGTCAAACTTAAAGAATCAGCATACTAAACAATTAGATAAATAA
AATACACAGATGATTGATCCAGTGTTTCTGGTAGCAAAATCTCAAAATTTTGAACAACCT
AAATGTCCATCAGTAGTAGAATGATGAATAAATTAATGTACAGATTTCTAGATGTCTTGT
TGACCTGGAGCAAGGGCCATGATATACTGAGAAAGCCAAGTTTCAGAATAATTTATGGAA
TGTGATTCCATTTTGCAGTGTCCTTGTATATATGCATATGCAGTTATATAAGTATAGAAA
GGTACGAACTAATGTCACTTTGGGAGAGTGGAAATGGCTATAGGGTAGGGTGAGATAAGA
TGAACTTACTGCTTTTCCTTGAATCTTTGTATTGGTAAGTATGTATCTTAAGGGTCCCCA
ATACTCCCCAGCACTTTCCTGACCATGGAAGAAAACCCTGCTTAAGATACACTGTTAAAG
GCAACTTTTTAAAGGTTATTTGGTTCATTCAGGTGGCCGAGTTAACCTGATTCATTGTTG
TCAATGATGTATTCTTGTCGGAACTGAGTCTAAATGATCTAACTTAAATATTCGTCACTA
CCACTGAGATGACAATGAATTCACTGTATGATTGTCTTAATACAAAATGATTCTCTAAAA
CCCTGCACATAAATATGTAGGGGAGAGAAAAAACCAAACCCATTGCTGTTGAGGTGATTC
TGACTTGTAGCAACCCTGTAGGACAGAGTGGAACTGCCCCATAGGGTTTCTAAGGAGTGG
CTGGTGGATTTGAACTGCCAGTCTTTTGGTTAGCAGTGGTAGCACTAAACCACTACGCCA
CCAGGGTTTCCATAATAAATGACTTTATAGGACAGAGTAGAATTGCCCCATAGGGTTTCC
AAGGCTGTAAATCTTTATGGGAGCAGGATGCCATACCTTTTTCCCCATAGAGCAGCTGGT
GGGTTCAGACTGCTGACCTCTCTGTTAGCAGCTGAGCACTTAACTACTGCACTACCAGGG
CTCCTTCTATAGGGGAGAAAGAGTAAAATAAGAGTAGCAACAATCAGATCTGAGAATGAC
ATATATACTAGGTAGACAAATGAGTATCATGAAATTCCTGACCTAGGAGGGACCCGTACT
TTTTCCTGGGCCAGGTCTGTGCAGTGTAGTAAAAAGTATCTGTGTTTGGTCATCTTTGCT
TGTGGTTTACATGTGGTAACAAACCTATTTGCGGTTGACCTTAGTTTCCTTCAAAGCCTA
CAACCTTCTCTATAATAGTCCAAACATTACTACCTCAACATTCAGAAAAACTAGTCATTT
TGTGAAGAATAGCTAACTCTTGCACCCTGACATCCAATAACAGGCAAGTTTCTTTTATTG
ATGTGTGCTCTTCCCCAGATATGTGGCTTTTGCAAAATCAGCATGTACCCATGACATGTT
TGTTTGTTTCATTCCAGAGTAAAGCTAAAACATTTTGAAAAATTTCAGGATACAGCAGAA
GCATTAGCAGGTAATGTAAAAATAAATAAAATAAAAATTAGAGGCTTTAAAAAGGGATCT
TGGCAATTTGTTTTCCTTATTCAAGGGTTGTTTGCTTCAGTTGTCTGAGTTAACCTTATT
CAATGTTGTCAATGATGCATTCTTGTTGGAACTGAATTTAAGTGATCTAACTCAAATTCG
TCACTACCACTGAGACAACATTGAGTTAGCTTTTTTCATCATAGGGTTGGTTGCCCCCCC
AGTGTGATGAGAGGTGAGAAGTGGTTAAGGTGATCTCCCTGTGGAAACCAACAGCATAAT
GCTGAAGTACAATTCAGTAAAAGCTGTTCTACAAGGGACCAAGTTAATGTGGTCAAGTTT
GCCGCTTTCTGATAATTTTAATGCAAGGGTGAAGTTTGAAAATATCCTGAATTCACAATT
GACCAGAAAGGGAGTTAGGGAAGTAATAAAGGTCAGGAGCATACATTTTTTTAATATGAA
AAAGCATATTCAGTATTATAAAAAGTTTTAGAAAAACATATAGTTTTGTTTTTAATGCAA
AAACTACAAGAAGGCCATAAGAGGTTTGCTGTCTGAAGGGGGGCTAGTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAACTTCTTGATGGTATAATTA
GAACATGAAGGACCACAAGGAAGAATATGGCTATGGATTTGGCAGATGCAAATATTTTGT
TCATTGGCCACTATTGAGAAAGGGTATGGTTGGTTCTCTTGGGAAAATTGAGGAGCCTAA
GTAAATAAGCTGGAATACTAATGGACACCCCAACCTGGACAGAGTTGTAGGTTAAGGGAG
GACCCAAGAATGGGGCCATTTAAAAAATATGTATTTATGGAGCTGCTTCATCAATAATTA
AGGATCATATAGCCATAAAGCGTATGACTATAGTAATTTTAATCTGAAGGTTTAGATAGA
GATCTGTTTATCACAGCCTTAAAGTTAAATAGGAGTAGAATTTTGGTAAAATCACAAGCA
AGAGTGTTTTAGTTCTGTACTGCACAATGTTGGGGGACATCACAAACTGTGACATGCGCA
GCTCCTGGAGTTGCAGGGTGCCACATCCGTGATGCCAAGGGTCCTCTTTTGAATTTCCTT
TTTGTATATACCCCCGTGTAATCTGTTTGAGATATTTCTGGCTGGTTCTTATTAAACTAT
TACTAAATGAGCAAGTCCAACTTTTATCCAGGCGTGAAACAGGTTTTTTGCTATTAATAG
TTAATATATGGGTCATGTAGTGATTGTCAGATACTTTCATAATTGTCTTATTTAACCCTT
GAGACAGTCCTGTGAGATAACTGTTGTCCTTATTTTGCAGATGATAAAAGTGAGGCTTAG
GGGTGTATCTGAATTTCCCTACCTAGCTTCACTGTTTTTTTTTTTTTTTCTTCTTCTTTG
AAATAATGTAAGATAAATGGTGAGAATGTTAACTAGGTGAGAATTTAAAGTCTCCCTTTC
CCTATTAGTCTAAGCTTCACGAGGGTGGAAACAGTTCTTCACTGTCATATCTCTAGGCTC
TAGCACAGTGCCTAGTCATAGAAGGTATCGTTTTGGGTAAATGAATGAAAGTAGTGAGCT
CTATCAGGAATCCAGTCATAGGAACCTCTACAGTACCTTTTCCTATCTGCTTTTACCATA
AAGTTGAATATCACCTTATTCTTAAGGGAACAGAGTCCTTTCCTGGAAATTTTCCTAATG
TCTATCATAACAGTTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTAGAA
TCCCTCCAGGCTGGCAGCATTATGAACACTGGCACTGGTTGTCTCTGCCTTCATTTTAAA
GCTGAGTGTCTCATGGATGTGGCTGGAATTTCCTGGAGATGGGCCCGCTTAGCGAAGCCC
CTCTTCTTCGTCAGAAGCAGAGCATTTTTTAAACATCACAGCCTTATAAAGAGTCTGATG
GGCTATGATATCGAGAATCTGTGTTGCCCTAGAAGTTCAAATACATCATTTGTGTGGAGA
GGTTTATTTTCACTCTTGATCACATTGGCAACTTGTGAGTCTTCTAAACAGCCTCAGTAA
AACTTGGGACCAACCTACATTTGGATGGAGTGGGAGGATTACTAGGGGATGTTGAAAAGT
TGCTGCAGAGACAAGTAGAAGAAAAACTGAGTGTCCCATTATCCCTGCTACCATCCCAAT
ATACTAGCCTTTATGAAGAGTATTAAGCCTTTCAATAAAGGGGAGATAAGTTTTTGTAAA
TATTAAGATAAACCTACATACAATTTTTTACTTTTAAGAAATTCATTTAAGGGAGAAAAC
CAGGTTAAAATGTAAAAGTAGGTGATATGGAAGATTGAGAAGAAGAAAGAAGCTGAATTA
AAATGCTTTTATAAATTATAAAAGAGGATTAAAAACTCTTAAGAATAAACGGAAGACACT
CAGTAGAAAGGTAGATTATAAGGAATCAATGTTGTATATAAAAATGAAAAAGATTAGAAT
CCAACAAAAGTAGCTTGAATCCTAGCTTCTTAGAGTATAGAGATCCTTGTAAGAGTTGTG
TGGTAGCCAGGGTCTTTTTGTCCTCACCTTTTATTTTCGCAAGGAACAGGTGGAATGGAT
TTACAATTCGAACAGAGGTAGGTCAGGAGAGCCGAGCAAGTACCTGGCCACTTTAGTACA
AACTGCTTGGCCTTACAAATTGTGTCAGACTGTCCTTCTTGCCAGGCATACTTTAGCCTT
AGCCAAAAGCTAGACAAATATCAGAAGACGTGTTAGTCCATGTAGGTCCAGAAGATGAAA
GTGTTATGACTGAGGAAGGGGGAGAATTACAAAGTAGAAAATTTCAGACTTCCCAAAATG
AAAGTGGTTCCACAAGAGAGTAGGCTAACTTGAAAGTATTTGGTAAGCAGGAGCCTAATA
CCGTGTCTGGATCAGGGATTAGCAAAGATGGGACATTAAAGGCCTCTACTCAGCCATGTT
TATTACCCTGTGGTGGATCCTTCAAATTGATTATACTTTGTTTTTTAACCAGAGTCTTGA
CATGGTTTTAGGATATTTCACAATCCAGAATGTCAGACCAGTCTCTGTGAAATTACATGG
CAGAATAAATCTGTTTGTTTACCAAAATAGATTGTTTTCAGGATTTCGTGATTCTAGCTC
TGAGTTCATGAGAAGAACCATGTGACATAGGGAGAGGAACCCTGGACCTGGTTCAACTCC
TGGCTCTGGGGCAGAAATAAGGGTGATTGTTGAGACGATCCGATGAAATTGCGAAAGCTG
TAACTTGTAAAACAGTTTTACATTTATTATGTCATTTCGGAAGTAAAGAAATGCTAAATC
AGTCCTTTTGAAAGGAAGCATTTGTTTTGTTTTTAAAAGAATTTAAGTGAGATTTTAAGC
TCTCACAATTGCTTTATTTTTCTTTTTCCGAAAAAGCATTCACAGCTCTGATGGAGGGCA
AAATCAATAAGCAGCTGAAAAAAGTTCTAAAGAAAATAGTAAAAGAAGCCCATGAACCCT
TGGCTGTAGCTGATGCTAAACTGGGAGGGGTCATTAAGGTAAGATCATGATTTTCTTTGA
TGCCTCCTAGTCAGATCTCACCAGCCTAGCCTTTGCAATAAGTTGTTTATGGTTTATTTT
TCTGTATTAGAAATTTCAAAGTAAAGTAATGTTGTCTCTCACTGAGTAAAATTTTAAAAT
TTTCTTAAATTCTTGTACTTGATCTTTTTTCTCTAGGCTTAAATAGTAATTGATTGCCAC
TAGGATTAGCAGACCAGGCACACATAAGAGATGCTTGTTTATTTTAGAAAATGCAGATAA
ATAAAAAAGATGATAAAATTAGCTTTAGCCCTGCCACCTAGAGAGACTCTGTTAACATTG
TGTATGTAATGCCAGTTTTTGGTCTAGCAACATTTTTTCTTCCTTCAGTAAAAATGAGGT
CATAACTTTGTTGTTGTTGAACATGTGTTTATTAGAAAATATTAGCAGAAGATGGAGTTG
ATAGAGGTAAAATGTGCAGTGAGAGTGAAAAGATGGAAAAGTAGGCTCCCGTGCTCAAAA
GGCAGAGCTGTGAGAGCTAGTTCTGGTAGGTTTGACCTTTAGTAGTTTCAGTGGTGTTGC
AGTGATGGTTAATTACTGTGTTCATGAACACACTCCTGATCCATGAAGTAAGGATTATAT
TATGCTGTAGGTCTTTTAAGGTTTAAAAAAAAAAAAGTGTTGGATTTGAGAACTTTTTTT
TTTTTTTAAAGGTAGAATGGTTAATTTAAGAAGTTCATTGGAATAGGTTATTATTTCTAA
TACTGCCCGATAGTCTGCTAGTTATCAGTCTCTGCATTTCACAAATCTTAGTTCATATTT
TTCTGTTAAGAATCTTAAATTTTAACCATGTTATGAATTGAGCAAACATTTTCAGCATCC
CAGGAACTGAAGCGTCATTCCACCTGGTGTTCCAGACTGAGCCTTGAGTATGCATTATGC
TCAAGAGAATGAAAACCTGTGAGAATGTGTAATAAACAGTACTGCTTTAGTGGGTGTGTA
CACACATGGTATAAACAGTCACAGAAGGATGTATTGCTGAATGGTGGGGTCACAGATGCT
CAAAGTTTTTTCTTTACAGTTTCTCTATTTAAAAACTTTTTTTTTTTTTTACAGTTATCA
CTTGTATAACATTTTGTTCTTAAACATGGTGCAATATGCACAATTTTACATGTTGTGTAT
GAGGGGAACTAGAACTATGAATGGAGATCTGTATGAAGTTAGCAAATACACTGTAAAGTA
AAATGAAGGTACACAGGACAAAATTTATTATCCCATTTGTGGGGGGGTGTATAAAAATTT
TAAACTTTTTAAAATAATTTTTATTGTGCTTTAAGTGAAAGTTTACAAATCAAGTCAGCC
TCTCACGTATAAACTTATATACCCCTTACTAAGTACTCCCACTTACTCTCCCCCTAGTGA
GTCAGCTGGGTCCCTCGTTCCAGTCACTCCTTTCGTGACCGTTAAACTTTTTTTATGGTG
TGTGTGTGTACACATATACACTAACGCATATATATAGTTGGAAGTATTTATAGGGTATTA
ATAGTTATTTATCTGTACGAAAAGGACCTAAGGCTTGGAACTTTGACTTCTCATTCAGTA
CCCTTTATAGTGCTATTGATTAGAATCTTACGTGTTTATAACTTTTATAATTTTAAAAAG
ACATTAACATGAGGTAGTAAAAGAGTCCCTCAAACTAACAAGAAAGCGTAAGACTACTAA
GTCAGATTGTATTTGTCTTTTTGTGACTTTTGATTCATGTAGCCAGGCTGCCTTCCAGAA
GCTTGCACCAATATTGACTTGGAATAGTATATTCAAGCATTCTTCATGATGAACAACTAA
AAACTATGCTTGCTTTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTGACCCACTCTGCGTTCTCATCTCCCCTCCAGTCAGGAGCTGCCCACATAGT
CTCATGTGTCTACTTGATCCAAGAAGTTCAGTCCTCACCAGTATCATTTTCTATCCTATA
GTCCAGTCCCAACCCTGTCTGAAGAGTTGGCTTTTGGAATGGTTCCAGTCTTGGGCTAAC
AGAAGGTCTGGGGGCCATGACCTCTGGGGTCCTTCTAGTCTCAGTCAGACCATTAAGTCT
GGTTTTAGGAGAATTTGGGGTCTGCAACCCACTGCTCTCCTGCTCCCTCAGGGGTTCTCT
GTCGTGTTCCCTGTCAGGGCAGTCATGGTTATAGCCGGGCACAGTCTAGTTCTTCTGGTC
TCAGGCTGATGTAGTCTGGTTTATGTGGCCCTTTCTCTCTCTTGGGCTCATAATTACCTT
GTGTCTTTGGTGTTCTTCATTCTCCTGTAGTCCAGGTGGGTTGAAACCAATTGATGCATC
TTAGATGGCTGCTTGCTAGTGTAAAAACTATGCTTTTAATCAAAGTGAAAAGATGCGTAT
ATTTAAATCAATGCTATTTTTAACATTTAAGAAATGGTTTCAAGAGAGCCTTTTATTTAA
TACAGATGTTCTTGTTCCTGTAGGAGAAGCTGAATCTCAGTTGTATCCATAGTCCCGTTG
TTAATGAACTTATGAGAGGAATCCGTTCACAGATGGATGGATTAATCCCTGGGGTAGAGC
CCCGTGAAATGGCAGCTATGTGTCTTGGACTGGCCCACAGGTGAGATTTGCTAAAAAATA
AAAGCAGCTGATTTAATAAACACAACACGGTTTTGAACATATTAAAAATGCTGATTTAAT
TCTTTTAACAACCTTATGAAGAAGTGGCAGTATTATCCTCATTTTATAGATGAGGAACTG
ATGCCCAAAGTCAATAAAGTGGTGGGTGGTGAAGCCAAAATTTGAATCCAGACATTCTGA
CTCCATTGCTTGGGATCTAAACTTTGTCATAGGAGTTTTTTGTCCGTTTGGTGTTGAGCC
TCAACACTGGTCTTTGTCTTAACTCTCTTTTTTGTTTCTCTTTTCTCTATTCAGTTCTCT
ATTCACTTCTTATCTCCCAGAATTTTCTCATTTGTTATGGTCTCTTTGTGTATGTATGTA
CTGTGATTTTTAATGAGTTTTTAGAATGAAACAAAGAGAAGTGCACTAACCTACCATGTT
TAATCAGACGTCTCTTAAAACTGGCATTTCTGCTGTATGTACTGTGACATGTGTTTCCGA
AAAGCTTGGCAGTCTGTGAAATTGTGTGCTAAAAATGGGTTATGAGGAAAAAACAGGATT
AAGGGTAGCAAGTCTTAGCAAAAAATGTTAGAAACATGTTGTTTATTTTAAAGAAATAAC
TATAGAAAGCAGAGGTCTGTGCCTTTAAACAAACGAAAAAGGTAAGCATAGACTAATGAA
AGGGTTGAAGCTGCTGAGTTACAGGGATGAGCAAAATGCACAACAATCAAGAACTTTGTA
ATAAGCATTTTTAGAGAAAAAATAGCTTAATTTAGTCAAGGTTGGAACCTGGGGTTAATG
GACATTTGTGTACACTAGTGGTTTTCTGTTAAGGATGATTTTTGTTGAATCGACTCGACA
GCACTGGGTTTTTTGTTGTTGTTGTTGTTTAGGTATTTGGCAATGTCTGGAGACATTTTT
GGTTGTCCCAGTTAGAGGGGCACGATACTAACAACTAGTGGGTAGGGACGAGGATGCTGC
TGAACATCCTATAATGCACAGGACAACAAAGAATTATCTGGCCCAAAAAGTCAATAGTGC
TGAGGTTAAGAAACTTAACATACAATATTGTTCCTCTATGGCTATTTGTTTTTAGGTGTT
AGAGTGCTGTGCTCTTTCTTACCTAATTGTATAAGGCATTAATGTGCTGTGTTTTTTTCT
TCACCAGGGAATGTATTATTTTTATTTCTTTTTTCTTTTTTATTATTGTACTTTAAATGA
AGTTTACAGAACAAACTAGCTTCTCGTTAAAAAATCAGTACAAATATTGTTTTGTGACAT
AGGTTAACAACTCCCCAACATGTCAACACCCTTCTCTTCTTGACCTTGGGTTCCATATTA
CCAGCTTTCCTGTCCCCTCCTGTCTTCTTGTCCTTGCCTCTGGGCTGCATAATGTGTTCT
TGTTCAACTGATTTTCCTACTTAGAAAACAGTGAAAGTAATACAATGTATTTCTGAGAGG
AATTTGAATAAAAAAAAAGTTTTTTTAAAGATGTAATAATTTAAATGCTTTTCTTAGGTG
TTATTTTACTGATTTATTTCTTCCCTTCTCCCCAGCCTTTCTAGATATAGATTGAAATTC
AGTGCTGATAAAGTGGATACAATGATTGTTCAGGCAATTTGTAAGTATCTATTTTTCTGT
TCCTCATGGGTTTTCTTCCTACTATTGAAACTTCTGTCTGTTAAAAAAGAGAAAGGAGAT
CAGCTAGAACTTTTAGTAAATAAAGTAGATAAATGGGAAAATGCCGTTAAAGGGAAGTTC
CGTAATTTGACTATTTGGAGACAGTGTCAGTGAGTCGCGCTTATTAACATTAGGTAAACA
GATTCCTTTGTCCTTTTTTTTGAAGCACGGTAAAGCCGTAAGTGGAATCGCTATAGTTTT
GTATTCTACTTTTTTTTCACTTGGTGTTATAATAGGTTATTCTCCCATGTTGTTAAACTT
ATTTGGAAGTGTCAGAGTCTAGTAATTTCCAGTTAAGATATCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCCTCATCCTCTGCAAACATTCCATAGGTGATAGGAAG
AACTTTGCCTCTGCCACGCTTTCTGAGTTACTGCCAGAAGAAGTTGAAGCAGAAGTGAAA
GCAGCTGCAGAGATCTCCATGGGAACAGAGGTTTCAGAAGAGGATATTTGCAACATTCTG
CATCTCTGCACTCAGGTAAATCGGTAACACAGAGAAAATAGTTGTGCTATGTAATACTAA
TTTTCTGATGGCAGTGATGATTTAATTGTTCACCTGAAATACAAATATGAGGGTGTACAG
TCACTACCTCATCTGATGCCATCTTGATTTTTATATTGGGAGGGGGTAAATATATATTAA
AACTCAGTTAGAAGAGTGTTATCTAAGTAATTATTTGTATTGTTAGCATTGTCTGAATAA
TGAGTTACCAAAATTGCATTAAGGCAGAGAGATGTGGCTTGGGTTATTTAATTCTGAGTT
TTATCGTATTTTTAGCCTGTAATGAGTTTTTTCTCTGGTTTGGAGACAAACATACCACAG
TCACAGGATGACACAAATGTCTAGCTCTTGGAGTTTTAAAAAAATACAGAAATATTGACC
AACATTTTTAGGCAGTGTACTGAGCGGTTTACATATCTTACCTATTGTCAGTGGTTTCTT
TCGTACATTGTCTAATTCTCACGAGAGCCCTCTGAGGGTATGTGCTTACCTTCACTTTAT
AGGAAACTGAGGTTAGGACTGGTTAATTTATCAAGGCTTGTCACACAGCTGCTCTGTGAT
AATTTAGGAGAGACGTTAATTTTATAAAATTTTTTTACCTGATAAGATGTTTATGACTTG
CTCATTTTGTTCCTCATACTAGGTGATCGAAATCTCAGAATATAGAACTCAGCTCTATGA
ATATCTACAAAATCGGATGATGGCTATCGCACCCAATGTTACAGTCATGGTTGGGGAATT
AGTTGGAGCCCGACTTATTGCTCATGCAGGTGATGGTTGTAATGTGATTTGTAAATATTG
ATCTTTAGAGATTGGCATTTTCTGGCTAGGATTTTTTAAAAATCTTTGAACATCATTTAT
TAAAGACATATTGGGTAATAGAAAGAGGGAGATGGTATATGGATGAGGACTAAGGACCAA
GTGTTGAATGATGATTTTTATTTGTTTGCCTGACTTCCTTTTGGATAATGAGGGCATCTT
TAGTCACTACCTCTTCTGAGACACTTATGGTCCATTGTCAGAAGTTTGTTATGGTTAATT
AGGATACTGAGATGAATGCAAGAGGATGAAATTTATTAGCATTTCATCAGATTAAGATTT
GAACACAGCTTTAAGAAACCACAACAGGTGATGTATACCCTTGAATGGGAAAGTTTCACT
ACTGAATATGCTATTTTCATTTATTAGACTTAAAAAATATTTTTGAATAACTGATTTATA
ATCAAATTTAATGCATGTGTATGGTGATATTGTAAATACGCATTGCTACAATAACATACT
ATATAATTGAATATCTGTAAATACAATGAAATACTAGTTTTTTTTTATATATTACTAGAG
ACATTATTGGTATTCATCACAGAAGATCTTACGTATCGTGTACTTCTAGATGAATCTTCT
TTCTCATTCAGATTTTGAAACAACAGGGCAAATAAAATATGGATAATTTATCACACAGCT
CTTCTAATACTGAGGTGCCCTAATAAGTTTTTATTTGTTGGTATATTTCTTTTTACCTAA
GCAGCAGAGTAGCTGGCATTCAAAATAAATCTCAGAAATGGGACTAGATTACTATGTGAA
AACATGTTTATATACTTAAACCATTTCTGTGATAATGCTAATGGAATTAGAATAGTAATA
ACGTGTCTCAGGCGAGTAGGTAAAATGAGCTAATAAACTTAACCTTCCAGTTTGTCCCAG
AAGTTCATCTCAACCATCTGCTTGTGGTAAAGAAGGAAGCACAAATGTTGGAGCACCAGG
ATTTTTAGTGAATTCTGCACTACAGAATCCTGTATTACTTCAGATTTTTATTTACTGTGG
TGACTGTGATACTTTTGTTTAATACATAGGACTTTCAAATACTCCTTAAACTACTTTTTT
TCTTCTGTAGGTTCTCTTTTGAATTTGGCCAAGCATGCAGCTTCTACAGTTCAGATTCTT
GGAGCAGAAAAAGCACTCTTCAGGGCTCTCAAGTCTAGGCGGGATACCCCTAAGTATGGT
CTCATTTATCATGCTTCACTTGTAGGCCAGACGAGTCCTAAACACAAAGGGAAGGTGAGT
TACAGTTTTTTCCTAAGCAACCCGTTTTCTTCCTCCTATAGTGTACAATAAATCTTTCTA
TTGTCCCTTTTTCATTAAATAGAGAATGAGGATTTTTTTTTTTTAGGTGAAAGTTTACAC
AGCAAATTAGTTTCCCATTCAACAAATTATACACAAAGTGTTCCATGATATTGGTTGCAG
TCTGCGCACTGTGTCAATACTCTCCCTATTTCTGCCCTGGGTTCCCATTCCCTTTTGGCT
GGTTTTCCTATCTCTGTCTGCCTTCTCATCCTTATTTTTGGGCAAATGTTGCCCTTTTGG
TCTCTTATAATTGTTTGTTCTATGGAGCACGTTCTTTTTTTTTTTTAATTGTGCTTTAAG
TGCAAGTTTACAAATCAAGTCAGTCTCTCATACAGAAACTTACGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTATCCATTCATCCATTGGTGGCACTTAGTTGT
TTCCATCTTTTGCTGTGTGCATAATGCTGCAGTGAACATGAGTATGCATTTATCTATTTG
TGTCACGGCTCTTATTTCTCTACGTTATGTACTAGGAGTGAGATTGCTGGATCATATGGT
ATTTCTATTTCTAGCTTTTTAAGTAAGTGCCATACCAATTTCCATAGTGGTTGTACCATT
TTACATTTCCACCAGCAATGTATAAGAGATCCAGTCTCCCCATAACCTGACCAGCGTTTG
TTGTTTTCTGTTTTTGTTTTAATTAGTGCCGTTGATGTTGGAGTGAGATGGTACCTCACG
GTAGTTCTAATTTGCGTCTCTCTATAAAAAAAAAAAAAATTTTTTTTTCTTTAATGGCTA
ATGATCACAAGTATTTATTCTTTCATGTGTTTGTTAGCTGCCTGAGTATATTCTTTGGAG
ATTTGTCTGTTCGTGTCCTTTGCCCACTTTTCAGTTGGATTATTTGTCTTTTTATTGTTG
AGGTTGTTGAAGTTTTCTGTATATTTTAGAGATTAACCCCTTGTCAGATAAGTTATAACT
GAAAATTTTTCCAGTCTGTAGGTTCTCGTTTTACTCTTTTGGAGAAGTCTTTTGATGAGC
ATAAGTGTTTAATTTTTAGGAGGTCCCATTTATCTAGTTTATCTTCTGCTGTTTATATTT
TTAGTTATGGTTAGTATACTACTTATGCCATGTATTAGGGCCACTAGGGTTGTCCCTATT
TCTTCTTCCATGATGTTAGTATTTAGGTCTTTGATTCATTTTGAGTTAGTTTTTGTGTCA
GATATGGGTCCTGTTTCATTATTCTACAGGTAGGTGCACAGTTTTGCCAGCACCCTTTGT
TAAAGACATCTCCCCGTTTAATGGACTTTGACCCTTTGTTGAAGATCAGCTGTCCATGGG
TGGATGGATTTCCTTCTGAGTTCTCAGTTCTTTTCCATTGGTCTATGTGTCTGTCCATGT
ACTCGTACCGGGCTGTTTATACTACCATGGCTGTGTAGAAGATTCTGAGACCAGGAAGTA
TGAGGCCTCCTTTGTTCTTCAGTGATGCTCTACTTATCCATGGCTTCTTTCCTTTCCATG
TAAAGTTTATGATTAGTTTTCCCCTCTTGTTAGAGAATGCTTTTGGAATTTGGATCAGGA
TTGCATTATATCTATAGCTTGCTTTGGGTAATAGTGACATTTTCACAATGCTGAGTCTTC
CTCTCTTTGAGCATGGTATGTTTTTCCATTTATATAGGCCATTTTTTGGTTTGATGACTT
CTTTAAATAAAAAGTACTTTTGGACACTGAAAGGGTTGGATGAAATTATTACTGGCCCTA
TTAAAAAGCCATTTTCTTTTGCTGCTTTAAAGTTCCTGTAAGTTCTGATATACAGGCTAG
TAGAAGGAGAGTAATTATGTCATGTTAAAAGCTGCATAATCTGAAAATCATCTGTAATTT
ATCTTCGAATTTTTTTTAGAACTCCGAAACCAGGCCAGAGTTAGTATTTGCTTGCATTTC
CTCCCTTCTCACCCCACAGTTGGAGAGAGTTGGTGGGGGGCACACCAAAAGCATTGTTGG
ACAGAAAAACCAATTTAACATCAACATTTAATAAATTATGAAGAGTAATAGCACAAGCAC
TGTTCTAAATACTTGGTGTGAATCATTTGCCTGAACCCTTTCAATAGCCCTGTGAGACCT
AGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTCTTGAGTGTGATTGGCCAACTTGAAAAAACTAATACCT
TTACATTTTAGAAACTGTTAGCCTTCATAAACTGCCCCAAAGCCACTAAAATGAAACAGC
ATTGTGTGCTTATGAAAGTATAATCTAATGACATTTTCTTTTGAGAATTATTCCCATTAC
ACAGATATTTGTAGAGATTTTCTAACTCTGGGTTTTCCAGTGAAGTGAAAACGTATGATC
CTTCTGGTGACTCCACACTGCCAACCTGTTCTAAAAAACGCAAGATAGAACAGGTAGACA
AAGACGAAGAAATTACAGAAAAGAAAGCTAAAAAAGCCAAGATTAAAATCAAAGGTTGGT
TTTTTAATTTTTCATGGCGTTTATACTCTTATTTAAGAATTACATAAGTCTTGGATGAGT
ACACACCATTGGCCTTTATTATGAAACAACCCATATGGAAAGCTAATGGTGTTTTAATAA
GCCATCATGTTCTCTGGGAATATTTAAGATAATATTAAATCTATTAGACTTCATAGGAAT
GTGAGAAGCATTTCTTCCAGTATGTGGAATTAAGCATTAGACTAAGTGTACCAAACTTCG
CTGTATTTTATAGTTCAGCTGGGATTAGTGAGAGTCCTGGAATGCATTACCAGACAGTGT
TAATTGCAGTGTCTTTATACTTACTCTATTCAGTTGAAGAAGAGGAAGAAGAAGAAGAAG
AAGTACTAGTGGTAGAAGAAGAGGAGAGCTCTGTGAAGAAGAAAAAGAAAAAGGATAAAA
AGAAACGTATTAAAGAAGAACCAGTTTCTGAGGAAGAACCATGCACCAGTGTAGCTGTTT
CTGTATGCTTGTTTTTAATTGCCAGTACTTTATTAGCATGGGCAGAGTCTCCATATTTAA
TCCACTCTGTATAATATACAGTGCCAAAAAATGAGTAGGCATTTGTTAAACGTGGTTTTC
ATTGATGGAGAGGTGAAAATAAAATAATTGCCTCATTGCACTTATATTTATAAATGGCCA
TTTCCCAGACCTGGAATGTTATCACAAAATGAGTTTCCTTTGGGAGATGGGAAGAATATG
ATTTGGTCCAGATTAGTTCCATGGGATGGCTTTTATAGATTCAGATTTTAATAAGTCTTA
AGAAGCATTTCTTATAAATCTTTACCCCCTAATTTGTTTTGAAAGGAAGTAAAGTAGATC
CAGTTTGCTTTTTATAAGAAAAAAATTGTTATCACTCACCCTTACAGTCACAACTCTTTC
AAAAGCATTCTTATTGGTTATTTTCAGAGTCCAGAGAAAAAGAAGAAAAAGAAAAAAAAG
AGAGAGGATGAGGACTAATGGTAAGGAACGGTAGTTGGATCGCCTGGAAACATCACTCTC
AAGATTCAGTCAGGAACATACCAGAGATGCCCACTAAAATATTGAGGGGAGGCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1005, 2717..2769, 6636..6757, 9323..9459, 11015..11079, 12084..12218, 12889..13034, 13702..13828, 14950..15113, 18523..18657, 18758..18819, 19120..19253, 19593..19741, 20187..20237
1001..1005, 2717..2769, 6636..6757, 9323..9459, 11015..11079, 12084..12218, 12889..13034, 13702..13828, 14950..15113, 18523..18657, 18758..18819, 19120..19253, 19593..19741, 20187..20234
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved