Loxodonta_africana Locus RC3H2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RC3H2
Loxodonta_africana
RC3H2
GeneScaffold_389
SNORD90
5544..5654
30220
TTTGGAATTTAGAAGTTGCAAGAATAACACAGTGAATTCCTGTATAACCTTTACCTACA
CTCACCACTCGTTTACATTTGGCCGTATTTATTATTCATTCTCTCTTTTTTGACTACTTG
AGAATGTGTTGCATACTTCTTTTTCTGTCTTAATACTTGTTTTTTGTGTATTTCCTAAGA
GCAGGATACTCTGTTATGTAAATAGCACACTACAGTCACCAAATTCGGGAAATTTAATGT
TGCTACAATAATCTGTAGTCTGATGTTCCAGTTTTGTCAGTTATCCCCAAAATGTATTTT
ATAGCATTACTTTATTTCACTATAAGTTCCAGTTCAAGATCATTTATTGCATATATTTGT
CATGTTTCTTTAGTCATCTTTAATCTGGAACCATTCTTTAGCCTTTCCTGATCTTTCATG
ACATCAAGAGTTTTGAATAATACAGGCCAGTTATTTTATAGAATATTCTTAATAATTTAG
GTTTTGCTGATGTTCTTTTATGATTAAATTGAGATTATACTGTACATCTCTGGCTGAAAA
AATGAAAGTCAAGCTAACACCTTCTCTAGGTATTGCATCCAGAGGCTAATGTTTAAAAAT
TATATACAAAATAGTTCTGACAGGCAAAGTAAGAGTCACATGCATAAAAATAATTACTGT
TTATTATAAGGCTACTTTGTATGTTATTTAATTGTCCAATTAGCTCACTTTAACATCATC
ATTATCTAATTTATTATTAATGCCTACAGAGATATTTTACGTTTTGTTGCCTTGTGTTCT
GATTGGTTGTTTAGTAGTAAGTATGTTTTCTTTCGCTTGATTACTTTTTAAGTAAACTGT
ATTTGTGTATGTGTGATGTCATCTTTTTGTGTTAAGTAAATACGAACTGTATGGGTAATG
GAACACCCTAAACTGATAACCTAAAGATGACGTTGACAGACATGCTCCACAGGGTTCCGC
ATTTATCGTGAACTGATGTTACCTACTTTAATATTTTAGCTATGCAAGAAGAGGCCTTGA
AACTGGTGTTGCTAGCGTTAGAAGATGGCTCCGCTCTCTCAAGGAAAGTTCTGGTACTTT
TTGTTGTGCAAAGACTGGAACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGCTGACTTAATTGTC
AAAATACTGCATAAGGGTGATATTTACTTTTGTAAACTTACCTTGTCCAATGTCTGGTTT
TCAACTTTATAGGCTTGGAGATTAGAATTTCGTGCGTGTGTGCAGTAGATTCTTTCCTCA
GGAATAGACTTACCCAAACTAAGGTCACAGACATCAGATTATCAGTTGCATTAATTTGTA
ATGTGAAATATAACTTAAATGACCAGAATTCTCACATTGGTAGATATTTTCCTGTAGAAG
AGTATCAAGCCTTTACTTGCTAAGCATAGGACAAGGGGAATTAACGATTCTGATATTTAG
TGCAGTGGTTCTCAACTGGATCACCTATGAAACTTCTAAAAGTATACATTCCTGGGCCCT
AATCCCCAGGGATTCTCATTTGTTATATATCTTAGGCTGGGTTCTCTAGAGAAGCAAAAC
CAATAAAGTGTATAAACATATACAGAGAGAGATTTATATCAAGGAAATGGCTCACGTGAT
TGTAGAGCCTGGAACGTCCCAAGTCCTTGGATCAGAATAGAGGCTTCTCCTGATTCACGT
AGCCACAGGGGTTGGAAAACTCAAGACTGGCAGGTTGGAGACCAGGATTCTTGCTCACAG
GTTGTGAAGATCAACAAATACCAAGACTGGCTGACAAGCTGATAGCCCAAATCCCAAGAA
CTGGAGGTCAGATGACTAGGAGTCAGCGCAGGATCCAGAGCGAGCAAAAGAGCCAGAATG
TCTGCTTATATTTGGGTGCAGACGACACCCCCAATGAAACTCCCTTTCAGCTGATTGGCT
GCTCATGCCAGATTCCATCGTGGTAGTGATCACATATAAACACTGAGAATCATGGCCCAG
CCAAGTTGACACACAATCTTAACCATCACAGTGTATCTAAAAGTATATATACTTTTTAAT
ACATGATCTTCAAATCCAGGGATTCTGACTCAGTAGATCTGAGATTGTATTTTTCAAAGC
TTCACAAGTGATTTTGATGCATATTATTGGAACTTTAGTAGAACCAGGCTCTATTAGCCA
CCTCTGTCCATCTTTATTACTCAGATGGGTAAATTCTTATGCTACCCGCAGGGCACTTTA
TACGTAGATGGTGCTTGAATGAGTGCTACCATCTTCTGGTTCTTTGGGTTTGTTTTTTCT
GTTTTTCAGGTTGATAATTCTACCTTTTGTTTCTTCAGGGTTACTTTAAGTAGTTAAAGT
GGAGCATAGATTTTTATGACAAGTATTAACCACACTCTACTCTTTCTTAACCAAAATGAT
ACCTAAGATTGCATTGATGAGAATTTTGGGTGTCTGAACCTCTTCTATAATATATTTATA
GATTACTAAAGAAAATTAATTACATCCATTGTGAACAGATACTATTAAGTTAACTCTTAG
ACGATAATTTGATTTCCCTATATTCATATTCTTGGGGGCATATTATTGTTGCTCTCATGT
GCCAACAACAGCAATAGAAAACAAACAGTGAGGTGGTGATGGTGGTAGTGGTGGGATAGT
TGGGATAGTTTCATTTTATAGATGCAGAAACTAAGTTTCAAATCATTTGAATGACTTGTC
CGTGGTGTTCTGAATCCTAACCAAGTTTCAGATTTCTCTATGGCCATTAGCAGTGAATGG
TTCAGGAATAAGTGTGTATCATCTGTTGTGGATGATACCTGCATGTTTGGATAATTAGAT
AATCTCATTAAAAAAAACCTGTTACGGCTGAGTCGATTCCAACTCATAGCAACCCTATAG
GACAGAGTAGAACTGCCCCATAAGGTTTCCAAGGAGCAGCTGGTAGATTCGATGTCCTGA
CCTTTTGGTTAGCAGCTGAGCTCTTAACCACTGTGCCACCAGGGATCCAGACAGCCTTAT
TTTAGGACATGTAAAACTCTCTAAATTTTGAATTTCTGTTTTTTTTAATCATGTGAGTCA
AGTATAGATTAAAACTGTATAAATATTCTAATGATAATTTAAGGGGTGGGAGAAAATGTT
TTAGTCATGTGATAGTGCTAATATATACCTACCAGATTGTCAGATTGCTTATCTGTCTCT
CAGTCTACCATTTACTGCTACCAAAGTGGTGTTTTTTAAAAACATAAATCTTATCTTGTC
ACTCCTTTTAAAAGTCCTCAGTGGCTCCTCATCCCCTTCAGGATGATACTCAAGGCCCTC
TTATGATTCCTTTCCAGCCTACATCTTAGGCTTTAACTGTCTGTACTCTCCTCTTTCTTG
CTTCTATTTCATGCACTTGCCACTCTTTAGAATTCTGTTCCTCACCTTCTTTGCCTGGGG
AATTCCTATTCCTCAAGGCTCAGTTTGTGTAGTCTTCAGCTGAGGGACAACTTTTTTGAT
ATCCCTCTCCTCCTTGATCAGTCAGCTTTAATTGCTTTTCCTCTGTGTTGCTGTAGCCTT
ATAATAGCACTTATACTGTAATTTTCTGTTCATAAGACTTTTCCTTACCAACTACTGTAC
TCATTAAAGGCAAGGACTATATATTTGGTTATATAAGTTCTGCTTCATTCCAAAAATAAT
TCGTAGTGAGGAAATTTTTATCTTTGCACTTTCTTTGTGTGGTGTCTGATAAGTGGTAGG
TACCCCACCCCCTAAAAAAATAAATGAATGAATTAGTTGAGGGGGCAGACAGAGCAGACC
ACTTCTGATTTTTTTTCCCTTTATTTTTTAGGTCACTAAAAGGGATGAAGACTCTTCCCT
GATGCAACTGAAGGAGGAATTTCGGAGTTATGAGGCATTACGCAGAGAACATGATGCCCA
GATTGTTCATATTGCTATGGAAGCAGGACTTCGTATTTCACCTGAGCAGTGGTCCTCACT
TCTATATGGTGACTTAGCACATAAATCACACATGCAGTCTATCATTGATAAGGTTTGTCA
AATTAGAGATGTTGACTTTATACCATTGCTGTTACATTGAAGAGAACTTGAATTTTCTAA
TGGAACTAAAGGAGACAGTTGGAGATGCCTACTTTTAAAAAATATTAGACTTATAAATTA
TCTTTTTTATTATTATTTTAACTTTCAAGATAAACTAAGGCAACAGGGAAGCAAATTCAG
AATATTAGAATAAAAGCAATGAGGCTTACTTACAAAGTCTGAGGGTTATCTACATTCCAA
CCCCAGAGAAATAATGTAGCTTATAAATAAGTTTTCTTAGTGTCTAATGATGAATTTCAT
AGGGCAGATTCTGAGGTGAAAATTTAATTCATCATTGATACTCCTACTATGGAATCTGAA
GACACTTGAAAACCTATTTAATGTTGACTAAATGAAATCATTTGATCAAAGATGCATCAT
AAGAACCAGAGTAAAAACCATTTTCCTTTCTGTTGGTTAGCTCCAGTCTCCAGAATCATT
TGCAAAGAGCGTCCAAGAATTGACAATTGTTTTACAACGAACAGGTGACCCAGCTAACTT
AAATAGACTGAGGCCTCATTTAGAGCTTCTTGCAAACATAGATCCTAACCCAGGTATGTG
GAAAAATGTTGTTTCTTATAAGTTTTCTACTTTCGAGTTTAATAACACAAGAGAATTATT
GCTAATAGATTCTCCTCCCAACCCCGTCTCCTTGGTGGCATATTTTAGATGCTGTTTCAC
CAACCTGGGAGCAGCTGGAAAATGCAATGGTAGCTGTTAAAACAGTGGTTCATGGGCTTG
TAGATTTCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATGAACGAGTGCACTACCTTGTGACGCTCATGAAAATGTTGTG
CAGTTTGGCGGTGTTTAAGTGTTTTATATGCATACCCTCCAGAACAAAATCCACTGCGTC
GAGTCCATCACCCAAATGAATTTGTTTGTAAATGTGTGGAATTTGAATTATCAAGATGCT
TTCAATGTACATTAGAAGGAGTTTTTTTTTTTTTTTTTTTTTAGCTATAACCCTTTATTC
TAGTAATAACATCCCTTTGTTGAATTACTACGAGCCAGTCACTACATTCAATATATATAT
ATATTTTATTAGCTTTAAGTGAAAGTTTACAGCTCATATTAGTTTCTCATACAAAAATTT
ATATATACATCGTTATGTGACCCTAGTTGCTCTCCCTATAATGTGACGGCACACTTTTTT
CCACCCTGGATTTCCTGTGTCCGTTCATTCAGCTTCTGTTCCTTTCTGCCTTCTCATCTC
GCCTCCAGACAGGCGGACAGGAGCTGCCCATTATAGCCTTATGTATCTACTTGAGCTAAG
AAGCACACTCCTCGTGAATATCATTTTGTGTCTTACAGTCCAGTCTAATCTTTGTCTGAG
GAGTTGGCTTCAGGAATGGTATTACTTCTGGGCTAACAGAGAGTCCGGGGGCCATGTCTT
CCGGGGTCCCTCCAGTCTTAGTCAGACCTTTAAGTCTGGTCTTTTTACTAGAATTTGAGT
TCTGTATCTCAATTTTCTCCTGGTACACGTCAGGGACTCTCTCTTGTGTTCCCTGTCGGG
GCAGTCATTGGTAGTAGCTGGGCTACATTCAGTATTTTACATTTATTATTTTCTAATCCT
CATAGCCATCTGCAAGGTAATTGCTGTTCCCAAACGGTAGTTTAATTAGGTTAAGTAACA
TATCTAAGGTCATTGGTAGTAAGTGACAGAGCTTGGATTGAATCTACTCCACATCTGTGA
CCTGTCCATTCTCCTGTCCTTATTCTATTAGAAGACATCATAATAGTCAAAAATTAACTG
AAAAATACATGTTTCCATTTTATTAGAGTCACAAAAGATAAAAATGACATTTTAGGTTTT
AATGTAACTTACAGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTTTTTTTTTTTTTTAATGCTTTTAAATTTTGTTGTTTTGTTATTAA
ATTTTAGACAGTAATAAGTTGATGAGAAAATGTTTTTATTTTGGGGGGCATTGTGTTGCT
TGAGAAATAAGTAGACATACATTTGAACCCAATTTCAGATAATCCTCAGAAGGAATATCT
AAAATGCCAACTGTAGTTTATACCACATACGTCACAACAGGGGTGCCATTCAAATGGAAT
AGTAGTTGTTTCAGTGCAAGAGTGACATTTCTAATATGAAAAAGAATTAAGAGTATAATC
ATGAAGTTCTGAAGTCTGAAGAGTGATTAACAACTAGAATCTTCAGTTTTTCATACATGC
GATGTTTTCCTTTTCATAGCCTCAGCCGAACAGTAAATACAAGACTAGCATGTGCCGAGA
CCTACGACAACAAGGCGGGTGTCCACGAGGAACAAATTGTACATTTGCCCATTCTCAGGA
AGAACTTGAGAAGTAAGTTATGAAAATTCTTTTTCATATGAGTTTAATTTTTGGTCGTTA
AGGAAGTGCCTTATGCAGTCTTAAAGTTTATGATGAGTTTGAAAGATGCAAGTAAATTCA
CATTGTAGAGTTCTTTAGACTGCAAAATAGCTTGTCTTTTTTTTTTTTATTGAAACCACA
GCTTATTGCTTATGGGAGCAAGATGAACATGATAAATTATTTAAAACTTTATTTAAAGGT
CACGTCTTGAGACTAGCTTATAGTGGGGATCCCTGTGTCTACTAAGCATCTGTGCATAAC
AAAAACACCCTTCTGTGCACACTTTATTTGGTCAGAGTCAGTTGAAAGCAAAGTTCCAGA
GAAAATGGTAAAGCAGATACTTTTTTTTTTTTTTTAATGGACTTTAATCTTTTTAACGTT
CTTTTCTGCTGTGTATTTCTTTTTTCTTTCTTTTATAGATGACCCTCTTTTCTATGTCCA
TTTACCCCCGGATAATAAAAGTAAAGGGGTGTAAGCTATATTGCACATTGTCAAAATTTT
AATTGTTTTGCTTTTTAACCAACGCATTCACCATTGAGACCTAACCCCCCCGCCAAAAAA
AATTGATCTGAACCTTTCTTCTGAAAAACCAACCTGCATATTACATCCTTATTGGGCGTT
TCCATTTTGCTAGTGGGCACTTTAAACTCCAATTAAGCTAATTTTCTCCTCCCATACTTT
TTCTCTTCCACTTGTCATTCTGCCATCCCCCATTGTGTCCTGTCCAGCCATTTATACGTG
CCATGTTTTGGGAGTCATCTTTCTCAGTTTTCCTTCATCTGCTTGTCTTAATCAGTCACC
AAAGTTCTACCATTTCACCTTCCTATATATTTCTTAGATCATTCAAACAGAACAAGGGGA
TACTGTGTAGTTAAAGTCAGGAAAGGTGTGTGTCAGGGTTGTATCCGTTCACCATATTTA
TTAGACTGTATGCTGAGCAAATAATCCAAGAAGCTGGACTGTATGAAGAAGAACAGGGCA
ACAGGATTGGAGGAAGACTAATTAAGAACCTGCGTTATACAAATGATACAACCTTGCTTG
TGGAAAGTGATGAGGACTTGAATCACTTACTGATAAAGATCAAAGACTACAGCCTTCAGT
ATGGATTACACCTCAACACAAAGAAAATGAAAATCCTCACAACTGCACCAGTAAGCAACA
TCATGATAAATGCAGAAAAGATTGAAGTTGCCAGGATTTCATTTTACATGGATCTACAGT
CAGCACCCAGGGAAGCAGCAGTCAAGAAATCAAACAACACATTGCTTGGGCAAGTCTGCT
GCAGAAGACCTCTTTAAAGTGTTGAAAAGCAAAGGTGTCACTTTAAGGACTAATGTGCAC
GTGACCTAAGCCATGTTGTTTTCAATTGCCTTATGTGCATGGGAAAGCTAGACAGTGAAT
AAGGAAGACCTAAGAAGAAAAGAAGAAATGATGCCTTTAAGTTGTGGTGTTGGTGAAGAA
TATTGAATATACCATGGACTGTGTCTTGGATTGAATTGTGTCCCCCCAAAATATATGTCA
ACTTGGTTAGGCCATGATTCCCAGTAAAGTCTGGCTGATCTACATTTTGTGATTGTAATT
TTATGTTAAAGAGGATTAGGGTGGGATTGTAACACCCTCTAATAAACACCTCCCCTGAAC
CAGTGAAACGGCAGTTTCCCTGTGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACTTTTTATCTTACAAGAGATGAAAGGAAAGCAAGCAGAGAGTGGGAACCTC
ATAACCACCAAGAGGAAGCACTGGGAGCAAATGCATCCTTTGTACCCCAGGGTTCCTGCA
CTGAGAATTTCCTAGTCCACAGGGAGACTGATGAGAAGGACCTTCCTCCAGAGTCAACTC
ACTAAGCCTTCGCCTGGAGCTGATGTCCTGAATTTGGACTTCTAGCCTACTGGACTGTGA
GAAAATAAAATTCTCTTTGTTAAAGCCATCCACTTTTGGTATTTCTGTTATAGCAGCACT
AGATAACTAAGATGGACTGCCAAAAGAATGAACACATCTGCCTTTAAAAGATACATAGCC
AGAATGCTCCTTAGAAGCGAGGATGACCAGACTTTGTCTCACATACTTTGGACATGTTAT
CAGAAGGGACCAGTCCCTGGAGAAGGACATCATACATGGTAAAGTAGAAGGTCAGCGAAA
AAGAGGAAAACCTTGTAGGTGATGGATTGACATAGTGGCTGCAACATTGAGCTCAAGGAT
AAAAATGATCATGAGGATGGCGCAGGACCAGGCAGTGTTTTGTTCTCTTGTGCATAGGTT
CACTACCAGTCAGAACCAAGTCGATGGCACCTAACAACAACAACAATGTATTTCTTACCT
CATATCTCTTCTTCTTTCCATCTTTATAGTTTAAGCTGTCATCTCCCCTTCTTGATCTGC
AGTTGTCTCCTGATTAATCTTATGTCTACCATTGCTGACCTCTTCTCTCATTATTCCCCA
CAAAACAAAGAAATCTTTTAAAAACACAAATCTACTTATGCCACTTCTCTGCACAGGAGT
CTTTGATAGATTCTCATTGCCCTAAACATAAAGATACAAAATCTGAATTGTGGCCTATAA
GACACTACATCATCCGGCCTGTGTCTACTTCTCTGATCTCTGGTATCATTTCTGATCTTG
GTAAGAGCCTTTTCAGTTGAATAGTGTGGACAAAGACCCAGTTTCTCTGGGTTGATAAGA
AAATGAGTGGTAAAAGCCAAAGGCTGAATACAGAGAATTCTTTTAAGGACTTTAGCTATA
ATAGGAAGCAGAGAAATAGAATATAGCTGAAAGGAAACATGAGGAAGATTTTATTTTTTA
AGATGCTTGATGTAAGTCATGTGTTGGAAGTGGCAGGAAAAAGGAGAAATTTACAATGCA
GGAGAGAAGAAAAATAATTACGAAAGTGCAGTCTTTAACAGTGGGCTTGGGACCTGGGGT
TCAGGTGGAAGGATCAGCCTTAGAACCTAAGTAGAAAGATCGGCCTCAGCTGGAACAAGA
ACCCTTCCTACCTTGTTTTAGTAGGAAAGACAGCATGTGGCCACAGATGTAGTAAGGTTA
GTAACATTGGTGTTGGAAAGATGAGTAGTGTTTTGGTTTTGTCTATTTTCCTATTACTTG
GGAGGCAAGATCACCAGCTGTGGAGGGGCTGTGGAGAGTGGATGGGCCAAAGGATGTTAG
GGATGGGAAAGTCTGTTTAGTCCAGAAGTATATTAATATATTGCTTGACCATTTTAAATA
ATCAATCATACTTTAGAAAGAAGTGTAGAGATAGCCAGATTGTACACTTTTTCTCCAGCA
TATTCAGCTGCTTAGGAGCAGACACAAAGTGAAAAGTTGAGTTTAACCAAAATTGGGATT
TAACCAGGTGAATTCAACAGAGGGGGAGTGGACCAAGGGAGTTAAAGATACTTTCAGGGG
AGTTTAATGGTGGATGGCGGACTCTAAGCTAGGTAGGAAGGGTGCGAGTGCTTGAAGGGG
TGCATGGACAATTCAAAAAGAATATGGGATAAGATTAAAACATTTTTAGAAGAAAATGTA
GGGGCGAGGCTCTGGGACCCAGTGTTTAATGATAGATTATTAGATATGGTAACAAAAGCT
CCACCAGCAAAAGACAAAATAGATAGATGGGACCTCGTAATTATTAAATACTTTTGTACA
TCAGAGGACTTTATTGATAAATTGAAAAGACAACCTACAGATGGGGGGAAGTTTTCAGGA
ACCCTGTATCAGATAAGGGCCTAATATCCAAAATATATATGAAACTTTTACTTAACAACA
ACAAAAAAACCGAATCAAAAAGTTGGCAAAGAACAACAACCCCCTCGCCAAAAAAGAAAA
AAAAAAAAAAAAATTTCACTATTCAACTGAAAAGGCTCTTACTGAGATCAGCGGTGATAC
CAGAGATCAGAGAAGTAGGCACAAGCTAGATGATGCAGGGTCTTAGAGGCCACAATTTAG
ATTTTATATCTTTATCTTCAGGGCAATGAGAATCTATCAAAGACTTAAGTGCAGAGGAGT
GACATAAGTAGATTTGTGTTTTTAAAAGATGTTCTGTTTTGTAGGAATAATGAGAGAAGG
GGTCAGCAGTGGTAGATATAAGATTAGTTCAGAGACAGCTGCGGAGCAAGGGTGGCCATA
GATGGTGATACTAATTAGACATAGCCAGTCACCTCAATGGATTTGTTCTCTTGGTTTGAA
GGCTATTTTAGTTATCTATTGCTCCTATAACAGAAATACCACAAGTGGGTAACCTTAACA
AACAAATTCATTTTCTCACAGTTTAGAAGGCTAGAAGTCTGAAGTCAGGGTGCCGACTCT
AGAGGAAGGCTTTCTTTCTCTGTTGACTCTGGACGAAGTTTCTTGCTCTTCTGCTTGTTT
CCTGGTTCCTTGGAGATTTTCCTGTGGCTTGACATCTCTCTTCCCCCATTTCTGCTCTGC
CCACTTGTTTAGCCTCTTTTATATCTCAAGAGATTGACTCAAGATACACCCTACACTAAC
CCTACCTCATTAACATAACAAAGACGCATTCCCAAATGGGATTATAACCACAGGCAAAGA
GGTTAGGATTTACAACACATATTTTTGGGGGACATAATTCAATCCATGGAGCTCTGGTGG
CACAGTGGTTAAAAGCTTGGCTGTGAACCAAAAGGTCAGCAGTTTGAATCCACTACCTGC
TCCTTGGAAACCCTGTGGGGCAGTTTACTCTGTCCCTTAGGGCCACTATGAGTGGGAATT
GACTTGACAGCAATGAGTTTGGTTTGCTTTTGGATTCAGTCCGTAACATGGTGGGAATGT
AAAATGGTATAGCCAATGTGGAAAACAGTTTAGTGGTTCCTCTAAAAGCTGAATATAGAA
TTACCATATGACTCAGCAATCCCAATCCTAGGTATATACCCAGCAAAACTGAAGGCAAGA
ATGTAGACAGAAACCTATGCAGCCATGTTTCTTGCAGCACTTTTCACAGTAGCTAAAAGG
TGAAAATAACCCAAATGTCCACCAACAGATGAATGGATAAACAAAATGAGATATATAAAT
ACAGTGAAATATTCTGCAGCTGTAAAGTGGAATGAAGTTCTGATGCATGCAGCAACATGG
ATGAACCTTGAAAACATGCTGAGTGAAATAAGTCAGTTGCAAAAGGATAAATACTGTATA
ACCTCACTTACATGAAATAAGCGAATATATAGAAACCAAAGATTATTAATGATTACCAGG
TATGGAAGGGTGGGGGTAAAGGAGGAGTTTTTGTTTGGGGAGCATTGAGTTTATGTTAGT
GGTGGGTGGAATATTTTGGAAAAGGAGAGTGATAATGGTGGCACAACATGAAAAATGTCA
TCAATGCCATTAAATTGTAAATGTTGAAGTTTTACTAGTGAATGTTTTGGTGTGCATTTT
CTGCACGATAAAAAAATAAATAAAAAGAATAGGGAGTAATTGAATTTTTCAAATGTGAGG
CCCAGATTCTAAATCCAAGTGTTCCTACCTGAGTAGGAAGTACCTTTAGCTGTATTAGCG
GTCTCATGTGTATCCCAACTTGTCACTTACTTTACCTCCTTTAGTTAAGGTTTTACTTCT
CATAATTCCTTTCTTTTGAGTTGTGATTCTGCTAGGCTTAAAATCAAAATTTATTTTTTG
CTTGCTAGAGTGTTTTTTACAAACTTAAGGTTATCTGAGATTTGTCCTTTCAGGGTGGAA
AGCAAGGAGCAGCTGGGCTTTTTGTATAAGGACCTTTGAGGTAAAGAATGAAGAGCAGAT
TTCAGAAAGCATGTTGAGGAAAGCAGAGGGATCTTTGGGCCCCTCCATGCCACTGAATTG
CCTTTCTGAAATACACTTCTACCCCTATTTCTCCTTCTTAATCATTGGTTCCCCAGTGCT
TACAAGATGATATGTGTAAACTGGCCATAACCTGTTTTGTTTTTGTTTTTTAATACTTCA
TTTTCTATCACTCCAGCATAAGCCAGTCTGATCTGGGAACATTTTTATTTTATTAAACTT
CACCTGCCTCTGTCAGTGTGTGCATGTGTGTGTGAGAGAGAGAGAGAGAGAAGATTGAAT
GATGAAGCTGTTTATAGATACTGAAAGACTAAAAGGGAAACAATTGTGAAAGTATTGTTA
ATCACTGATACTATTTATACTTACCATGTTGGTTATATATAATATTAGTATCAGATTAAT
TTAGGTATATATAAGTATGACTCCAAATGTGTACTGTTCTTTTCTACTCATGTAACAATT
TTTCACTACTTTAATACATTGGAGGGAACATTGACTAGGACTACATCATAATGAAATTTT
TGTTACAAGAGTGGAAACAAAATTTCTTGGAGTCCAGGATCAAATTTCATCAAGTATTAG
AGTATTACTTCTGGTCACCATAAATAAAACTTACTAGAAGAGCCTTTAATCTGAATACAT
TTTACATTAGGCATAAACTAATCTGTAAAATATAATACTAATCTATATTTTAGTGTTACG
CTTGTTTTAGAGTGAGTTTTTTTAATCTCCTTGAAAATTATATAATGCTTCCACAATTTG
GTAAGAGCAGTGAATGCTTTCAACTCTTGCATACTTATTCTCTTCATTCTGTGTTCCCAA
CTAAATTCGGTACTGGTTCCTGCCATTTGTACATAGTGTATTTTATATTCCAGTTACATG
GAATTTTCAAAAGGATTCCTTACCACGCTCCCAAAAGGTTTCTTTGAATACATGTATACT
TCGCTATATTATAAGCTTACATATACACGTATACTATATATTATGTGAATGACATATTTT
CATATGGCATCTATCACAGTTTTATGTAGACTACATTTGATATTAAACTCAAGAAACTTC
TTTCAAAGCTGTTTCATCCTTTTTAATCTTGTCCTATTGCCCTTTTTTTTTTTTGCCCCT
TCAGAGTAAGATTTAGTTAACTGTTCATTGATACATTGATTGTTTTTGAAACAGGTATCG
ATTAAGGAACAAAAAGATCAGTGCAACTGTAAGAACGTTTCCTCTTCTAAATAAAGTTGG
TGTGAACAACACTGTCACAACCACAGCCGGAAATGTCATTTCTGTCATAGGAAGTACTGA
AACAACAGGGAAAATTGTTCCAAGTACAAATGGAGTTTCAAGTGCAGAAAACAGTGTTTC
TCCACTAATCCCACGTAGTACTGAGAATACATTAAGAGTTCTGGAGACTGTGAAGAAAGT
GGGGAAGGTTGGCACTAATGGTCAGAATGCTGCTGGGCCCTCTGCAGAGTCCGTAACTGA
AAAGTAGGTATTCGGTAAAAATGGTTAATAACGACTTCCTTATCCCTTTTAGAGACCCCG
AGTATGTTTACTTATCCTGAGAAAAAGCAGAATTTGTATGCAGAATGTTTGATGTAGTAG
AAAAACCACTAAGTATCAAGACGTTTGAGTTCACATCCTGCTCTGCAACTGAATAGTTCC
GTGACCTTGGAAAGTCACTTCACCTCTGGGTGTTTTCTTCAACTATAAATTGAAGGGGTT
GGATCAGATGAGGGTTTTTTTTACCCCGTATTTCCTTGAATTTTAGGGTTGATTCCGTAG
CGTTGCTGGAGAGGAACTAAGTAAGTTCCTAAACCAATGAAATGCTGAACCTTTAGCCTC
TGTTTCTGTCAGGGCAGTTCTTTTATTTATGCTCTTTAATGAGGCATAGTTGTTAAGAGG
GGAAATTTTGGAGTCAGTCTGTCTGGGTTCAGATTTGGCTTACTGCTTCCTAGCTGTTTG
ATCTTGATCTCTCTGTGTCTGTCCTCATTTTACTCATCCATAAATGTAGAATAACAGTTG
TATCTACTTTCACCTGTTGGTTGTGAGGAATAAATGAGTTAATACATGCAGCGTGTGTGG
TGAATAATACCTGCCACATAGGAAGCTCTCAATAAATACCTGTTGTTATTACTGGTGTTA
CTGTTGCACCTGGGTTTTAGTGTAGAATTTCATTTGGCAAAAGAGTTTTGGTGCTTTAAA
AAAAGTTTTAAAACCTTGGAGGATCTGAAAAGTTACTTCCAACTCAAAAATCTACTACTG
CCTTGATATTCGTTTGGGGTCTTAAATCTCAGGGCATGCTCAGTTTTTGTTGCCCAATTG
TCATTATCTGTTTTTTACTTTGCTAGGAACAAAGCATTACGCTAGACTCAGAGTAAACTG
TTAGTGATTTCACATAATAAATGATAGGTAGATGAGTATTAATATTCTCTACTTCTGCAG
TCAGCATGTGATCATGGAAACTGCTTATTAAAGGACTCTTATGCTCTTCACTGGGAGAGA
TTTTAGAAAAAATATATTAGAGAATATTGTCTCGTTAACGAATGTTATGTGTGCGTTCAT
TCTGAGGTCTATTCTTGGTACTTTTGGAAATGCATGACAAGTATAAGATGATATCTCTGC
CTTTAAGGAGCTTATGATGATATAGTTGTGGAGACAGCATTTAAACAAATGAAGCAGTAC
TGAAATTTTATTAAAGCCTGTTGCCATCAAGTTGATTCTGACTCATAGTGACCCTACAGG
ACAGAGTAGAACTGCCCCATAGAGTTTTCCAAGGAGTGCCTGGTGGATTCGAACTGCTGA
CCTTTTGGTTAGCAACCATAGCTCTTAACCACTGTGCCACCAGCGTTTCTATGAGTTGGC
AGTGGGTATGTGCGTCTGAAATTTTATTAAAGGACAAGAAAATTTTATATCGCTGGGAGA
AATATGGGAGAAGATTTCAGAAAAGGAAATAGCAAAACTTTGATCAAGTTTGTTGGTAAT
TATATGGAATATGGAGGAGACCAACTTTTTATGTTCAGGAAATGAGCTTTTGAAAGGTTT
TGGTAAGGTAATGTTGTAAAACTGTTTTATATCCATACAATTGAATATTACTCAGCCATG
AAAAGGAGTAATTACTCTGTAGCATTGATGAACCTTGATGTTAAGTGAAAGAAGCCAGAC
ACAGAAGGCCATAGAGTGTATGATTCCATTTACATGAAATGTCCTGAATAGGCAAGTCCA
TAGAGACAGAAAGTAAACCAGAGGTTGCCAGGGGGTAGAGGGAGTGGGGAGTGAATGCTA
ATGGGTATCGGGTTTTTTTTTCTTGGGGTCATTAAAATGTTCTGAAACTAGATAATGGCG
ATGGTTGCAGAACCTTGTGAATATACCAAACCCTCCTGAATTGTACACTTAAAAAGGGTA
AATTTTATGGCATGTGAATTATATCTCAACTTCTAAAACTATGATGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
AAAAAAAAAGATTAATGTCACCGAGATAACAGGTTTATGTATTTTACATCAGTGTGATGA
GTTATCAGGTACAACTATTTCATTCATCCAGTGAATATTCACTGATTACTTATCTACCTG
CTGTATGCTGGGAACTGTTGTAGATGCTGGGGATATAGCAGTTAACAAAGTATGTAAACG
CAGCCTTTCTTTAGGAGTTTACATTTCAGGTAATCTGACTCTTAGTCAGTTCGTTCAGTG
TCTGTCTTCTTTGTCCCCAAGAATTCTACTGGCAAACTATATTTCTTCTATTGAGAATTT
ATTGAACAGGAATTTTTTTTTTTTTTTTTTTAATTTCCAGTAGGAAAAATCTAATTAAAG
AAGGGGTAAAAAGGAACTTATGGGTCACATTAGTATCTGGGATTTTTTTGTATTGCTTGT
TTCCCCCACCAGAAAATGTGACCTGATACTGTGACCCTGTGAATTAACCATGTAAAGGCA
GTGAAATTCATTGCCTTATTTGTCATAGAAATTTATAGTGTTTTTCTGTTAATGGTTTCA
CTATATAATTTTATGAAAAATTTCTACGGAGGAAGACTTGTCAATCATAGGTAGTGACTT
ATCCCTCTTTGTTAAATTCTTTCTCCAGTAAAATTGGTTCTCCACCCAAGACTCCTGTAA
GTAATATAGCAGCTACCTCAGCTGGGCCCCCTAATGTTGGAACAGAGCTGAATTCTGTGC
CTCCAAAATCTAGCCCATTTGTAACTAGAGTACCAGTATATCCTCAGCATTCTGAAAACA
TTCAGTATTTTCAAGATCCAAGGACTCAGATACCTTTTGAAGTCCCACAGTACCCGCAGA
CAAGTAAGTAATTTTAGACAATTGTACGAAAAAAGAAATTTTAATTTAACATTTGTTGCC
CTTACATAAATGAGTCAGTTTATCTAAGCATGTCTACATAAAAAAAAAAAAAAAAAATCC
CTTGGACTGCATAACCCCTATGTTTTCTTCCTACCCCAATAATCTGTGATTCTAGATACC
AATAGTTTTAAGGTTGTCATTCCTATGAATCAAGTATCAATAAGGTCAGTGGATGAGCTT
CGGGGGGGGGGTGGTAAATCTAAAAATATTTTGTTTATATATGCTCATGTACATTTTTGG
GAAGATAGTTCACAGCTTATATAGATTTTGAAAGAGGTCCTTAACCTCTGACCCCCAAAA
GGTTAAGAACCAATGATCTGTCAGTTTGATCCAATGTAGAGAATTCCTTAAGAGAGCCCA
GTGCTCAAGGCAGATATTCTTTACTAGTTAAGCTAAACTATTGTTTGGTTTAAAGAAGAC
TTCGGGGGGGTATTTGTGGTTTAACATTAAAGGTGATCTCAGCGCAGTAGTTTTCAGGGG
TTCATCCAACCCCAGTGGCTCCAGAAAGTCTGGATTCCCCCTTTTGATCAGAATTCTTCT
GTAGAATCTTTGACCAAAACATTCAGGAATGGTAGCCGGAAACTTTATGGGATCAAATTG
ACAGCAGCAAATCTAGGAAGCTTAGGGGGCAGAGAGTTTGTGCTTACTGGGGAGGAACAG
TTCAGAAAAGGAGAGTGAGAATGGTTGCACAACTTGAAGAATGTAATCAATGTCAATGAA
TTGTACCTGTAGAAATTGTTGAATTGGTATATGTTCTGCTGTGTATATTTCCAAAAACAA
AAATTATTTAAGAAAAAAAAAAACCACAGTGATCTAGCTGATTACTTAATTCAAAACCTG
TAGCAATAGGTGTGGTAGAAAGAAATTTACCAGCCATCTGTGAATACCTCTGTCATGTAT
TTTCAAGACATTATTCAACAAGGTATTGAATGTTTTCATAGAGTGGTGTCTTGAAAGTGT
GCAGCTTCCTTATGAAGCAGTGTAACTAAAGTTTAAAGCTTATTTTATTTTTCCACATTA
AAGGCTGCATTAGATGTAAACCATTTTAAAATGTTGGGGGTTTTACTAAGATCACATTAA
ATATTCCTCTTTCCAATTTTCAAGGATACTACCCACCACCTCCAACGGTACCAGCTGGTG
TGGCTCCCTGTGTTCCTCGCTTCGTGAGGTCCAATAATGTTCCAGAGTCCTCCCTCCCAC
CTGCTTCCGTGCCATATGCTGATCATTACAGTACATTTTCCCCTCGAGATCGAATGAATG
CTTCTCCTTACCAACCTCCTCCTCCGCAGCCGTATGGTCCAGTTCCTCCAGTACCTTCTG
GAATGTATGCCCCTGTGTACGACAGCAGGCGCATCTGGCGCCCACCTATGTACCAACGAG
ATGACATTATTAGAAGCAATTCTTTACCTCCAATGGATGTGATGCACTCGTCTGTCTATC
AGACGCCTTTGAGGGAAAGATATAACTCATTAGATGGTTATTATTCAGTGGCTTGTCAGC
CACCAAGTGAGCCAAGGACAACCGTGCCTTTACCAAGGGTAAGTAATGATGGAAAGAGGA
ATGCTATTAAGGACACTGTCTCTGGAGTTAAACCACCAAGGTATATATCCTGGCTCTTCC
ACTTACTAGTTCTTTGACTTAGGGAAGTTACTTGACCTCTCTGTGCCTCAGTTTTTTTCA
TGTTAAATGGAAATCATAGTAGTACCTACCTCATAAGGCTGCCATGAGGATTAAATCAGA
AAAAATAAAGCTCTTAGAACTGGGCCTGATACAGATTAATGCTCAATAAATGTTATATTT
GGATAGGAAACTAATGGGAAGGCAGAAAGAGATCTTCAAAATAAAAGCACAGGGCCTTTT
TTCAGTATCCTCCCATTTTTACAAATGCCCTTCCTAAACCAGAAAAATGAATAAATACTA
ATTTTTTTAAGTGTGTGGAGAAAAATAGGCTAGGATGACTTCCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTAATTCTTATAAAAACCTTAGGGGGCAGGTATTATCCCTCTTTTACAGGTGAG
GAATCTTACCCAGAGAAGTTAAGTAATTTGCCCAAGATTATTCAGCCTTTACATAGCAGA
CCTGGGATTTGAATCCTGGTCTATCTGAAGCATTTCTTCCCTACTTCACAACAGGTACAG
AAATGCCTTCTGTAGTATTCATGCCATTTACATCACTGTTAGTTGTTCTTGGCATAAAAA
AATTTTTTTGTATAAGGATGATTTTTCTCTTTACCCTTGTGTTTTAAGCACTGTTGTATT
TAGAGAAAACCATTAGTTTAAACAGTTTCTTCTTTTTTTATTACACACTCTTTCACCCCT
AGAGGTTCTAATATAAAATCTTTAAAAATCTTTTCATTATGAAAATTCCAAACATATACA
GAAGTAGAGAGAATATATATTATGCCCCATTACTGATCACCCAGCTTCTACAGTTATCAA
CTCATACCCAGTCTTGTTTCATTTATACCCCCCACTTCCCATTGGATTATTTTGAAGTAA
CCCTAAACATATTTTATCCGTAAGCATTTCAGTAGACCACTGAATTTTTAAACTAGGTCC
AAATACATCTCACCAAACAGACTTCTTCAAAGCATCTAAACATTTTGAAAAAGTGATAGA
ATTGCTACTTGCCAGATTAAAAAAAAAAAAAACAGCATTTTACATTTTATATTATGTTTT
TAGGGAATAAATATATCTCCAAGACTCAAATCTGCTATTGGCTAGCAATGTGACTTGAAA
CAAGTTATTTAACCTTTTTGGTCTTAAATTTGCTTATCTGTATAACTGTTGCTGTTAGGT
GCTGTCGAGTCGGTTCTGACTCATAGCGACCCCATGCACAACAGAACGAAACACTGCTGG
TCCTGCGCCATCCTTACAATCATTATGCTTGAGCCCATTGTTGCAGCCACTGTGTCAGTT
CATCTCCTTGAGGGTCTTCCTCTTTTCTGCTGACCCTGTACTTTACCAAGTATGATGTCC
TTCTCCAGGGACTGATCCCTCCTGACAACATGTCCAAAGTATGTAAGATGCAGTCTGGCC
ATCCTTGCTTCTAAGGAGCATTCTGGGTGTACTGCTTCCAAAACAGATTTGTTCGTTCTT
TTGGTAGTCCATGGTATATTCAGTATTCTCCAGCACCACAGTTCAAACTTGTCAGTTCTT
CTTCGGTCTTCCTTGTTCATTGTCCAGCTTTCACATGCGTATGATGGGATTGAAAATACC
ACGGCTTGGGTCAGGCACACCTTAGTCTTCAAGGGGACATCTTTGCTTTTCAACAAATTA
AAGAGGTCCTTTGCAGCAGATTTGGCCAGTGCAATGTGTCTTTTGATTTCTTGATTGCTG
CTTCCATGGGTGCTGATTGTGGATCCAAGTAAAATGAAATCCTCGACAACTTCGATCTTT
TCTCCGTTTATCATGATGCGGCTTATTGGTCCAATTGTGAGGATTTTTGTTTTCTTTATG
TTGAGGTGTAATCCATACTGAAGGCTGTGATCTTTGATCTTTATTAGTAAGTGCTGCAAG
TCCTTATCACTTTCAGCAAACAAGGTTATGTCATCTGCATAATGCAGGTTGTTAATGAGT
CTTCCTTCAATCCTGATTCTTCTTCAATCCAATCCCCATTCTTCTTCATATAGTCCAGCT
TCTCGGATTATTTGCTCAGCATACAAATTGAATAGGTATGGTGAAAGGATATAACATACA
CCTTTTCTGACTTTAAACCACTCAGTATCCCCTTGTTCTGTCCAAACAACTGCCTCTTGA
TCTATGTACAGGTCCCATCTGTATAATTAGTAATCTAGATTTAATAATTCTTACGACTTT
AGTGTTCTGGTCTTACAGTAATCATTCCCCTGTGTCCCTTTAAATTTATCCCCTTCCCTG
TGTAATTCCAGAGCCTTCTCTTTTGTACTTTATTTAATTTATCATTTATACTTTCTTATT
TACATGCATCATTCTTTTCTCGAAAAATTGTAAACTCTTAAAATATTATGAACTCCTTTA
GGACAGGGACTATATAGTATGTGGGTATTTGTTCTATTTTCCTGTTTTTTAGAGCACTCC
ATACCATGTTAGATGCGTGATATAAATACAGATTGATTGGTTTGATGGCATCAGTTGTCA
GTTCAATGAACACTTGAAGGACAAAGCAAAAAGAGAAGGCATGCTATTTTCTATTAATAA
ATAATATAAATAAAAATAGTGTAAATATTGTTGCTTATTAGTTATCGAAAGTAGTATTGT
TTAGTTTGAAGTCCTATGTATTCTATAATAATAACTTTATAGTGGTTACAAGTTAGTAAT
TAAGTTCTTACTAATTGACTATGTTTTTTTTTTCCTCCTAATCAGCTCTCTGAGAGCGTG
AGTGGTACAAAATTTGAAGAAGATCAACTTTCCCATTATTCTCCCTGGTCTTGTGGCACC
ATAGGCTCCTGTATAAATGCCATCGATTCAGAGCCCAAAGATGTAATTGCTAATTCCAAT
GCTGTGTTAATGGTATGATTTTGGTGGGAAATAATGCATGTTGACTCAAATGTAAGACAG
GTTGAATGCTTTCATCTTAATATCACCACTATATTGCTCATCTGTAAGCAGTAGGGTTAT
ATTTAAGTACGTCTCTAATAAATTGTGTTTAACATTTAAACTATTTGACCATAGTTGGGT
GGTCTGAAATAGATACTGGATTATCACTGAGATCTAGAGTCTACGGTGAAATTTACTAGA
CAACTTTATTACATGTCTTTTACTAGCATGTATTTGTATTAGCTGAAGTATGTCTCCAGA
GGCCTTTCATTGATTTTCTTTGGCTTATGCAGGACCTGGACAGTGGAGATGTTAAGAGGA
GAGTACATTTATTTGAAACTCAGAGAAGGACAAAAGAAGAAGACCCGATAATTCCTTTTA
GTGATGGACCTATCATCTCAAAATGGGGTGCAATTTCCAGATCTTCTCGTACAGGTTACC
ATACCACGGATCCTGTCCAGGCCACTGCTTCCCAAGGAAGTGCGACTAAGCCCATCAGTG
TGTCAGGTAATCCGCTTAACTAATACCTAGCCTGATATGCTGTAGGCACTGTGCTTTTTA
ACCCTCACATTGTGGCATATAGAACTTTTTCCTCCTTTTAACAACCACAGTAAGCTCAGA
ATTAAATGGTTTAGTTGGGATCACATGGCAAGTAGGATAAACTGCAGATCTTTTTTGAAA
AGCATACATTCACATCTATATACTGATTTTTCACTTATGACTATTATTTCTTTCTACATT
TCTATAGATTACGTCCCTTATGTTAATGCTGTTGATTCAAGGTGGAGTTCATATGGCAGT
GAGGCCACGCCATCAGCACACTATGTGGAACGGTAATGTTGCTCTTAATTCTTTAGGATT
CTGTATGTTTAGACTTGTATGTATACTTAGAGTACAAATCCTACCCCCCAATTGTTCATG
AATTGTGTTTTGCTTGTTTGAGCTATATAACAAATTTCTGAAAATATTTTACTTTTACAT
TTGGAATGATGACTGAAATTTTCAGGGTTCTGTTATTAAACAAACATATATAGTCATCAC
TGCTTTTGTTGCTTCATTTGTTTCATTTTTATTACAATGAAAATCTTTCTCTTTAAAGGG
ATAGATTCATTGTTACTGATTTATCTGGTCATAGAAAGCATTCCAGTACTGGAGACCTTT
TGAGCATTGAACTTCAGCAGGTAGGCTCTGTCATTCAGAGTTGAATTTTTTAAAAATAGA
ATGGCAGTCGAAAGCTAACTTTACCTTTTTTCCCTTCTGTAGGCCAAGAGTAACTCATTA
CTTCTTCAGAGAGAGGCCAATGCTCTGGCTATGCAACAGAAGTGGAATTCCTTAGATGAA
GGTCGTCACCTTACTTTAAATTTTCTGAGCAAGGAAATTGAATTAAGAAACGGAGAGGTA
AAGAGATCAAACCTATCAAGCTTCATGCTTAATCTGCTGCTTTTGCACTTTGGTTTATGG
CATAACTTAATATATTTTACTGTGCCTTTTTCTGATGGATGATTGCTTTTAAAACTTACA
ATAGAGATAAAGTTGTGGTCCCAGATTTCTTAAATAATTCTCTAGTTAAATTGTTGGGAT
TCCTATCTTAATTTAAAAGGGAAACCCCAGTTTTCATAGGTTTAAGATCAGTATTTTTTT
AATTACAGAATGATTATACAGAAGATACAACAGATTCTAAGCCTGATAGAGATATTGAAT
TGGAACTTTCGGCACTTGATACAGATGAACCTGATGGACAAGGTGAACAAATTGAAGTAA
GTATCACAGTTATATTTAGGAGATTTTGTTCCATTGGAAATTAAAGTGTACTGAAGGATT
AACAGATTTTATTTTCTTAGGAGATCCTGGACATACAACTTGGTATCACTTCTCAAAATG
ATCAGTTGCTGAATGGAACAGCAGTGGAAAATGGACATTCAGTCCAGCAGCACCAAAAGG
AGTCACTAGAGCAGAAGAGACAGAGTTTAGGTGAAGACCATGTGATTCTGTGAGTGTTAG
AAGGAAAATTCATAACCAGTTGGTATAGGGCATGAGTGTTTAAAGAGAAGTAGATGCAGT
GTTAAATTTCATTTTTGGCTTTGTGCTGTGAGAGGAAAACCTCATATAATAGGCCAAGGA
CATGGTCAGTCTGGATTTTTAGAAGAGGGGAGGTAAATGTGAACCGAGTGGTCCATTTTA
GTACCCTGAAACTTGTGTTTTGTTGAGGTGTAACAGTCCTTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTAC
CAAAAATTAAGTCTACTGTGGGCTTAACCTTTTTTTTTTTTTTAAATAATATTTCTTTGA
GTTTTTGGTGAAAGTTTACACAGTAAGTTAGGTTCCCATTTGACAGTTTCCACACAGATT
GTTCAGTGACGTTGGTTACATTTATCATGATGTGTCAACATTCTCTTTAATTTTGTTTTG
TTTGTTCATTTCTGATACTCTAGTTTCCCTGCCCCCTCATCTTCTCATCTTTGCTTTTGA
GTAATTGTTGATCTTTTGGTCTCATACAGATGGTATTTTAAGTAGAGCACCGATCTTACA
GGTAATATCCTTTATTTTGTGTGCCACTCTGTTATTTTGCTAAAAGGTTATCTCAGGGGT
TAGGCTCAGATCTAGGTTTAAAGAGTGTCTCAGGGCGGTAGTCACAAGGAGTCCTCTGTT
CTCCACTGTTGTCTGGCTTTTTTTTTTTTAAGAATTTGTGTTCTGCTCCATATTTTTCTC
CCATTCTATCCAGGACCATCTATTGTGATCCCAGTCAGAATGGTCAGTGGTCATAGCGGG
GCACCATCTTGTTCTGGTCTCAGGGTAGATGAGGTTGTGGCTCGTATTGGCTTGTTTCTT
CTCTGAACTTCTGGTTACCCTCTTACTGTTTTGCACCTGACAAGTAGAGACCCATAGTTG
TATCTTAAATGCCTGCTGGTAAGCTTTTAAGACCCTAGACACTACTCACTTTACTAGGAT
GCAGATCAGGATTTTTGTGAACTCTATTACGCCAGTTGACTGAATTTTCCCATGAGACCA
TCGTCCTAAGCTTTCAAACCCAGAAAACCAGTCAAGGAAGGTGTTTGGGTTATGCCTGAG
GAGTATGCATATTTGTGTCTTCAATGAATGTATTTGCCTGCACCCACATAGTTGTATTTA
CACGTACCTGTAGATACTTTGGAGCCCTAGTGACACAATGGTTAAGAGCTCGGCCGCTAA
TCAAAAGGTCGGCAGTTCGATTCCACCGGCCACTCCTTGGAACCCTATGGGGCAGTTCTA
CTCTGTCTTTTTGGGTAGCAATGAGTTGGAGTCGACTCCACAGCAATGGGGTTTTTTTTT
TTTTTTTAATAGATACTTCTGTCTGTTCTCACCTACGTATGCACCTGTACCTACCCATGT
ATCAATATGCTTATACCCACCCATCCATATGTGCTCAAACACTTGTTTTTGCTTTGGTTG
TGCTGTGCTTACTACACCCACATTTGGTGTCACTTTTCCCGTTGTTTGGGCTTAATCTTG
ACTTAGTAGTTTGTATGGCCTTAAATTAACCAATATTTTGACTTTTTATTATAATTTTTG
GAAAATGGGACTTTTTCAGTCACCTCTTAAACTTTTTACTCAATAAAGACGTACCTTTGC
TATGGGCTCTGAAGTTTTGACACAACTTTTGTTAAGCATGTATGGTTATTCTTAATGTTT
CCACTTAAAACTAATTTATTTTCAATGTCATTTGTTTTTTCTCAGGGAGGAGCAAAAAAC
AATTCTGCCGGTGACTTCTTGCTTTAGCCAGCCACTTCCAGTGTCCATTAGCAATGCAAG
TTGCCTCCCCATCACCACATCTGCCAGTGTTGGCAACCTCATCCTGAAAACTCATGCTAT
GTCTGAGGATAAAAATGACTTTTTAAAACCTGTTGCAAATGGGAAGATGGTTAACAGCTG
AAAGGAGGTTCATCTTTCAAATTTGTGATCACACCATGGAAGCATTTACACTAGCTTTTT
ATATATATAATATATATTATATAATGTATATTTTTTTTAAAAAAAAGATATTACTGGGGC
ATCCATTTCCTGTGGACTCTTTGATACTTCAAGCCCTCTTGCATTAGCATTCTGAAAAGA
ACAAAAAAAAAAAAAAGAAAATTTACTTTACTAGGGTAACATGTTCACTTTCCAGAAGTG
ATTGGAATTTGGACAACATTTAACTTAAGCTTCAAGCAGCTTTTTATGAGTTTTTAGCAA
TCCGGTGCAGTAACTGAGCCATTTCCTATTTAAATGGCTTCTGTAGAAAATTAACAACTC
AGTTATTAAACTAGCAGGATCCTACAATGATACATCTAGTGAAAGTAGACTTAATTAACT
TATTTATTTCTATTTTATGTTTCACTGAGAGAAATTTCCATCTCATTCCAGCTGCTTTAT
TTATCTTTTCTCATGGGACTTTGCATGGAATTTTTTTTTTTTTTTTTAAACTTTGGGAGA
AGTGGAATTAGACATTACCACCATAGAATTTTACAGGGTTGTACACTAGCTTTCTTTACT
GCATTATATGTAGGAGTGTGGTGCAGTGCTTTTATCTGTAGCATTTAAATTTTTTTTAAT
TTTCCATTTTTCAAGAATAGTTTCTGCTTTATTACTCGTAATGTTTATACACAGGCTACT
TGTTGAAGTAAGTAATTAAAAATATAACCAAGTGCCTAAGTCTTTCAGCTGATGTACTAG
ATATTAAATTCTCCTAAGTTATGCAGAATCGTTTTTACAATTTTGATAAATTATGCACTA
ATATAATGGCAGTTTTTTAAATGCAGATTTAAGCCTGTACATTGTTGAATCTGAAGACTT
GGCAAAAGAATCAGGTGCTTTCAGCTTTCTTGAGAAAACCCTGTATGTAGCGTTTGCACT
GACTAACAAGAGGGTATTGCTGGGTTTTTTAATTTGAACTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1174, 5071..5271, 5740..5872, 5988..6106, 8179..8291, 15354..15662, 19408..19622, 20784..21217, 22049..22219, 25005..25151, 25472..25685, 25927..26011, 26278..26359, 26442..26576, 26822..26935, 27020..27168, 29025..29220
1001..1174, 5071..5271, 5740..5872, 5988..6106, 8179..8291, 15354..15662, 19408..19622, 20784..21217, 22049..22219, 25005..25151, 25472..25685, 25927..26011, 26278..26359, 26442..26576, 26822..26935, 27020..27168, 29025..29217
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved