Loxodonta_africana Locus ENSLAFG00000017669
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000017669
Loxodonta_africana
ENSLAFG00000017669
GeneScaffold_3393
SNORA65
3995..4124
5867
GCTGGCTCAGGCCCCTCCTGTCATCTCACCATGCCAGCAGGGATGGGAACGGTTGGGAA
ACAACTCTCATCTATCTACCTATCCCTCCCTGATGATCAGCTCTTACGCCCCAGCTCCCT
AATGACCAACCCTCACTCACCCCCTCCCCGACGTCCAGCCTTCTCCACTCTCTCTTCAAT
GACGAGGAATCCTTCAAGTTCATCTCTTTCCAACCCAGTCCCCAACGTTCAGCCCTCCCT
CCTCCTTCCCCGACGTCCAGCCCAGAAAGGGAGAATCACACCCATCTTTGGGGCCGGGAT
GAGCTGTGCCAGACCTGTTTTTGTGGATGGAGAGGTCCCCGACGTTCGGACCCTCGGGTG
GACCCGAAGGCAGACCTATCACTCGGTGGGGTTGGTCATGGACGCGAGGTCGCAAACCAT
TCGGACAGGCCCGGGCGGTGCTGGAGTCTGGTCTCTCCCAAGCGCAGGATCTGGGGACCG
AAACTCAGAAAGTCATGCAGACCAGAATGACTAAGTCTTGAGACTCTGAGAACCGCGGAA
CATCAGAATTTAAGGGTTGGAGCTGGTTTAGACCCGTATAAAATTGTTTTCATAACTAAA
ATGCACATACCACGAAAGGGATAGGAGAGAAGTCGAGGTCGTCAAGGCACTAGGGTCCCG
GAACGGGGGCGCCGAGCATTCAAGGGAGGGGTGGGGCCCTGGGATGGGGTACAGGGACCC
TGGGGTGATTCACCCAGTAAGGGACAAGGGGGAACAGCGGAGCTCTCAATTCCAGAAGCA
GTCCCCTTCTGTCGCCTTCCCCTGGATCGAAGAACCTCGAAACCCCCTTGGAGCCCCTAG
CCACAGCTCACCGTGCTGCCCAGCCCTCCAGCCATCAACCGCAGGAGCCTGCCCACAAGC
AACATGGCGGCAAGGGCGTCGTCGGGGGCTGGGCGGAGACTGCAGTTCTCGCGATAGCAG
TGTTTTCGCGACTATATCCGGCGCGTTCTGCAGAACTTCCGACCTTTCGGCTTTCGGCTC
GGAGGAGGCCTCGGTGCAACTTTCCTCGGTCGTCCCGCATCTGGGTTCATCCGACACCAG
GCGCCTCCGCCATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGGTGGGTGCTCTA
GATGTGGCCGGGGCTGCGGGATGGAGCATCTCTCTTCACTGCGGCCCGTTGGGTCTGCAG
CCCCCGCCGCGATTGCCTTTCCCATGTGGGTCTCTAAGGCCTTGGCCTTCTGGAGGCCTT
CTCGGAGCTTCGGTGCAGCGTTCGGGGCGCTGTGCTGTCCTGGCCGAGTCTCTTAGCCTG
TTTGGGCCTCAGCTTCCCCACACGTGTAAATGGGGAGGGGGACCGGACGACCTGTGGCGG
CTTTGCAGCCCGCACGCCCTGTGGTAAGGTTTGTTTCCGGGCTTTTCTGCTCTCCTGGGC
TGGGTTCGCCGGCGCCCGGGGCTGCCTCCTTGCCCGCCCGGCGCGGGGCAGAGGTGGTTG
CCGAGCCGAAGCCGCTGCTCCGCGTGGCACCCGCTGCAGCCTACGCCCGAGGGAGAGGAG
GTGGCTCGCCGGGAGGGCGAGGGGGTGGCCTGTTTCGGTCACCACTAAGGTTCTTGCTGC
TGATTTGAGAAGAGGCGCTGGGTGGTGTGACCAGCCCCGGGAAGATGCAGGGAGAGGGCT
CTGGGTCGGGGGCTGTCTTTGCAGAAGCACTAACCCTTTTTTTCTCCCAGTGTACCTGAG
GTGCACCGGTGGGGAAGTCGGTGCCACGTCTGCTCTAGCCCCCAAGATCGGCCCCTTGGG
TCTGGTAAGTTATTCTCATGAAGGTGTGTTTCTTAGTTTATATGAGAAGAGCAAAGTTGA
GCTTTGGTTTAGGCAAACATGACTGTACCCGAGGTGCCTGCCCGCATCCTTGGGGTTTAT
CATCTCTGACCAATCTCAGCACAGGCAGTAGCGACCGTAGAAAGGTTATGTATGAAAACC
CTTGAAGTAAGTCTGCATAGTTGCTTTTAGTGTATTGAGGCCTGGGCCGGAGAAGGTCAA
ATGTGAGGGTTCTGGAGTCAGGAGTGGCTATGCTATATATGTTGGGCATCCTGCATTTCT
TGGTCAGGAGAAATGGGTTTAGTACAGGATTAAATGGGGGTCGGGGAGGAAGTTGGGTGA
AGATTGTAGTGAGTAGTATAGTAGCTTGCACTTGCACCACTGTTCTAAAGTGTAAATCTA
GTGGTTGATATAGCCAGCGTTTACTTAGTATCTGTCGATGACCAGCCTCATCTCCATACT
GCCTTCTCAATTTTATACTGTACTTTTACTGAATGCATTTCCCTGAATATCTTCAGGCCT
TTATTCTTTGGGCAGTGTTCTCCTGTCCCAAATGCTTCCCCCAAGTCTTCCTTAACCAGT
GTCTTACTACTCTGTGTTGGTTTTTAGCACAGCTGGCACTGAATAGACATCTCTCCTGTT
TAGGCTAGTGATCACTAGACGAATTACAAAGTAGCACGTGTCCAAATCCCATCTCCAAGG
TTTGACTTGATTAGTCTGAAATGGAGACCTGGTATCTTTAAGGCTACTCAGGTGATTTTA
ATGTAACTGCGCTGAAACCACCTGCTTTATCACATAGGCCGTTTTAAAAAACTAAGGGAC
TTGGCCGCATTGTGGGCCTGAGCCTATAGCTTACAGCCCTGGACAAAATTAACTCCGAAT
GTCATTTTCCCAATTTGTACTATGGGGATAGCGGTGCCTTGATTAGGTAAAGTTAAGTGC
CTCATACATTTACTTCTGAATGCTGGAAAAGGAAGATTTAGGATGTTGCCAAGTGAGGTA
CCAGGCAGATGCTAAGATTGTGTTTCAACTTTTGGGCACAATGTGATTACATACTTCTGT
TTTTACAGTCTCCAAAAAAGGTTGGTGATGACATTGCCAAGGCAACTGGTGACTGGAAGG
GACTGAGGATTACGGTGAAACTGACCATTCAGAACAGACAGGCTCAGGTATTGTACTTAG
TTTGAGGGAGCAAGGATAGCAATCCTCTGGCATCCCAGGGTGGAAGGCTTTTGCTGACAC
AGCCACCTTGCTACCAGTGTTGAGCTGAGAACAGTCCTGTTGCCAGCCCCAGGAGGCACC
TGCTGTGTTTGGGAGAATTGAGCTGGGAACATGGGTGTCACACATGCCCAGCATGGGGGT
GACTGAAAAAACACATGCTAATCGATTTTAAGCGAATAAGAGATTTTTAACAAGAAAAAG
GTGGAATTTTATCTTTGTGGGGCGGACCTTTCTGAGAGCATATGCCAAGAAAGAAGTTCC
AGTATCAACTCTTGTCACCTGTCTGTGACCTTGGGCAAACCACTTAATGTCTCCCAGGCT
AGTAGACACCCTGTCAGGTTGTGAAGATTGCTTGAGAATGTACAGCAGGCCCAGTGTCTG
GCTCAGGAAACTGAAGATCTGAAGTGCATGGCACTATTGCTTGTGTTCACTGGAGGTGGG
GTAGGGCTTATTATTCATATCAAGAATCTCTGCTGCAGATTGAAGTGGTGCCCTCCGCCT
CTGCCCTGATCATCAAAGCCCTCAAAGAACCACCCAGAGACAGAAAGAAGCAGAAAAACA
GTGAGTTCCTTTTTCACTGGTAATCTGTTCCACTGATGGTTTGTGATTGATGGTTGTGTA
GCCAGTGTTTGATAAAGGGCTGCATATTTTCCCTTTGATGAAACCTGGGGATTGGGTGAT
TCATTGAAAGTTGTTACAGAGCCAGGCACTACCAAAAGGTGCCACGTAGCTTTTCCCAGC
CCCTGGTGCGGGGCCCGTCACACTTACAGTACTTGAGAGGGAAAGAGGTGTGAGGATCTT
TGCTTGTCTTGGGCAGTTAAGGTGGGTTGAGGCAACTGAGTGATGGACTGGTAATCAGGA
AGTAACTGGCTTAACCACAGTAACTTGAGTCTGTTTCCTCAGCTCTAAAATAGGGATATG
TCAGGTTAACGAAGACTTGGTTTTGCCCGTAGCCACCCGCCACTGCACCTGATCAGTTCT
CTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAACCCCAGCTTAGGAAACAGAGT
TGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTAGGGAAGGATTGAG
GACATTATGTAGTTTGTTCTGGCCTTGAGTTGTTAACAGCTTTTGTGTTTTCCTTTCTGC
AGTTAAGCACAGTGGAAATATCACTTTTGATGAGATTGTCGGCATTGCCCGTCAGATGCG
ACACAGATCTTTAGCCAGAGAGCTCTCTGGTAAGGCAATAACTTGGAACTGCTTTAATTG
TTGTAATTTGGTGCATTTTCGCTGAGTAGTTAGAGCTCTTTTATTTGAGATTTACTCTGT
AAGATCTCAAATTTGGGACACTGTCTTCCCTGGGCTTGAAAGAATGGCTCGAGATAGTGG
TGACCATCTTGGGCTGGATATGTTATATCTGGACACTGATGGAGGCTTTGCATTAGGGCA
TCTAGTTTGGAACTCGATGGAGCACCAAGCTTTGGAGTGTCACTCCTGCTGTTCCACAAA
ATGGGCTATTTCTCGCCAACCTAGTATTCTGAGGGACTGAGTCCTTCTAATGCCACTTTT
TCTTGATTATAGGAACTATCAAAGAGATCCTGGGGACTGCTCAGTCAGTGGGCTGCAATG
TTGATGGCCGCCACCCTCATGACATCATAGATGACATCAACAGTGGTGCTGTGGAATGCC
CGGCTGTAAGTCATCTACATCAGTTTCACTGGTTAAAATGGGGGTAGAAGTCCCAGTGGG
GGAGTGGCTAATGTATCCATGGATATAAGCTGGAAAATTCTGCAATTATCAATAATGGGG
TTGGGAAACAATTTTTTTTTTTGATGCCATTACTGATAGGGCTTCTTTTTCCTTTCCTAC
AGAGCTAACAACTACAAAAGGAGATATTTCAATAAAGGATCATTTGATAGCCAGCGAGCT
TGTTTTTGTTTTTTTGATGTGGTGTCTTCCCTGGGGGAAGCTAGCTCCTTTTGAGGGGTG
ATGGTCAGTGGGGGCCGAGGTGGCAGCCTGTGGAGAAATGGCAGTCTGGGTAACAGGCTC
CTGTAGACAGATCCTGGCCTGTATGGGACCAGCTCAGATGAGTGAGGACATCTGGAAAGG
AGATCACTGCTTTTTATAGTCACTTAAATATTTATAGAGACCGGTAAGCTCTGTGTGTTG
CATCTGTTTTATTTATCATCTTAAATTCTGTTCCTTTTCGCCTGCTCTGTACTGCCTGCA
CTTTTATCTTATGTGAGATGAATGAAGGGATAAATTGCAAGGTACTTGAACCTACTGAGC
AGTTTTAAGCACCACCTGGAAGGGGCTTCTATGGTTCCAGTCTCAAGAGAGTGATCGCCC
CCTGCATTAGTCATTTTTTGGCTTCTCAGTCATTTTGTCAACCGAACTCATTACCATGGA
GTCGACTGCAACTCTTAGCAACCCTATAGGACGGTAGAACTACCCCATAGAGTTTCCAAG
GAGCACCTGGTGGATTCGAATTTTGTCAAAGTTCCCTTAAATCAGTAGTTCTTAATCCCC
CAGGTGGTCTAATGTGCAGTAAGGGTTGAGGACTTGGGAGGGGAGGGGAAGAATAAGCAT
TTCAGGACACCTGAGACAGGCAGTCTAAGTTGCCAAGGAAACAAATCCAGGGAGGCACAG
GCGTGCTGAGAAGAGTTCACTAAATGGGGAGGGTGGGATAAAGGAGACTAGGACCCAGAT
GAGTGTAAGGAAGGAAACAGACAGTAAAAAATACTACACTGTTTTTTGTCAGGAAGAGGG
GAAAGAAATGACTGAGGAATCTGGTACAGCTTTTATGACCCACTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1730..1803, 2888..2986, 3518..3599, 4202..4288, 4632..4752, 4760..4769, 4771..4788, 4797..4838, 4841..4867
1001..1127, 1730..1803, 2888..2986, 3518..3599, 4202..4288, 4632..4752, 4760..4769, 4771..4788, 4797..4838, 4841..4867
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved