Loxodonta_africana Locus ENSLAFG00000013387
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000013387
Loxodonta_africana
ENSLAFG00000013387
GeneScaffold_1766
SNORD42
5366..5430
6810
AGGGACAACTTTTCCTTTTTTGCAAAATCCTCTTGGACTTTGGTCAAAGGGGAAATCTG
GCCCCAGAAGGGGAGGGGCAAAACAGGGAGGGATGAAGGGGAGGGGAGGCACAGATCCTC
AGAGAAGACATTTACCTGAACAACACCAGGCCTTGCTCTTGGTCAGGATCTGAACTTGAG
GATGCAAAGGTGACTGGGGTAGGAGAGGGGACTCTGAGTGAAGTTATTCACTGGAAGGAC
TAGCGAGTACTGGGGAAAATCTTGAGCTGAGTGTTTAAATACTGGTAGAACTTCCTCAAG
AGTATTATCGGGAAAACGCACGAAGTCTGACACTGTCACAGGTAAAGGGGAGGTGGGAGA
ACTAACGTGCCCTCCATGCACCTACTCGGATACTTCTTTCCCTTTGCCTAACTAGATTTT
ACCGCCACCAAATCAGGCGTTATTGATAAACGACGTCTCCTTTCAGCACCTTATTTTCCA
CAGGTGTCGACTGAGGGAGTAAAACACCCGTTGCCGTGGAATCAATTCCGACTCATAGTG
ACCCTACAGGTGTTGACTGACGGAGTAGGACTGGGCAAACCCTGCTCTAACGTTCTACAA
ATTTGCTTCGCTGTCCCCGAATCAGCCTAACTGTAGTCTTTCAGTGGCAGTGTTACTGTC
TCCTGGCGCTGCAGCCATCCTTCTTGAGACCAGAAGTTGCTCTAAGTGGGAAGCGTACGA
CCAGACTCAAGCAACAACCGGCTACACCATCCACAAGCCAGAGCAAGTAAACACGTGTCC
TAAAAAAACTACAACTCCCAAGAAGCTTTAGTGCCTTACAGGATCAGGGGTTGGCGCATG
CTTATTCCTTCCCGTAGAGAAATTAAATCTAACTACCATTCCCGGCGGGCGCCACGCTAC
AAATTATCCAATCCGCTGTAAGTGGAACCATCGCGAGTCTTCTGTGAGACTTGATTCTAT
AAGCCCGTGAGAACGGTCGTGGAAAAACCCTTTTTACGAAGATGGCGCCGAAAGCTAAGA
AGGAAGGTGTGTGTCGGGGCTAGGGGCCACCCCAGGCTTGTGTGAAATCCTCGCAGAGGG
AACGAACTGGGAGGATAGCTTCTGGGCTCATCCCCGGGGGATCTGCTCGGGAGCAGCTGA
CTGCATTTCGGCTTCGCGGCGGCCTATGTGGGCCGCGTGGGCCCAGCCGCATGGGCCGGG
CTCCAGTGACGGAGAAAGGTGGAGTAGGCAATCCGGCACGGCATCATCCGCCGGGGGAGA
GCCAGTCGGCCCCTTCCTCGGAGGAGCTACACACGTCCACATGCTGGGAGCTGCTTTGTC
TCCAGAGCTAAAAGAAATTCGTGCCCTCAGTTATACCTTGCACTTTTTTTTTTTTTGTGT
TGGTAAACGAGGCTTGTTTAGACCCCCAAGAGCCATATGTATGCAAATCCCTAAAAACCC
TGGTGGGCAAGGGGCCAAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGTTGATTTTATTTGCAGTATACGGGGAAGGAAGC
CCCGGTGGCCCAGTGATTAAGAGCTCAGGCTGCTAACCAAAAAGTTCGCAGTTGAAATCC
ACCACCAGCTCCTTGGAAGCCCTATGGGGCAGTTCTGCTCCGTCCTTTAGGGTCGCTATG
AGTCAGAAGTGACCCAGCGGCAACCTTTTATAAGGGGAAGAGTTTTAAGCAGAGGAAGGG
TCTGAACTGACTTGAGTATTTAAAACATCACTCTGGCTGTTATGTGGAATTTAGATTTGA
GGGTGACAAGAGCAAAAGGGACCATTTCAGAGGCTAGTGTGCATTTTAGGTAAGAGATGA
TGATTTGATCAAGCGTTATAGCAGAGGGCATGGAGAGAAGTGGATGGCGTCATGATATTT
TGGAGGCAGAAACACAGGATTTACTGATGAGTTGGTGTGAAATGGAGGAAAGACCCTGGG
ATGATTCTCAGGTGTCTGACTTTAATAAGTAGAGGATGGTGGTGCCATTTACTGAAATGG
AAAAGAGCCGGGAAGGAAAAGTTTTTGGGGGGGTAGGAAGCAAGAGTTTTAATTTGCTAA
AGTGTAGGATGGCTATGAGCCATTCCGGTGGAGATGCAAAGCAGGTAGTTGGATGTGTGA
GTCTGGGGCTCAGAGGAGAGGTCTGGGCTGGAGATATAAATTTCAGACTGTTCAGCAAAT
ATTTATTGAGCTCCTAATAAGTGCTAAATACTGGGCTATGCACTGGGAACTTAGGGGTAA
ACAAGGGGAGTGTAGTCCCTGCTATTATGGACATTGACCACAGACTAGAAATGAAATAAT
AATATGAATGGTTTGTACATATTGAGCATTTTCTGTGTGCCAGGAACTTGCTAAGTGCCT
TCTCTGCGTTTTCTCATTTGATCTTAACAGCTCCGTGAAGTCGATTCTATATTATCCCTA
TTTTCCATATGACGATGTCACATAACTTGTCTAAGACCAGACAGTAAGAGGAGAAGCAAG
GATTTGAACCCAGGCAGTTGACTCTAGAGTCTGTGGGAACTTAAAGCAAAACAAAACAAT
TGCCATCAAGTTGACCCTGACTCATGGTGACCCCATGTGTGTCAGAGTAGAACTGTGCTT
CGTAGGGTTTTCAATGGCTGGTTTTTCAGAGTAGGCTTCTAGGCCTTTCGTCCAAGGTGC
CTCTCGGTGGCCTAGAATCGTCAACCTTTTAGTTAGCAGCTGAGGGTATTTACTCAATTT
CATCACTCAAGGACTCTTATGGGAACTTATAGATCAGATTACTTTTTTCTCATTGCGCCT
GTGGTAAAACTGAGTTTCAGATAAGTTAAATAACTTTCTCCAAGGTCTCACACCACGTTT
GTGATCATTCTTCTGTTTCTCAGCTCAGTGTTTTGGGCCCTTGGCTTCTCATGCTGTGAG
TCCATTCCGACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCTGCCCCTCAGGAATGTTAAATAAGATAAAGAATGTTTAAGATTTG
GAACTCAAAGATGAGCCTTTCAAGAGAAAGTGCACAAAGTCTTTAACCCCCATCTGGGGC
TCAGAGTCCCTAGGTTTCATGGTGCAGATGATGACGTCTATTCAGCGACCAAAGTCTGAC
AAAAATGATTGCTACCTTATTGTCTGATGCACTGGGCTCCAAAAGAGGGCACATCTTTTC
TTCACCTACTAGGCCCAGGCCAGGTGACCCCATTTTGCCTCTCCCCCAGGCTTGACCACT
ATGCCATCATTAAAGTTCCCCTCTGACCACTGAGTCAGCCATGAAGAAGATAGAAGATAA
CAACACACTTGTGTTCATTGTGGATGTCAAGGCCAACAAGCACCAGATCAAACAGGCTGT
GAAGAAGCTCTATGACATCGATGTGGCCAAGGTCAACACCTTGATTAGGTAAGTGGGGTC
CTGTGGGATGGCAGGGGGAAGCTGGGGCCACAGTTAAGAGCCAGAAGTCCTGAACGGCAT
GGGATTTTTTGATGCTACTTCTACTCTTGAGGTCAGAGGTCGGTTTGGTAGTTTGCAAGC
CTAGAGAAAAGAGCAGCTCCTGCTGTAACTGTATTCCTTTGTATGGAGTATGGGCTTTTC
AGGGGGCAGGGGCAGGTTCTAGAATTAAAGTTGTGTCGCATTACTTAGGTTTGATTCCTA
AATGTCTTGTGGCCTATGGTGTTTCCCATAAAAGGCAATAGAGAATTAGCTTAATTTGTG
ACTTTGTGGCTCCTATACCACCCTCTGTGCAAATGATGGAAAAATCACTATTTGGAAAAG
AATGACATGAACAAAGGAACCGCTGATGTGCCAGAGGACTAAGGGAGGAAGGGCGGGAAT
GGAGGCAGTGCGAACACTCAGGACTAAGGCTCCCTTCTCCCCACCCCAGACCCGATGGAG
AGAAGAAGGCATATGTTCGACTGGCTCCTGACTATGATGCTTTGGATGTTGCCAACAAAG
TAAGCTTCCTCTTCTACAAACTCCCTAACACCCACCCCCTGGGTGCAGATGATGCCTCTG
TTAGTGACCAAAGCCTGATGTTTGGTGATGAGTCTTAACTGACTGACTGCACCCTATCCA
TAACAGGCCTCGCCCTCGTTTTTTTTTTAACCATAACATTCCAACTTAATCTTCACGTTT
CAGCTCTTAGTAACAAAGCTCCCTTTTGTTTTTCAGATTGGGATCATATAAACTGAGTCC
AGCTGGCTAATTCTAAATATAAATTTTTTCACCACATATGCTTCTTGTCTTTGTATGTGT
TTCTGGTTGGGCTGGGGTGAAGCCATGCTATGGTACACAGCTACGGGGCCTGGGCAAGAC
TCTTAGTCTACTTTGTTGCTATTAAAACACTCAGCCCTGACACCCCACCATACTCGTAAC
CCCTGGTGGTAGGAGCTTACGTACCAGACATACTTTGTGACCCAGATTAAGGTTAGTTGT
CCTAAGACAACTTCACTGAGAGTTTTCATTAGCATCCATTACCGGGCAGTGTGTGGGTTG
GCTGACTTTCGGGTAGCACCCAGTCCCCACACACCCATCTACCGTGTCCAACCGGTCTGT
CTGCTTCCCTCACCGCTTGCCCAAGAAAGGACAAGGACTTCAGAGGAGTGCTTTCATAGT
ATTTTCAATACCAGGTGCCCAAGGTTAGAGGTTGGTCACAAAGAACACCCCAGGCTTGGG
GTGAAGTCCTAGTTGTTGTGTGAATTTGCTCTCCTAGGCTGTGTTTCCTGGCCTTGCCAT
GAGTCCCAGGCTCTGCTCTCACTCAGTCAAGAATTTGTCTTTGTGTTTCTGGCTGGGGAC
ACGTTCAGGGCAGAAGTCAGAGCGAAGGAGGCGGGAAAAGTAGATGAGGATCATCACGTC
CAGCATGAGCAGGATGCCCAGTAGAAAGGTACCCAGGTTCCTCTGGCCGGTGTAACGCAG
GAAGAAATGGGTGAGGTAGGCCTGAGGAGCTAGGCGGAAGAGAAAGTACATGACCAGGTT
GACATACTTGTTGACCCGGTAGAGAAGGAGATCCTGGGCATTGTTAATCTTCATCATCAT
GCGGATGGTAAGGAAGATGTTGCTGACCTCCACTAGTAGTGTTAGGACGCCCCCACCGAC
AAAGCTGCTCCAAAATATGCCTGAGAAGAAGGCACCCATGGCCTAGAAGGTGAAGAACAG
GGGTTAGGGACCAGAGATGCCAAAACTTTCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1611..1794, 4849..4878, 4881..5027, 5509..5578, 5796..5810
1001..1025, 1611..1794, 4849..4878, 4881..5027, 5509..5578, 5796..5807
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved