Loxodonta_africana Locus EEF2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana EEF2
Loxodonta_africana
EEF2
GeneScaffold_5552
SNORD37
6885..6949
16098
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCAAGGCTTTTGGGGGGAGGAGAAT
GGGGTAGCTCCGTGGTCTTTTCTTTAGGAGTTTTGGGGGAGGCATTGTTAACTGACATCA
TCGTTTTTGCACCTGGCCTGAAGGGAGTCGTGTCACCCTTGGTGACTCACTGTATAGCCT
ACTTTGTGGGCTGTCACCAGCAAATGGCAACTGAAATCAGAGCTGCTATGGAGATTTGGG
GAGAGGTTTTTTAGAGCACCCTGGTCATCACTGTAGAGACCAGGAAGTCAGGCTGGGAGT
TGGGGGTGCCAGCTTGCTCTTGGCCGTGGGCCTGGCTGTTGTATCGACCGGATTCTGAGT
GCCAAGTTGGTTCCTGGAATCCTGTTCTCCCCCTCCCCCAGGTGAACTTCACGGTAGATC
AGATCCGGGCCATCATGGACAAGAAGGCCAACATCCGAAACATGTCAGTCATTGCCCACG
TGGACCACGGCAAGTCCACGCTGACAGACTCCCTGGTTTGCAAGGCCGGCATCATTGCCT
CCGCCCGGGCTGGGGAGACCCGCTTCACTGACACCCGGAAGGACGAGCAGGAGCGCTGCA
TCACTATCAAGTCCACGTGAGTCCCTGGTGCTTTCTGGGCCCTGGCAGGGAGTGGCCGAT
CAGCTGGCTGTTGGGGGGTGGAGGCTGGTGACAGCACGTACCATTTTCGGGGGGGGGTGG
TGGGTGACAGCACGTATCATCTTGCTGGGGCTGGGGCTGGTCTGTCCAACCATAGGAAAA
TGTGGTTCAATTTAACGAGGTGCCGCTGGGTCGAGATTGGGGGCCTTGGGGAGAGGAGAA
GGTTTGACCCAGTGGTCTCCTCCTGGGGAGTGACTTGGCCACTCCTCCGGGGACACTTGG
TACGGTTGTCAAAGCTGGGAGGGATGCTACAAATTTCTAAGGTTGTTACTGAACACGTTG
TGATGCGCAGGACAACCTGCCCACCAGCACAGAGAACTGTGTCCGTGCAAGTCCATAGTA
TCCAGGTTGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGAGTGGGCAAAGTTTACTAAGAGAA
AGGTTAGAAGGTTCAAACCCACCCAGAGGTGCCTAAAGGCCTGGTGATCTGCTCCAGAAA
GGTCAGTGGACCGCCACAGTACAGCCCTACTCTGACACACGTGGGGTTGCAACAGCAGTT
GGTTTGGTTTGATTTATACCTCTGTGTGGATGTAATTCCACTTGGGATAGGACTACCTTT
GTTATACTAATGAGACCAAATCAATATAGGATGTGTCTTAAGCCAATCACTTTGGAGATA
TAAAAGGGGCACGTTAGGCAGAGAAGCTGATATAAACGGAACAAAGGTAGATGCCACACG
GAGATCTCCAAGGAATGCTGAAAAGAAGCTGAGACGAAGATATTTTCCCCCAGAGAGGAC
AGAGAGCCTTCCTCTAGAGCTGGCACCCAGAATTCAGGCTTCTAGCCTCCTAAACTAAAG
AAAATAAATTTCTGTTCATTAAAGCCACCCCCTCGTGGTATTTCTGCTATAGCAGCACTA
GAGAACTAAGACAAGTAGAGATTACGAAACCAGTTGCCATCACGTTGACTCTGATTCATG
GCAAGCCTCATGTGTGTCAGAGTAAAACTGTGCTCCACAGGGTTTTCAGTGGTTGACTTT
TCAGAAGTAGAGTCCCAGGCCTTTCTTCCAAGGTACATTTGGGTGAATTTGAACCATCAG
CCTTTCAGTTAGCACCCAAACGCTTAACTGTTTGCACCACCCAGGGATGCCAGACTAGGG
ATTACATGATTGGAATTATTGCAAGCATGCAAATTCTCAATCATTGTTGAATCTGGGTGG
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGCCCCCCAGGAAGGGAGAAGATTCCTGGTCAAAGGGTG
CCATGGGTGGGTTTTGTGTTGTAAAGTCCATTTGAAGGGATGACTGATATGTGAGGGCAC
CAGGTTAAGCATGGTGCTCTGAGGGATCTGCATCTGGGGTTTTAGTGGCATCCCTGTCTT
AGCTGGGAATTGGGGCCCAGACATCTTGACCCACTGGGGCAGGGATCTGAGGCTGGTGCA
AACTTGGGTCAGTGTCCATCCATCCGTAAGACTTATCTGTCTGTTCTTAGCGCCATATCC
CTCTTCTATGAGCTCTCAGAGAACGACCTGAACTTCATCAAGCAGAGTAAGGACGGTTCT
GGCTTTCTCATCAACCTCATTGACTCACCTGGCCACGTTGACTTCTCTTCAGAGGTGACA
GCTGCTCTCCGTGTCCCCGAGGGCCCCTTGGTGGTGGTGGACTGTGTGTCCGGAAAGCAG
CGGGTCCCTCTGGTGGGGGGGGGGGGACTCAGACCGTCCCCGCTTGGGTCATCCTCTGGG
TGACTGACCGTTCCGTCCCCAGGTGTGTGCGTGCAGACGGAGACGGTGCTGCGCCAGGCC
ATCGCTGAGCGTATCAAGCCTGTGCTGATGATGAACAAGATGGACCGGGCCCTGCTGGAG
CTGCAGCTGGAGCCCGAGGAGCTTTACCAGACCTTCCAGCGCATCGTGGAGAACGTCAAC
GTCATTATCTCCACCTACGGCGAGGGCGAGAGTGGCCCCATGGGCAACATTATGGTGCGG
GGCCTGGTGCTTGGTGGGAGGCTGTTCTCTGTGGCAGGGACTAGGGAGACTTGGCTTTTC
TTGTCTAGTGGGTGCTGTCATTGGGGAATGGTAGTTTTGAGGAGCTTGAAGAGGTTGATT
TCAGCCATTGGTATCCGGGAGAGGGAGGCCGGGCTGGGCACGCCAGCATGTGATGACTGA
CATTTCTTCACTTTGACCTGATGTGTCTTGAAGAAACCCAGTGTCTGAGGCCCACGGTAC
CTGGGGAGCTTGAGGCTGTGATTTTTACCCCAGTGCCCCCGCCGCCCCAGCTCTATGGTT
CCCTCTTCTCCTCAGATTGACCCTGTCCTTGGCACCGTTGGCTTTGGTTCTGGCCTCCAT
GGCTGGGCCTTCACCCTGAAGCAGTTCGCTGAGATGTATGTGGCCAAGTTCGCCGCCAAG
GGCGAGGGCCAGCTGGGGCCTGCCGAGCGGGCCAGGAAAGTGGAGGACATGATGAAGAAG
CTCTGGGGTGACCGGTGAGTGTGAGGCCTAGTGCTAGGGTGTGGAGGGTCCCGCCAACAC
ACAGCCTGCGGGCTGTAGTTCTGCCAGTTCTAGGGGCTGGCAGGGTCCCAACTGTGATTT
GCAGGACGGCCTTAGAAGCCTTCTGGTGTTCTCTGCCCACGTTGGCAGGTGGTTGCACCC
CGGGACCACCCCTGGCTCCCCCAGCATGTTTAGGTTGTGTCTTCTCTGCCAGGTATTTTG
ACCCCGCCAACGGCAAGTTCAGCAAGTCCGCTACCAGCCCTGATGGCAAGAAGCTACCCC
GGACGTTCTGTCAGCTCATCCTGGACCCCATCTTCAAGGTGAGGCCCGTGCTGCGTGTGG
GGTGACAGCAGTGCTGCCACCTGCCCCGATGGCTCTGTGATCCCACAGGACAGAGGAAGG
GTGATGGGGTCAGGAGGCTGCTGTAGAGTGGGGCAGGAGGAACATAGTTAACTAGAAGTC
GAGCCCCTGAGGTCCCACCGTGGAAAGTCTGTCGCTGGGTTCTGTACGGAAAAACAGGGA
AGGTTGTGCCTCTCCGATGAGGGGAGGTTAGAGTCTGACTAGACTGAAGAGGGAAGGTGT
CGGCGTGGGTAACTGCTTACATGAATCAGATTTGGGAGACGTCTGTGAATCGGTGGGTTT
TGTTGTTTGTTTTTAAACCTCTACCGTGGGTGTTTTCTCTTGACTTTATCTTGTGGGCTG
GATCCTTGGTGGCAGGTAGATTGGGTCTTTGCAGCCATGCATCTGCTCTGCCTCTGGGCC
TCTGAGCTGCAAGCCTCTGCAGCTGCTCCCGGGTGAGCTGACTCTCACTCTGTTACGATT
TCAGGTATTTGACGCAATCATGAATTTCAAGAAAGAGGAGACCGCAAAAACTGATCGAAA
ACTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTAGAAGGGCCCACAGGACTCGGAAGGC
ATGGGGTGTCCCCACACATCCTGTTTTCCCGCCCGCCCCCAGGCTGTGATGCGCCGCTGG
CTGCTGCTGGGGACGCGCTGCTGCAGATGATTACCATCCACCTCCCCTCGCCCGTGACCG
CCCAGAAGTACCGGTGTGAACTCCTGTACGAGGGACCCCCAGACGACGAGGCTGCCATGG
GTAAGCGAGGCAGTGGAGCCTGGCCCAGGCCACTGGGACACCAGCACGCTCAAAGGCGGT
GGCCTTTGTGCACGGAATCCTTTGCCCGGGCCTGGGTGGGCAACGAGCTGTGATTTTGTG
GTCTGAATGCCCCTCACTGTCTGGCCTTAGATTTCTGGATCCTGGAGTGTTCTGCTGCAA
GGTGATCCTCTCTCCTCAGGTATTAAAAGCTGTGACCCCAAAGGCCCCCTCATGATGTAC
ATTTCCAAAATGGTGCCGACCTCTGACAAAGGGCGCTTCTATGCCTTTGGGCGAGTCTTC
TCGGGGCTGGTGTCCACCGGCCTGAAGGTCAGGATCATGGGGCCCAACTACACGCCCGGG
AAGAAGGAGGACCTGTACCTGAAGCCAATCCAGAGGTGAGCAGCCTGCACCAGCCTGCCT
CCTGCCCACTGATGGGTCACGGCTTTCCAGCTCTAGCCAGTCGTGCCCTGACTCAACATT
CAGGAGTAATGTAGTCTTAACTGAGGAAGGGTTTTTGAAGTTGGGGGCTCAGGGGTTTCC
GGGTGTGTTTTTATCCTCACAACCCAACGAGGAGGAGAGTGGGTGCTCCAGTCTGGACGA
AGAATCTCCCTGGAGGAGCCAGGGTCATGGGGCCCAGCAGGCCAGGCTGCACTGGGTGGA
ACTCCAGCTGTAAGGGCCGGGTGCAGCCGGCCTTGATTCACCTTTGGTACTCAAACTCCC
AGGTAGTTGCAGCACAGTTCTGTTGTGTATTCAAAGAGCAGACTCAGACCCCAGAGACCC
TCTGGTTCTTGAGTCGGGGGCAGGGAAAACAGGACTGATGCCTGGCCCACGCAGTCAGCA
ATGGGCCCTGAGTGGTGTTGATGTCACAGTTGAGTTCTCATCTGTGGGCAGGGGGCACTG
CTGTGTCATCGGTCTTTGGGGGTACAGGACCCAGGATCATCATGGAAACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTCCCTA
AAACCCCCACCAGAGAGGCAGCTTGAATTGTGCCTTCCCTACCCTACCCGTACCTAGCAG
TACCGGAGCCCCCAGCGTCCGTGCAGCCTGCCTTGGCATTGACGTTCAGGCCCCTTCCAG
TGCATCATCGAGGAGTCGGGTGAGCACATCATCGCGGGGGCCGGCGAGCTCCACCTGGAG
ATCTGCCTGAAGGACCTGGAGGAGGACCATGCCTGCATCCCTATCAAGGTGAGGCTGGCC
CGCAGGTGCCCACCTGGCTCTCCACGCACCAGGCTCACAGGTCCAAGTGCAGGGTCCTCA
GGGCCTGTGGCCTTGTTGCCACACATCTTTGTCCTCCCCTGCGCTGCCAGGTGCATGCAG
CTGTCTGTGAGGGTGGGGGGAGGCGGGTGGAGCATGCTGGTTGAAACCAGGCTCACAGGG
TCCTCTGAGGAAGCCTTTGGGTTGATGGCTCTGAAGGTGAGGTGTAGTGGCTAATAGGTT
TTAAAACCTCAGGTATCTGGTAGACTGTTCTGAGGTGCACAGATTGGTGAATCCAGGAGC
AGCCTTGCTCTGCCGAGGGTGGTCTGGGTGCCAAGCTCAGACCTGTGCACGGCTCGCTAC
CCGGTGGGGGAGTTTTACCGTAAGCGTGCTTTTGTCATTGAGTTTCTGAGACCTTTCATT
TGTCCCTGCTCATAGGAAGTTAAGTATTCGCAGAGCGCCTGTATTACAGTTGCTTCTCTG
TGCTAACAAGGGGCTGGTTGTGGCCATGCCTGCTTGCGGCACGTTTTTCCCCAGCTCCCA
CGTGTCAGAACTGGCGGAATGTTGTATGCCGAGGGGTCCTTAGCCAGTCCTGTTGGCAAT
GGGCAGCCTCGGACACGTGAACGGCTCTGTACTGAACACCTTGTATTTGAGTGGAAGTAA
GGCACACATGCCTGTGTAGCAAATCAAATCTATCTTATGTGCCCAGTGCTAGTCCGTGTT
TCCTAACCAGACTTGGTAGGAAGAGCTTGTAGGTCATCTTTACTGACGGGTCCCCCACTT
ACCCCCTTTCCCTTCCTCTGGCAGAAATCTGATCCTGTGGTCTCATATCGGGAGACCGTC
AGCGAGGAGTCAAACGTGCTCTGCCTTTCCAAGTCCCCCAACAAGCACAACCGGCTGTAC
ATGAAGGCGCGGCCCTTCCCTGACGGCCTGGCCGAGGACATCGACAAGGGGGAGGTGTCA
GCGCGCCAGGAGCTCAAGCAGAGGGCCCGCTACTTGGCAGAGAAGTACGAGTGGGATGTG
GCTGAGGCCCGTAAGATCTGGTGCTTTGGGCCCGACGGCACCGGCCCCAATATCCTCACT
GACATCACCAAGGGTGTGCAGTACCTCAATGAAATCAAGGACAGCGTGGTGGCCGGCTTC
CAGTGGGCCACCAAGGAGGTGAGCAGGTGGCAGGGAGGAGGGGCTGGTCAAGCGTCGTCC
TCTCAGAGTGGGCTCAGCACGGGCTCTCTGGCTCACCTGTCTTCCCAGTTTGTGCATTGG
AGTTGGTCGTTTGTAGGAGACTTCTTTCACTGAACAGATGCTTGGGTGCCTCTGGGTAAA
GCACTCTGGGAAGATGCTAGAGGAGTGGCATGGGATTGGGGGGGGGCACAGGTGGGCAGG
CAGGCATCTTGGGGCCTGGGTTTCTTGCGGGTGCAGGGCTACTGGAGTGGTGTGCTTGGC
CTGACAGTGGTCTCTGTCTTGCCCTGCAGGGGGCGCTGTGTGAGGAGAACATGCGGGGGC
GTGCGCTTCGACGTCCACGACGTGACGCTGCATGCTGATGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1215, 6230..6411, 6502..6713, 7035..7213, 7432..7537, 8044..8084, 8086..8100, 8105..8162, 10722..10742, 10745..10859, 11059..11254, 11909..12167, 13440..13547, 14364..14717, 15029..15053, 15055..15098
1001..1215, 6230..6411, 6502..6713, 7035..7213, 7432..7537, 8044..8084, 8086..8100, 8105..8162, 10722..10742, 10745..10859, 11059..11254, 11909..12167, 13440..13547, 14364..14717, 15029..15053, 15055..15098
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved