Loxodonta_africana Locus ENSLAFG00000005782
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000005782
Loxodonta_africana
ENSLAFG00000005782
GeneScaffold_6116
SNORD49
1338..1408
4683
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCAAACTGAGGCGCAAAAAGGGT
AAGTACTTTGCTCGAGGCCACACAGACAGGTGGTAGCAGAAGCCGGAACTTCCCCACGAA
AGCTTCTGCGCGCCCAGAAAGCCCCGCGCTCGACCACGTGCGCAGGCGCCCTGCACCCAG
CCCGCTGAAGCTGACCCAGAATTCCCGGCGCCGTGGACGAGACCACAGGCCGCCTCGGCG
GGGGGTTCCGGGGCGTTAGCCGGACCGGAAGCTCCCGGGAGCCTTTGCCTCCGTCACCCT
CAGTTCTGTGCGAAGTGGAACATTCCGAACCCTTAAGAGCCTTAGTCACCGCGAGCGCGG
CCTTTTCGCGGTCGCCATGGAGGCGTGTGCGGGTGCAGCCTGGAGCTGGCAGCTGGCAGC
CAGGGCCGACAAGGAGCGAGGGTTCTCTAGCCCCCGGGATGGTGTCTTCGGGACGCTTAC
CTGCAGGAGGGACCCCCGTTCTCTCGGGGGCCTCGGCGCGGCGCGCGGCCCTGTGCACCG
AGTCGCGCCGTGGCCGGTCGCCGGCGTGGGCCGAGGCTGACGGGCGGCGTGTCTGGCAGG
GCCGGGGCCGCCGCAGCCTGAGGCCGGGGAAGCCGGGCCGCCCAGCCCCGAGGCCGCCGA
TCCCCGGGGCCGCCCAGCCCCGAGGCCGCCGTGGAGACCGCGCTAAGCCGCGGGAGCTGG
GTAAGGTGGGTTCCCGCCCCTGTTGGGGCGCCACAGCGGGCGAGGGTTGTCGTGGGAACG
CAGGGCGGATTGTGCGACTGTCCTGATGAGATTGGTAATAGGAAGTGCCGTCAGAAGCGA
TAACTGACGATATCTGCGTTTGTCTGACTGCAGTCGTCCAAAGCGGGGCAGCTCAGTGAA
CGTAGCTGCCAGTGTGTGCCCCACACCTATGCCTTGTTTCTCTGTTCAAGGTTGCAGTGG
CACCGCGGAGCGTCGAGCACAGGAGCAGCGTCCCTCCGTGAGGTGAGCCCTACTCTGCCT
CCCCACCCGTTGCCTTACGTTGATCCCGACTCACAGCTACCCTGTAGGACAGAACTGCCC
ATTGGGGTTTCCAGAACTGTAATGTTTGTGGGATCTGACTGCCATGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGCATTGGCCTACTGTGAGGTAAGTGTTTGTCTAGGAGGT
AGGTTAGTGGTTGTATGTACCTAGCTTGTTAAATAGTTAATTCACGTGAAAGTGCTGCTC
TGATAGGTCAGATACTGGCAGTTTCACAAATCTGTGTAGGCCTTGACCCTTAGAGTACCC
CTGAGCCATCCTGACATGGATCTGTGGTGGCGGTGAAGCCACTGTGCAGAGCACAGGCAG
GAGAGGTTCCTGTTTTATCCCTCTGCTGCATGATCTTGAGCAAATGACCTGTCTGCTAGA
TGTAGTTTCTTTCGTCCATGATAACCTTAGGCTTCTGAGGCTTAAAACAAGGTGGCCAAG
TGGAGGTCACAGACCTCAAGGAAGTGAATTAGGATTTGTTGACTTGGGTGATTAATTCAC
AGAAAAACAGCTCTACTAAGTGCTTTTTGAGCACTCTTGTTAGCCCAGACTTTTCATTTG
TACCTGAGGCTACCGTCATCAGAAATGCCCCCTGCTCTGCCCTTGGTGTGTCTGAGGTGT
GTGTCTTTCCACTTCCCCAGGGTTGACAACTGAGTGCTAGAGAATGGGACCTGAAGTGCG
AGAGTTTTAGAGCAACCTGGGAGGTAAGCCTTGATCCTAGACAACCAACCACCACGGTGG
AATAAATGAAAAGCAAGTGTTAAAACTGATGTGCGGAAAAGGATATCACATGATGAGATA
ACCCAAAATAGCTGGAATTACCGGCAGAGTGTGTAGTGGTGAACCTGTGGTTTTCTGAAG
ATACCTTACATGCTGTGATTGAAAGCTGGTTGAAGCGGAAAGTGAGACTGATACCTAGTT
TCTTTGCAGGCTGTGTTCCCAGATGATGACCAGCTGCAGCAGGGGCAAAATGCAGTCCAG
GAACCTGGGGCCACCACGAACTTGGACTCAAAAGCTCTGCATTTGATCTGACACTGTGAA
ACACGCTCACTGGTGAGTATCAGCTGAAAATGTATCTGGCAACTTTTTTCCTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNACTTCTTGTCCGGGCCTCTGCTAAAAGATTTGGGCAAGGGGAAGGTGTAGGGTGAA
ATCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1033..1059, 1064..1072, 1075..1103, 1108..1126, 1131..1157, 1161..1171, 1179..1189, 1198..1207, 1225..1237, 1239..1259, 1490..1519, 1521..1527, 1535..1541, 2369..2437, 3680..3683
1001..1030, 1033..1059, 1064..1072, 1075..1103, 1108..1126, 1131..1157, 1161..1171, 1179..1189, 1198..1207, 1225..1237, 1239..1259, 1490..1519, 1521..1527, 1535..1541, 2369..2437, 3680..3683
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved