Loxodonta_africana Locus RNFT2
snOPY snoRNA Orthological Gene Database
Loxodonta_africana RNFT2
Loxodonta_africana
RNFT2
GeneScaffold_3237
SNORA15
10922..11062
63355
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAAGTCTGAAGGCAGAAACCACCTCTCCCCCAGCACTCTTCTCGGGCTTAA
CTGGCTTAACCGGCCTCCCCACAGGCAGCATCCCTGCCAACCCCTTCCCGTCCAGTCTGG
TGCTGGGGTCCTCGGCCAGTGGCGGAGACGTGTTCATCCAGATGCCGGCCTCCAGGGAGG
AGGCCGGGGACCGGGGGCAGGGGGGTGCCTACCACCACCGCCAGCCCCCGCACCACTTCC
ACCACGGCCACCGCGGGAGCTCGCTGCTGCAGCACGTGGGCGGGGACCACCGTGGGCACT
CAGAAGAGGGGAACGATGACCAGCCCGGGACGCCCGCCCCTGCCCTGTCAGAGCTAAAGG
CTGTCATCTGCTGGCTTCAGAAAGGGCTTCCATTTATCCTGATTCTCCTGGCCAAAGTCT
GCTTCCAGCATAAGCTGGGTGAGTGCCTGGGTGTGGTTAGCCTGGGGCATCACCTGGAAC
CTGTGAATCCGGGCCAGGTGAAGGCTGTAAAGGCAGACGGCATTAAAAAAAAAAGTTGCC
CTGGAATCAATTCTGACTCATAGCAACCCCACAGGGTTTCCAAGACCTTTGGGTTAGCAG
CTGAGCTCTTAGCCACTGTGCCACCAGGGCTCTGACGTGGTGCATAGTGCTTAAAAACCC
AAAAAACCAAACCCATTGCCGTCAAGTCAGTCCCAACTCACAGATACACTATAGGGCAGG
GTAGAACTGCCCCATAGGGTCTCCGAGGCTGTAATCTTTATGGAGGCCGACTGCCACATC
TTTCTCCTGTGGAGCAGCTGGTAAGTTCAAACCACTGACCCTTTCAGTTAGCAGCTGAGC
ACTTTAACCACTGTGCCACCAGGGCTCCTTTTGCATAGTGGTGTGGCATTCTGAGTCAGA
CCTGGGTCCAAATCCTGACGGATGAGCTGTGTGACTTTGGGCAAGTAACTTGCCTTCTCT
GAGCCTCAGTTTTATCATCTGTCTGGAAGTGGGTAATGATAGAAATGTCCTCAGATGGTT
GGTTGGTGTGAAGCAGTATAGTAAATAAAGGTCTGAATCCTGGCTCCGCCTCTCCCTAGC
TGTGTGGCTCTACGTAAGTTATTTAACCTCTCTGCGCCTTGGTTCCATCATTTGTAAAAT
GGGGATTCTAATAGTACATATTTCAGAGAATTGCAGTGAGGTTTAAATGAGTTAATACTT
GTAAAGCACTTAGGACGGTGCCTGCAAGTAGTAAGTGCTGTGTAAGTGTAGATTATTATT
TTTATTGTATCTTTTGGAGTCCCTGGGTGGCATAAACAATTACACGCTCGATATTTATCA
TGAAGACGTAAAATACTTAGCAAAGAAACGCACATAGCACCAAACCAAACTTGTTGCCAT
CGAGATAATTCCAACTCATAGCAGCCCTATAGGACAGTAGAACTGCCTCTAGGGCTCCAA
GGAGCAGCTGGGTGGATTCGAACTGCTGACCTTTTGGTTAACAGCTAAGTAGCTTAACCA
CTGCACGACCAGGGCTCCAGTACATAGCAACTGCTCAATGGGTATCACCTATTATTGTTA
GGAAATAAGGTAATGATTCATAAAGTACTTAGCCTAGTACCTAGCTCGTACTTAACATTC
AATGAACGATGGGTGTTCTACCGTTATTATTACGGTTATTTCTTTTTGTTTTGTGGTCAC
GATGCTGCTGTGCCCCAAAGGAATTCTCAAAGTGGTTGTATTTGTCTTATGGTAGGAAAT
ACCGCGTAGCCTACTGCCTGCCATAAGAAAATATCCAGAGGAGATTAGGCTTATTTGTCC
CTCAAATCACCAGCCAACTCAAAGCACCCCATGTTTCTTGGGGGGGCGTGCTACTGGATG
AACTCATTTTCTAGTCCTGGAAATGGAAGTGACCATGCCCCACCTTCTCTTGAATTTCGG
CATACGCACAGCTAAGTTTTGTTCTTGAGTGTGGTCGTTTTCTTCTTCACTTGGCAATTT
TTTTTTAATCAAATAGGAGAGTAGAAGGAGAGATTGTGACATTAACTAGTTTTGATTTTC
TATGTATCCAGTGAAGAAACGCACCATCTCTTACAAAGCAGATTTGGGGAAATACCTGGA
GCCCGTATACTGTGAAAAAAGTAAAAGCTGGCTCCGAGCATGATATTTAATTTTTTTTAC
TGAGCAGCATGACAGCTTCAGCATATTGTATAAAATGTGAATCCTGTCTACGGGAACCAA
AAGTAGGATGTGAAAATCACTCAACCCACTGGTTACCATCAAGTCAGTTCCAACTCGTGG
CAACCCCCTGTATAGCAGAGTAGAACTCTGCTCCGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCACACAGAAGAAGTGGCAGAGCCTGGATTTGAGCCCAG
GTCTACATATGCCCATAGTCCTATAGTGCAATAAAATGCCCCACAGTGGCCTAAATTCCA
TCCCTAAATCCGATGCCTATCCTCAGAGTGGGTCAGGGTTCCCAGTCGTCTACATGGCAG
CCCAAACCCTCCAGAAGTGGGATTTTCCCTCTTCTGTGAGTTTTTTTTGTGTGAGTAGCC
TGTATGCTCCGAGGGCACCAGGGATGGGTCTTTTTTAACTTTGCTCACAGGCCCTCGCAG
GCCCAGTGCCAAGCCTGATGATAAGTCAGTATTGTTGGACCCTCCTCTATCCCGCAGGCA
TTGCTGTGTGCATTGGGATGGCCAGTACCTTCGCCTACGCCAACTCTACGCTCCGAGAAC
AGGTCTCGCTGAAGGTGAGTCACCTGGTGTATTAGTCTTCTGTGGCTGCTACAAAAAATG
ATCACATACTTAGTGGATTAAAACAGCACAAATTCATTACCTTACCCTTCTGTAGATCAG
AAGTCCAAAATGGGTCTAAAATCAAGGGATCAGGATATTACTTTCTAGAGGCTCCAGGGG
AAAATCTGTTTCCTTGCCGTTTCCAGCTTCTAGAGGCCTCCTACATTCCTTGGCTTATGG
CCCCTTCCTCCATCTTCAAAGCAACAGCATTGCTTCTCTCTAACTATTCACCCAATGTCA
CATTTCCCTCTGACTCTCTTCTGCCTCCCCCTTTCACTTTCAAGGGCTCTTATGATCACA
TTCGGTGCACCTAGGTAATCGAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTGCAGCCCCCAGGAGCAGTGTATCCTCTGTGTGCTCCTGGTTCAGTCCCTTTCACCC
TTCTGGCATTCAGTCTGTTAGCTCAATTCCAACCCACCTTCACGGTGAAGACCGTTCCAC
TGGTGCTACTGGGTTTCACCACCATCATCGTGAGTCCGCTGTAAGATTGGCTTTTTAGTG
ACTATTTGCCTAGCACAAGTCTAAGCCCACTGCATATGTCATCTTGCCAGTTCATCAGTA
AACAATGGCTCAGAGACACCAAGTTCTTTGTCTGAGGTCACACAGCCAGTGTAGGTGGTG
GCCTCAGCATTTGAACCCAGATGGTTGACCCAGAGCCTATGCCCATCCTGGGTTGAAATC
CCAGTTCCTCCACCCACTGTGAGCTTTTGAACAGATTACCTTGGTAACCTCAGCCTCCGG
TTGCTGCCTCAGATGAAGGGTCTTTTCGTGCTAACATCAGAGACCCATTGAGAGGACTGG
ATGAGATTGTGCATGGAAGGTATTTAGCACAGGAAACATTTAATGGCAGTTTTTTTTTTT
TCATATATTTTTTACACTTATGATTTCTACTGCACATGGGATCTCATTGTCCTCACCTTT
GACCTTTCTCTGTGCCCTCTGCTTTCTCAAAATTGCTTAGGCTTCCCTGAGGCATAGAGG
ACAGCTTAGCCTCCATTTGACCCATGAGCACCTTTGAGGTCCAGAATTGGGACTGGAGCC
AGAGGTTCTTCTTGACCCTTAGTCTCATCCACTTCATTTAAACTCCTGCTGCTGTTGTTA
AAACAGCAGGTAAACTCAGTACCACAGTGGGAGGCTTTGGAGGCTGGCTCCCTCTCAAAG
GCAATAAGACCCAGATGGGGCCTTGAGTTGAATTTTAGGGGCCTAGAGTATTTTTTTTTT
TTTTTTTTAGAGTATGCCTAGGAGTGCCGTGGGCAGGCTTCTAGGAGTCCTGGAACCCTA
TGAAGCTACACGTGACGTTTTGCCTGAATGCGTGTATTTCCTGTGAAAGAGGCTCCATGT
GACTGTCAGAAAGCTTAGGAATCTCAGTTTCTTACTAGACAGCTACCCCCTTTGTCCTTC
AGAGTGTAACTGCTCAGAGCATGGCTTCTGCCCCCTTTCTGCTCCGCCGTTGATCTGGAT
TTACCGAGAATTAAACTGGAGTCTGTTATTTATTGGGGTAAAAAGGACTGCCAACTGGAT
TAATCCCATTGATAAATAAGAGCAGTTGGTTTGTTTGAGGTGGTTTCTAGGGTCGTTGAC
CTTGAATGCTCCTGGAATAATGGGTAGATGGAGATGCACCATTTATTTTGTCCACTCTGT
GGACATGTGTATCATAACAGCACGTGGGGCACTGGGCTATGTCTGGAGACAGTGCGTATT
GAGCATTTACACAGGCAAGGTTACACTGGGAAAGTTATGACCTCATCTTATGCCAGCCCT
GCAGCCACCCTGGTCCAGGAAAAGATGCAGGTTTGAGCATTAGCAGCAGAGGGGTCTGTG
TCTGTCTGCCAGGGTACACACGCTCTGCTCTGTACCTCCTCCGAACATTTCCAAGGATTT
GCTCTCAGGCCGAGAAGCTACTATGAAATGACAAATTGAGAAAGGTTTCCCGTTTCTCTT
TCTGAAAGTAAACAGAAATGAGGATGGAGAAAGATACTTGGGGCTGGATTGTGAAGGGCT
TTAATGGTCAAGGTGTATGAGTTTGAATTCCATCCTATAAATACGGCTCTGCAATGAACA
ACCAGCCCTGGGGAGTGTCCCAGAAGTCCATTCCAGGAAAAGTTAGAGCAGATGTTTCTA
ACCAGTAGATCTGAATCTACTGCTGGGTCATAAAGCCTTAACAATCAGACTTAGCATTTA
GTGAGCCTGAAATATGTGTCTGTACCAGACTGAATGTTGTGAATTTCTGACTCACAGACA
ACTCGTACTTGTGCGTTAATGTTACGTAAATTCACCCTCACGTTGACACGCTTGAACCAA
CCCCCACTTGCAACAAATTCTTCATCACAATCACCTTCACTTGGTACACATGCAGCTTTT
AAATCACTGAAAAGTCTTTGAGCCTTTTCTTGGACTAACCCAAACCCACTGCCATCGAGT
CAATTCCAACTCACAGCATCCCTATAGGATGGAGTAGAACTGTCCCTCAGGGTTTCCAAG
GCCATAAATCCTTACAGAAGCAGACGGCCACATCTTTCTCCCACAGAGCAGCTGGTGGGT
TCGAACTGCCGACCTTTTGGTTATCAGCTGAGTGCTTTAGCCACTGTACCACAAGGGCCC
CTGTCTTGCACTAAAACCAAAACCAAACCAAACCCTTTGCCCTTGAGTTGATTCCGACTC
GTAGCGACACTATAGGAGAGAGTAGAACTGCCCCATAGGGTTTCCAAGGAGTGGCTGGTG
GATTTGAGATGTCAACCTTTTAGTTAGCTGCCAAGCTCTTAACTATTGTGCCACCAGGGC
AGGTAAGGCCAAATAAGAACCATATGCACCTGTTCTGATGTACCTACAAATTCTTGAAAA
CACACTTAGGAATGGATCTCATTCATAACTCAGGGACTGCCTGTAGAAATGTTAATCCTT
AACAATACCCCATTTCCAAATGAGGACACTGGGGCTTAACACATGTGCCCTTGAGCAACA
GTTACTTAACCACTCTGTGCCTCAGTTCTTAGCAATAAATGTAAGTTAACAGATAGCTGT
GTGCCAGCCAGTTTTCAGCATTTTATGTACACAAGTTCTCAGAACTCTGCAACGTAGCTA
CTAATATACCCATTTTGCAGATAAGAATAGGGAAATACAGAGAGTTTAAGTGGCTTGCCT
GGGCTGCACAGTTCCCAGGTAGCAGACCGAGGATTTCAACCTAGACTGTTCAGCTCCAGA
GTCTGTGCTGCTAACCACAGTGCTTTCCTGTGTTTCTGGATAGTTCTCCATAAAGGTTTC
CACCACTCTGTCAGCTTCTCTGTGACCACCCCTTGAGTTCAGTGAAATGGAAAGATGCTC
ATGTCCTTCCATTCAGCATCAGCTCTGCCTTCTCCAAACCCTCGAGAAAGGAAAAAGTTG
GTACTCATCACGGAACATTCTAGAGTGTTCTGCCATGGGTGCATTGCAGCTTTCCCACAG
GTCTCTTGCTTTCTCTCCAGGAGAAGAGGTCGGTGCTGGTCATCTTGTGGATCTTGGCCT
TTCTGGCGGGGAACACCCTGTATGTGCTCTACACCTTCAGTTCTCAGCAGCTATACAACA
GGTCAGCAGGAGAGTTCCACTCCTACAATGGTGTGAAGGGGAGTCGGGGCTTGGTGGGCT
TGGGACACCGAATCCCTTTACCTGAGAATGATGTAGCAGTAACTTTCAAATTCCTCCCTG
TTATATACACACATATACCTAGAGCAGCACCCTCCAGTAGAAACACAATGTGAGCCAAAT
ACGTAATTTTACATTTTCTAGTAACCACATTAAAAGTTTTTTTAAAGAAATAGGTGGAAT
TAATTTTAATAGTAGATTTTATTTCACTGGACGTACCCAAAATGTTATCATTCCAATAAG
CAATCAATATAAAAAATTACTGAGATGTTTTACATTTTTTTATGTTAAGACTTTGCAACC
TGATATTTTATACTTACAGAACGTGCCATTTCAGACTAGCTACATTTCAGTCCCCAGTAT
GGCTGGTGGCCTCCGTATTGGACAGTGCAGACCTAGAATATTTCTGGAAGGATGCATGGG
AAACTTGAAACAGTAGCTGACCATGAGATGGGGACTATAGATCAGAAACTTACTTTTCAC
TGTGTAGCTTTTTGTCTCTTCAGTCTTTTTTCTTCCTTATGAATGTAATAGCTTTTAAAA
ATTATATTAATGTATATATATATCTTTTTAGTCTATAAAGATACACACTTAAACAGAGGT
TAGCGAACTACAGCCATCCACCTGTTTTTATAAATAAAGTTTTATTGGAACACAGCCATA
CCCATTCATTTACATGCTACTTTCCTGCTACAGTGGCAGAGTAGAGTCATAGCAACAGAG
ACCATATGGCCTACAAAGCCTAAAATATTTACACTCTGGCCCTTTCCAGAAAAAGTTTGC
AGACCCCTAACCTAAAATATTAGCTATATTTCTCTAGGTGTTAGATAGGTGGGTTATTAT
TTTTTTGTAGTCATCTATATTTTATAGTTTTTTTGTAATTTTTTAGATAGGTGGGTTATT
ATTTTTTTGTAGTCATCTATATTTTATAGTTTTTTTGTAATGAATATGTATTTTTCCATA
AAAATAGTAGTGCTTTTTTTTTTAATTAGAGGGTAAAAATGTCTACTCATCTGGTTTGAG
CTGGGCAGAAACAAGGGTACAGGGCTCTTGACCCAGTCATGTAACTTCTCAGGTGACTTA
TTAACGCAGCATTCTGTGCAATGTGACAGGCGTGCGGCAAAGCCAGAGAAATCAAATGGA
TCACTTAGCCCTGATTTAGCATAAACTTCCTTAAAATATCCCCATCACATTGGTAGCCCA
CCCCCTAGAAATTCTTTTGAAACAAGGAAGCTGCCCTTCTAGATCTGCCAGCGTTAACTA
AGCAGGCAGGACCTCGCTTGCTCACTCACATAAGTGTGTTAAAAGGCCAAAAGTTGTCTT
TACTAAGTTCTTTCAGGACTGTTGCTAGTCAGTTAGGAGTGAGTTTCCCCTGGTGCCCAG
CGTAGTGCTTAGTTCATAGCATTTGCACTATTATATTTGTCAAATAAATAAATATATCAG
AATTTTCTAATAACTATATTTTAGAGCTGTTTTAGGTTTATGGAAAATTGTGCAAAAAGT
ACAGAGAGTTCTCCTATTCCTTCTCCTGCCTGTGCACTGTTTCTCTTATTATTCCCTTGC
ATCTGTGTAGTATCTGTGTTATAACTGATGAACTGATATTGATATGGTATCACTAAGGTC
CATAGTTTACCTTAGAGTTCACTCTTTGCGTTGTATAGTCCTATGAGTGTTTACAAATGT
CTGTCACTTCCACCTTTACAGTATCTAGAAGAATAGTTTCACTGCCCTAAAAATACCTTA
TGCCCCACCTATTAATCCTTTTCCCTGCCCCCCTGAGCCCCTGGCAACTACTGATCTTTT
CACCGTCTCCGTAGTTTTGCCTTTTCCGGAATGGCACATAGGTGGAATCGTACAGTATGT
AGTTTTTTCTGATGGGATCCTTTCACCTAGCAATATGCATTTAAGGTTCATCTGTATCTT
TTCTTAGTCTCTGAATTTTAAAATTAACTTTATTCTTCTAATTTCAAAAGTAGTTTATTT
TTAATGGTAAAAAGTTGGAAAACACATAAAAAAAACCCAAAATCATTTCCAATCCTATCA
CCCAACAAAAAACTAAAACCAAACCCAGTCCAAGGAGCGCCTGGTGGATTCGAACTGCTA
ACCCTTTGGTTAGCAGCCATAGCACTTAACCACTACACCACCAGGGTTTCCAATCACCCA
ACAGAAACTCTTAATTTTTACGTATATGTGCATATTTGTTATGGAAGTTTTATCAGACAG
AACATACCATTTAATAACCTTTTCTTTTTTATTTAGCAGTGTATTACTTTAAGTCAACAG
GTAGCATTTATTGAAGCTTCCGCTGTGTGTGCCCAGAACTATATTAAGAAAACCTGTCAA
AGAGGGCCCTTAGGGTTACTACTTTAGCCAGTCGGGCATTCTTTCTTTAGGCATTGCATG
ATCCAGGGGCTCAAACAATTCAAGAAAAGGTTAAGAAGAAGGCCTGAAAAAAAGACAGGA
ACCAGGGAAATTTCCGGAATTTGACAGCCAGAATTCATGGACATTCACTCTGATGTCCAG
CTATTGGCATGATTTGATTTTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACAGCTGTGGCAGGACAGGGCCACAGAGTCCAGTGGGGATGTAGGGGTTTTACTC
GAGAATGGCTGTGGTGAGCGGTTTTCAGAGTAGAGAGGCACGGGCTGGGAAGACACCCCA
TGTTAGCTACTCCACAGAATCTGAGGGCTCTTTGCGGAAGGGTCCTAGGAGACCGAGGGG
AAGTCACAGATCCATATCAAACAAAAAATAGCCCTGGTGGTACAGTGGTTACGACCTCAG
TTGCTATCCAAAAGGTCAGCAGTTTGAATCCACCAGCCACTCCTTGGAAACCCCATGGGG
CAGTTCTATTCTGTCCTATAGGGCTGCTCTGAGTCAGAATCAGCTAAGGGTTTTGGGTTA
AGGCACCGCCGAATACTGTGTTCTTTTTATCAATAGTTTACACAGCCAGACACCGTGCAA
AAGTACAGTCTTCTCTTTTAGGCAGTTATGGTGGCATGCTGAGTTTTTTCCATACCATGT
CATTATTACAGGTGAATACAAATAAATTAACTAATACCAAGCTTAAGGAGCCCTGGTGGT
GCGACGGTTAAGTGCTCGGCTGCTAACTGAAAGCTTGGCAGCTCCTACCCACCCAGCAGC
TTCGTGGGAGAAAGACCTGGCGATTTGTTTCTGTAAAGAATACAGAAAGAATATAGAAAA
CCCTATGGGGGCAATTCTGCCCTGTCACGTAAGGTCTCTGAGTCGGAATCGGCTTAACGA
CACCTAACAACAACAACGGTAGTGCTGAGCTGGCAAGAGCTGCTTAAGTGCTCGTTAAAT
TGAACTGTTCTGCAAGTTGAATGTTAGCTGCTTGTACTACGGCTTTCAAATGCAATATTT
ACATTGCTGTGGTCATAGTGAACCATGATTCTCAATAAATTAATGGCTTTTATTAAAAAA
AAAAAAAAATGGTTCCTAGACTTTGGGATTTCACAGACCATTAAAACATCCCCAAAACAA
AGTCCAGGGGTCCACCATGTATACCAACATGTTCTTTTAATTAAGAACATCTTAAAAAAA
ATGGTGATTCCCCCCCCACCATTATATCCTAAAAGAAAGGGATTTTAACACCAAAGGATT
AATAAAGAGCAGTCCTTTAGGTGGAATAAATTTAGATTCATTTAAAAATATGTATGTTTG
ATTTGAATAGATGGAAGATTTACAATGAATTTGTATTACGATTCTAATTTTAAACTGTAA
TGAAGTAAAAAACCAGTATGTAATGGTGGGAAAAAAAAAATATTAGGGAGTCACTGAGCT
AGAGAATGTCACCAGGCTGGAGGTGCCCACTGCAGAAACCAGCAGGACTGTTGTGATTGA
AAGAAGAGTTTCTTGTGGATGAGCTGGGGGCTGGGGGGAGAGAGAAAGAAGGAGGGGAAG
AATGTCCGTCAGGGAGAGCCTCTAGGACAAGGTGAAACTCGAGCCAGGCTTTCTGATGAT
GTTCATCTGCCTTGAAAATGCACTTTGAGGAATGAACGGTTACCCTACCCTCTGAAGACC
ACCCCAAAAAAGCAATTTGGAGAGGCTGTTCCAAGGCATCAACACCCATCTCACATCCTG
CATTAGTTATGTGGTTCCTGGTGGGGAGCAGAGGAGGTGCAGTTTCCCAGAACCTTCGGT
AGATTTCCAGCTGAATGCTATTCTCTGGCCACGGTCAGGTTCACAGGCTCAGACCTCTGT
GCCCTCGTCAAGCCAGGGCCGAATCAGACTGGCAGCACAGAGCGAGAGAGCCAGAGTGGC
TGGAGAGAAACGGACCAGAGCAGACTCCTCTTCCTTACTGCTGTCTCAGATCTCAAATCT
GGTTGCAGGTGATACCAACACCACCTTTTCTTATTTTGTCCTCCCAGTGACCAAGCAAGG
TATCACTATGTGTATTTCCCAGGTGAAGAAACAGAGCCCTAGAGAAGCCAAGTACATGTT
TTCAGAGTCACATGGCTCTGGACAGCAGAGCCAGCCACCCAACAGCCAACTCTGTCCAGA
GCTTAGGGTCTTAACCACCATCTCTCATCAGAATCACCCAGAGAGTGTCTTGTAAAAATG
TGTATTCCCAGGCCCCACCCCAGACCTAGTGAATCAGAATCTCTAGGGTGGGGCCCAGGA
ATCTGCCTTTTTTATGATGTTGCCTGGTCCCTCAAAGTGTTTGGATGTGTCTAGGAAAGT
TCTATGCTTTCACTTTGGTCCAGTTGTGCTGACTTCCCCCGTATTGTGTGTCGTCCTCCC
CTTCACCGAAGTTGACACTTGTCTGCTATCTACTGATTTCCCTTCCCCCTCCCTCTCCAC
CTCAGGTGATTCTGAGGCATGTGGAAGTTTGAGAACCTCTCAAGTGTTTTCTGGTTCTTA
ATTCTTGCTGTGCATTGGAAATTCTGATTTAATTGGGCTGAGTTGGAATGGACATCAGCA
GTTTTCAGAAACTTCCCTCTTGATTCACATGCACAGCTTGGGGTTAAGAACCTCTGCTCT
TTGCTCTAGAATTGGAAAGATTTGACACCACCTTGCTAACTATATTCTCAAAAAGGAGGA
TTTCAATCCCAGTGACATCATCAGAGAACTAGGTGTGGTTGGGCTGCCCATCTCCTCTGG
AAGTAGGGATGGTACCGTTGACACCCTTTTTTTCTCTTTTACTTGGAAGAATCCAACCCT
TCTGGGCTGACTAAGACAGCACTAATCCCAGACCGACTCTGTCGAGCTTGAGTCTCCACC
TTCTCCCATCCATGATCCCTTCCATACAGCACAATTGTATCAGTCAGGATCAGTTTTGCC
ATTGCTGCTATAACAAAACTTCTTACTTTCACAAACAATTGGACACTTGGCTACTAACTG
AAAGGTTGGCAGTTTGAATCTGCCCAGAGGTCCCTCAGAAAAAAGACCTGGCGATTTACT
TCTAAAAGATCACAGCCATTGAAAATGTTATGAAGCAAAGTTTTACTCTGATACCCATGG
GGTTGTCTTGAGTCAGAGTCAACTCAACAGCATTTGGGTAAAACAAAAAACTTTCTCATT
AGTTTATTTCTTGCTCATTCACAACCCAATGCAGGTTGGACAGCCTTCCCCCATCTTTTA
GCTATACCATCTGGAACATGTAGCCTCCAAGGTCACTTTGGCAGAGGAAGATAAAGGGAA
GCAAGGACTCCCACAAGGGCTTTTAGGGGAACATCACTTCCTGGAAGTGGTGACTATCCC
TTCTACCTACATCCCATTGGCCAGAACCCAATCACACAGCCCCAAATTAACTACAAGGGA
AGCTGGGAAATGCTGTTGCTGCTGTTATGTGCAGTTGAGTGGAACTGCTCCATAGGGTTT
TCTAGGCTGCAGTCTTTACAGGAGCAGATCGCCAAGTCTTCCCCCCATGGAATCACTAGA
AGGATTCGAACCACCAACCTTTTGGTTAGCACCCAAGCACTTAACTGTTGCACCACCAGG
GCTCCTTCTAGGAAATGTAGTCTTCGTCTATTCCCAGGAAGGGGGAACTGTGGTGAACAC
AGTTACCTGTGCCACAGGAATCCATTAGTTAATAGCAAACCAAAAGACCAAACCCATTGC
CATCGAGTCGATTCCGACTCATAGCAACCCTAAAGGACAGAGTAGAACTGCCCCATAGAG
TTTCCACGGAGCACCCGGTGGATTCTAACTGCTGACCTTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCCTTTCTTTGTTCCGCATCTTGACTGTG
CTCCATACCTCTCTGAATCTGTTTGTACCACTGATTAGGGAGATTGTCTGTGGTGCTGCC
TACTTGCATTCCTAAATTTGGTTTATACACCCATTTCTTATTAGGTGCCATCAAGTCAAT
TTTGACTTACAGCAATACCACGTGACGAAGCAGAGGTGCCCCATAGAGTTTCCTAGGCTG
TAATCTTTATGGAAGCAGATTGCCAGGTCTTTCTTCCTTGGATCCATTGAGTAGGTTCAA
ACCTCCAACCTTTCTCTTTGCAGCTGAGCACTTAACTGTTGTACCACCAGGACTCCTTTT
TTGGTGGCACCCTGCCATGTTTATAATACAGGGAGGGTTTGGTGGTCCTAGGTCCCTCTT
TGGTCTGTGGTCGTGCCTTTCCCTGTGATAATCCCAGGCTAGCTGATTGACTTCCACAGT
CGGCCCTCTCTGTTATCTTTCTATGATTGCAGCTAGATGGAGACCTGACTTACACTTTGT
GTGTTTTATCTCAGAGGCATTGGTTGGTGTTAAATGCATTTATCAGGATTTTCTCTTTTC
ATCATTTTTGTGCTTTTCCTGTTAGTTTTTTTTTGGGGGGGGGGTGCAAGGGTGTTTTTC
CACAGGTTGATAATTGTTTGTATTTATTTTTAAAGTACTAGAAATTGAATTTAATCCTCT
AGGAACTAAAAGATTTGACATCACCATCACTGTTATATTCCTAGAAAGGAGGATCTCCAT
CCCAATGACACTATCAGAGAACTATAATAACTTAATTAACTATGTAACTAATAACATACC
AGTTATGAAAAAAACCAAACCCATTGCAGTTGAATTGATTCTGACTCACAGCAACCCTTC
AGGAAACCATAGGGTTTCCAAGGCTGTAATCTTTATGGAAGCAGACTGCCACATCTTTCT
CCCATGGAGTGGCTGGTGGGTTCAAACCACTGACCTTTCGATTTGCAGCTGAGCGCTTTA
ACCACTGTGCCACCAGGGCTCCTTACACCAGTCATATGAACTGATAAATATTTTATTGTC
AGTTTTATTTCTCATTAGGTGCCACTGCCAGTAATTACAGTTATTAGTCATAAAATAATA
ATATTAATTATGGTACAGTTATGATGTGTCAAATGTTTCATACTTTATCAGAAACTTTCG
ATTGTCTTTTAACATTTCATTTTCCTAGTTAGCCTGTTCAAGTGGATAAGGTAAGAGTTA
GCTTGCTCCTGGTTTCAGAAATGAGGAAACTAGGAACGACTGAAAGAGATTAAATTATCT
GCCAAAGGTCACGAAGCTGGTAAGTGACGGGATTAAGAATCCCAGATGTTGGGGATTGGT
CCTTGAATCCTGGGCAGATTCAGCCCCAGCCTTCCCTGGGCTGAGACTCATCAGGAAGGG
CCTAGAAGTCCCCCAAGTATACTGTGCTCCTTGGGAGACAGCTAGAGCCTACAGGACCCC
ACCGACCTTACATGAATGGCCGCTCAGACTTGAAGGCAAGGAATCCCTCAGAGACAGAGC
TGGGATGTGGGAAGGACACTGGTGGTTTTACAAGCGATTGCCTACCAACATAGATTTTTT
TGCTAACATTTGCCTGCTAACGTTGTTTTTGCCCTGCTCTAGCTTTTTTAAGGTTTTTAC
TATAAATAGAAATGTATTGTTTTCTTTTTCTTTTTTCTAATAGAAATAGGTATTTTTTTA
AATAAAACAGAGGCCAGTGCACTCCTGTTATCGTTAGCTGCTGTCAAGTCAGTCCCCAAC
TCGCGGTGACCCAGTGTACAAACAGAACGAAAACGCTGCCTGGTCCTGCACCATCCCCAT
AATTGGTGTGAAACAGAACTGGTGGGTGCTTCATAGGGTTTTTATTGGCTTGAATTTTTC
AGAAGTAGGATTGGCAGGCCTTTCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCAGCAGATGATAAAGAGATCTGGGGAATGACCATTGAGACAGAGATGTGAACCTAGGCA
CGTGAGAAAGCTAGCTCAGCAGTGACTGCCTAGAATAATAATAGCCTTAACAATAATAGC
TTGGAATTATTGCGTAGCAAATTTGTACTCCAGACTCTATGCTAAGAATGCTTTAGGTAT
GAATTATTTCACTTAGCCTTATGACATCATCTGAGATAAAGCACTGTAGTGGGTTGAATG
GTGGCCCCCCAAAAAGATAAATGTCCACCCCAAAACCTGTGAATGCAACCTTATTTGGGA
AAAAAAGGGGCTTTTCTGATGTGGTTAAAGACCTCAAGATTAGATCATCAAATGTCCCTA
GAAGAGAAAGGGAGGACACAGAGACAGAGAAGGCCATGTGAAGATGGAGGCAGAGATGGG
AGTGATGCATCCACAAGCCAAGGAATGCCTAGAACCACTAGAAGCTGGAAGAGGCAAGGA
AAGATTCTCCCCTGGAACCTTCAGAGGGAGTACGGTGCTACTAACACTTGATTTTGAACT
TCTGGCCTCCAGAAATGTAGGGGAATAAATTTCTGTTGTTTTAAGCTACCAAGTTTGTGG
AAATTTGTTACAGCAGCCCTAAGACACTAATGGAAGCCTGGTGTGCAGTGGTTAAGTGTG
CAGCTGCTAACCAAAAAGTCAGTAATTCGAATCTACCGGCCACTCCTTGGAAACACTGTG
GGGCAGTTCTACTCTGTGCTGTAGGGTCCCTATGAGTTGGAATCAACTCGATGGCAATGG
GTTTGGTTTGGCTTGGTTTAGAACAGTAGTAGAGGTACCATTACACTCATTTAGGGATGA
GGAGATCGAACACTGGATAGGTCACAGTGTCTCGTAGCGGTAGAATTAGAATTGCAGCCC
AGGTCTTTAGAGCTACAGTGAATTTGAGAGAAAGATAAGGAAGGCAAGAAGCTAATGGTT
ACTCATCACCAAATCATTCGGGGTTCTTGCTGGATTCTTTCCCATGACCTGAAACATCTA
AGGCTGCCCACACCTCTGTGAGAGAGAATTATCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCAATAAGCCTGGGTATAAATCTTGGCTCG
GCAGCAGGTCACTTCACCTCTTTGAGCCTTCTGTACCTCATCTGTAAAATGGTTCATGTA
ATAATACCTCTTCGGTGGGTGTGTCATGTGGAACAGTGACTTCAGTATAACGTGCCCAGC
ACATCATGAACACCAGCAAGCGTATGGGCCATTATCATCACTGTTCCCACTAGAGCAAAG
AGGAACTGAGGAAAAGGTGCGGAGGTGACTTCCTCAAAAGCCTTTTGGGTAAACTAGGGA
GAGGGGAAGGCAAAGGACTAACACCACCTCGATTCATGTGCCTGCGCCACCATTCCCTGG
CTGGGTAACCTGGGGCGGGTCCCTTACCCCTCTGAGCCTCCGCTCCCTGGTCTGTTAAGA
CAAGGCTGAGAACAAAACTTCCTTCACCGGGCGGCTGTGAAATCATGCAGGCTAGTCACC
TTGCACCGCTCCAGAGCTCAAGTCCAGGGGACACTCGGATGACATTTTCAAATAAAAGGG
CTGGTGTGAGCGGGCGAAGACACGTCGAAAAAAAATGGAAACGACACCTTTGCCTTTCGC
AAACGGCCAGCTCCTTTGTCCAGAGAGCCAAAAGGACCTCAGGCCCGGGGTCTCTTACTG
GCCAGGGGCAACGGGAGGCACCAGCCCGGAGTCGGCTGCACCGGCGGCACGGGGCGCGGG
GCTGTGACCTCATCGGCCAGCGCCGTCCCGCGGGGCCATGAGATCATGAGATGCCGGCGC
TCGCCGAGGAGTCGATTCGTTGGCAGCGCGGGGACGGACGGTCGCCCGCCGCGGTGATCT
CATCCGGGCCCGGGGGAGGAGGAGGCAGGCGGCCCGGCCCGCCCGCGCCACCCGGGGGGG
GGCGGGGATCGAAGGCCGCCGCCGGCCGGTGACGTCACCGGCAGCGCCCGTTGCCAGGCG
ACGCGCGGCCGCCGGCCCCGCCCCCACGGCCGCGCTCTCGGCATCGTTCTGTCCTTGCTC
GCTGTTTTTTTTTTTCTTTTTGTTTTAAGATATAACCCGCGTACGGTAAAGTGCTCTAAT
TATCAGTATACAAGCTCGGTGAATTTTGTATAAAAAAAAAAATTTTTTTTTTTTTTTTTT
GACCACTACCCAAATCAGGGTATCGTACGGCTCTGTCCGATAGAAATGGAACACAGTCGC
ATAGGCAATGTAAAATTTTCCAGTTAGCCACATTAAAAAAAGTAAACAGAAACAGGTGAC
TTTAATTTTAAGAATATATTTTATTTAGGGTCAATATGTCCAACATACAATCATCTCAAC
ACGTCATCGGTATAAAAAAATTTAAAGGAGATTTTTTACCTCTTTTTTTTTTTGTTGTTG
TTTCCTTTTGATTGGCACAGTGGTTAAGCGCTATCGCTGCTAACCAAAAGGTCAGCAGTT
CGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACAAGCTCCCATAGTAGAACAAACT
GACAGATGGATGGTGGTCCCGTGCCCATAGTAAGTGCTTAATGAAGAGATAAATTTGGTT
CCTCTCCACCTCCACCTCTCCTGGTCTCTCCCTCCCAGGTTCCCTTTTTATTCAGGCCTG
TGACTATCATTCTCCCCTCTCTTCTGCCTGCAGTCCCTTTTCCCCTTCTATTTCTATCTC
ACCCCCTCCCTCCCTTACTGCATCCCCCTCTAGACTTTCTTCCATTGCTTGTCCCCCCGC
ATCAACACGACTTTCTCTCATGATTACGTTAGTTCTAAACTTACTTGTCAAACCTCCCCC
TGCCTTTAAAGCCTTCTCAAGATGGAGCAGACCTGGCTTGGGTGGTTTGTCCCCTCCACC
CATCAGCTCAGCATTCCAGAGGTCGGTGTTCAGGCTATTTTGTTCTGAAGGGCTCTGTCA
GCAGCTGTCCCCACCAGAGCCCTACAATCATAACAGACCTGCAGGCCACCTTCCCAGGAA
AACAAGTCTTTGTTTTCAGGCCCCTGCACCTGCCCAGCCTGCTCGTTTCAGAGCAGGAAA
TGTGGCCCCATCCCCTGTGGCCGTTAGGCTCTAACAAGCAGTCCAGGGGAAGGAAAGCAA
AGGAGGGAAAATCACCGTAGAGACAGAATGACTGCTTGGACTTCCCAGGGGCTCTTCTGA
CAATGGAGGCTAGAAGAAATTTCTGCTTACTTTCTCCCCAAGTTAAAGGAGGGCTTTTAA
ATGTGGTCTCCTTTCCTGCAGTAGTTCTGGCTAGCTTTCTGTTAAGGGGGTGTCCTCTCC
CTCAAGGTGACTGTGAGTCACAGCGCTGTCCCACCATGTGACTGGGCCTGACCAATAATG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTGGACTCCAGCAGGGC
TTCCAATACCTGCCACTCGATTTGGTAATTGTACCCAGGAAGGAAGAGGGTCACTTTTCC
TTTTGGAATTCAAGCTGTAAGAGTGTTGACGTGGAGCTGCCAGTGGCCATCTTTCCTACC
AGATATAGGTGGATCCAGCACTTCCTAGCTGTGTGACTAGAGGCAGGTTACTTAACCTCT
CTGTGCCTCCATTTCGTCATCTGTAAAATGAGTGTTAATAGCACTTAACTCAGACTGTTG
TGTGCAGAGTGGTACCTAGCACATAGTAGGAGATGAACTATCATCGTCATCATTATCGTT
GCCATTATGGTGGAAGAGTATCCCCTTGGCAGGAGATAATGAGGCCTGCACACCAAGAAC
AGCTGAGACAACCCAGGCTGAGAGGTATGGAAGAAGAGGAGAGAGAGAGAAAGACAAAGC
TGTATAGCAATATAGAAAGATCTTAGACCACATTGTTTGCATTCCTGGATCCAACTGTAC
TTGAAGCCAGAGGTACCTCCATATTCCCAGTTTTGTGACCCAATAAATCTCCTTCTTTGT
GTAACTACTTGAGTTAGCTTTCTGTCAGTTAGAACCAAAAGTGACACAATTATGCATACT
CTTAAATCACTAGTTCTTGTAACAGTGCTTGGGGCCCAGAATATCAGAACTGGACCAACA
CCCCCATTACACAGAACAGAAGACTGAGGCCCAGAAAGGGAGAGCAATTTGTGAAGGCCA
CGGGTCCACAAAGGATACACTCTAGCTAGCTTACTTCAAACTCTACATTTTTAACATTGA
CTTCATATCACAAATGTATTCTTTCCCACTCTGTTTTCCTGGTCCACTGCCATCCCGTTT
AATCAGGCTTAATTCATTTTGTCTGTTTTTTTTTTTTTTTTTAATGGTTGCCAAATTGCT
AGCCATGGCTATAGCTAACGCTTACTGAATACATACCATGTGCCAGGCACTGAACTCAGT
GCTATCCATGCTTTAGTTCATTTAAAACCTAGTGCCGTCAAGTCAATTAGTTCATTTATC
GTCCCAGAAATCCTAGGAGGTAGATACTGATGAGGAAACTGAGGCATAGAGGGATGAAGC
AACTTGCCTGTGATCACCCAGCAATTCAAGCCCAGGTCATCTGACTCCAGAGTTCATGAC
TTCACCATCATGCTTGCTCAGACTCCAGGGTCTTACCAACTTGTAAGAGACAAAGGGCAA
AGAACCCAAAATAATAGTGGCTTAAATAAAAGAGAAATTTATGTCTTTTTCATGTAAAGT
CCAAAGATAGGCAGTCCAAGCCTGGTATGGTGACTCCTTCCAGCTTACTGCCCTACCAGT
TCTAGGGTGTGGGATTCCTCCTCACGGTCCAATGTGGTGGCTAGAGTACCAGTCGTCACA
TCTAGCTCCAGACCACAGGGTGGAAGAAAGGGGGAAGAATAAGGCCAAAAGTTCCTTGAA
ATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATGTCTTAGCGACT
AAAATGATACCTATCTACTCCTAAGTGCGAGGGAAGCTGGAAGATGTAGTCTTCATTTGA
GATAGCTGTGCATCCAACTAAGAAATTGAGGGCTGTAGTACTAAGGAAGAAGAGAAAAAG
AGATGCAGGGGTGACAGCCAGTAGCTAGCACCACACCCTGGCTAGCCACAGGGGAAAGAT
GGGGAACGAGATATGGTTGCCTACACTCATGAAGCTCACAGCCTAATCAGTGAAACAGGT
AACAACAGCAGTAATAAAGTTATTGAGCACTTACTCTGCCAGGTGCTTTACATGGCTTAT
TTAAATTCAGAGATTCTTGAATATTTTAGACTCAGAACCTCTTTATACTCTTAAAAATTA
TTTAAGACCCCCAACGATCTTTTGAGAGTTTTTTTTACAATACTTATTTACTAATTAAAG
GAACACTAATTAACCCATTACGCTGTTAACGTAAATATTTTAAATGAAACATACCTATAC
TTAAAAAAAATTTTTTTTTTTGTTTTTGTGAAGGGGCATTGTTTTACATTTTTGCAAATT
TCATTAGTGACTGGCTTAATAGATGATAAGGAGCCCTGGTGGCACAGTGGTTAAGTGTTT
GGCTGCAAGGTCGGCAGTTCAAACTTATCAGCCACTCCTCAAGAGAAAGATGTGGCAGTC
TGCTTCTGTAAAGATTTACAGCTTTGGATACACTGTGGGACACTTCCAGTCTGTCCTGTA
GGGTCACTGTAAGTCAGAATTCACCCCACCTCAAGGGGTTTTTAATAGAAGATACCAAGA
TTCTCACATTTGTTGGAACATTACATGTCATGTAACTTCAGGAAAACTCCACAGTGTACT
TGTAAGAGGGAGTGAAAAGCAAGTAATGTCTTGGTATTATTATGAAGTGGAGCCCTGGCA
GTGCAGTGGTTAAGAGCTATGGCTGCTAACCGATCAGCAGTTCGGATCCACCAGCCGCTC
CTTGGAAACTCTATGGGACAGTTCTACTCTGTCCTGTAAAGTGGCTATAAGTCAGAATGG
ACTCTGCAACAACGGGTTTTGGTTTGGTATTATTATGAAAGTAGTTTTGACCTCACTGAC
CCTCTGGAAAGGTCCTGGACCATACTTTGAGAAGTGCTGATTCAGTTTGATGCTCATGGT
AACCGTATATAGTAGGCACTGTCAAGTTCACAAGGTTCCCCCGATGCAAACCCTGAAACA
GGGATTTGTGTGCAAGTTGTTTTTTTGGAAGGTGACCTCTGGACGCTCAGTGAGGGAGTA
GCAAAGAGGATTTCATATATATGTATAAAATCATCCCCAATTTACAGATGAAGAAACTGA
GGCTCAGAGAGGTGAAAATTAGCATCCAAAATCAAGATTTAGTAAGTGGCAAATTTCAAC
TTGGAATCTCAAATCCCATACCCTTAACCGCTGTACCATCCTGCCTCTAGATGAGAGAGT
GTGTATGAAAGAGATTGGTAAAGAGGCCGAGCTGTATAAAAATTCATTATTAATCTTGAT
GCAGAGAAAAAAAATTTTCATTTGGCTTCTCCATCCCTTGATGCATTGGTACCACTAACC
GCTCTTAGTGTGTGTCTCTTCCTCTTCCTCCTCCCCATCCCTGTAATTCTTTCAAAATCA
TCTTTCCTGTGTAGATGTGTTTTTCCCTTAAAAAATTCCCCTTCTCTGTTCATTGCTCCT
TGTTTCTCAGCATCCCACTCTCCTTCACGTACCACCCCCTTCTGGAGTCAGCCCTCTGTT
GTTTCCTATTTCACTTTTTGTCAAGCCCTCCACCCCACCTTCCATCCCACCCGAAAAGTC
AGAATAGAATCCGCCTTCCAAACACGACTGCTCCCTCCCCGAGTATCAGAATCCAGGCGG
AGAACCTTCGGTGCCCAAGCACGTTCCACAGCAGTTGCTACCGTTCCCCATTCCCCCATC
ACAGGTGGCAGGGAAGCCAGACTGCTCAGCGTCTGTTTGCTTTCCTTGTTCTCTGACACC
CCGGAGAAGCCACACACTCTATTTGGTGGTCGTCAGAAATAACATGCTTAAGAAACCTGG
AATTATAAAACTGCTTAATTAGGCAGACATGGTTTCCCTGGGATATGCCCAGTTTTCCCC
GGTGGTTTTATCTCCTTCTCAAAGTGGCCCGCCCCTCCGCAGCTAATTGCTACCTCTAAC
ATGGTGCCACAGGAGCACTCACTCCTTTTCATTTTCCGTGACATCCATGCTTGCTTACAC
AGAGAAGTTCTCTCTCCCATGTTCCAACATTCCTTCTCCGTTAGTGAACTCTAGAAGTGA
GCTTTAGCCTCTGAGGCCCCCGAGTATTAAATGAGCACCTGCTATGTGCTCGATGCTGGG
GATGCAGCCACAAAGCAAATTATCTTGTCTCTGCAGTGGGAGAGACAGATACTAAGATAA
TTTTTAAAACATTGTGAGAAGCACTTTGAAGGACTGCTTCAGGGTGCTCTGGGAGGGTAT
AACAGGAGGATCAAACTTAGTAAAGGAGCCTGGGAGGGCTTCTCATAGGAGGAAACATTT
AACTGAGACCCAAAAGATGGATAGGTAGGTGTTAGCTCAGCAAAGAGTAGAACCAATTGC
TGTCGAATTGACTTCAACTCACAGCAGCCCCATGTGTGTCAGAGTGGAACTGTGTTCCAT
AGGGTTCGGTTTTTTTAAATTTTCATTGTACTTTAAGTGAAAGTTTACAAATCGAGCCAG
TCTCTCATACAAAAATTTGTATATACCTTGCTATATACTCCTAGTTGCTGTCCCCCTAAT
GAGACTCCATAGGGTTTTTAATGGCAGATTTTTTGGAAGTAGATTGTCAGGTCTTTCTTC
CAAGGTGCCTCTGGGTGTACTTGAACCTCCACACTTTCAGTTAACAGCCAAGCGCGGTCA
TTGTTTGTACCACCCAGAGACTACCAACAAAGAGTAGGGGGACTGGTGCTCCATCAGCAA
AGGAAGAGCTTGGTGTAGTCAAGGAACAGGAAGGAAGGGTGAAGAGGCTGGCATTTGAGC
CTCCTGAGAAAGTCTAGGGATGTGTTGGAGTCCCCATTGTGACTTATGTCAGTTCTGATA
TCCTAGACCAGGTGATTGACAAACTATGCACTGTAGGTCAAATATGGCCCTTCACCTGTT
TTTGTAAGTAAAGTTTTATTGATACACAGCCATGCTCATTTCTTATATGTTTTCTGTGGC
TGATTTCACTCTACAAGGGCACGGTCGAGTAGCTGCAATAGAGACTATATTGCTTGCAAA
GCCAAAGTATTTGCTGTCTGTCTTTTTTCAGAAAAAGTTTGCTGAACTCTCTTCTAGATC
ACCTCAATAGACAAGTGAGAAGCTTAGGGTCTGGGATAGGGGGTGAACTCACAGCTAATC
TCTGAGGATTGAGGGATCCAACGACAGTGATCAAGTCTAAATAAGAATAATAAGCTGGTA
GGTGACAGAGCCAGGCTCCAAGCCCAGGCTGTCTAGCTCTCAAGGCTGCCCTCAACCACT
AAGCCAGCCTGGTTATGGGAGGTTAACCTAAGAGGGGGAGCAGAAGGGGGCCAGCAGGAT
CTGTCAGGAGAGTCAGCCAGACACCAGAATGCAGAGACTCCCAGAGACACAGGGACATAA
GACCTTTTATCTAGTGGATGTGTCCTGACATGCCATGAAGCCAGGCAGACTGAGCAGGAG
ACTGCCCACTGACAGAGCACAGGGGCATTAGCCATCCTTTCTCTCACTCTTTCTCCCTTG
TCCTCCCCACATTCCCTTCACCTGCCTGACTCCTACTTGTCCATTAAAATAGCACTTCTC
CAACATGACTGTGCACAGAAATCACCTGGGGGACCTTGTAAAATTGCAGATTCCAATACA
GGAGATCTGGGGTTAGTCCTGAGATTCTGCAGTTCTCACAAGCACTTAGGAGATGTTGAT
GCTATTGGTCCATGGACCACACATTGAGTAGCAAAGGTTTCAACATCACTTAGGTGATAC
TTCTCTTAGAAGGCTTGCCTAACCACCACCACCATCACCACCCCCACCCCGATACACACC
ATACCTCAGCTTTGCTCCCGGGTTCCCCTGGTGTTTCCCTCAAGCATAGTTCTACTACAC
TATATTGTAATAAATTGTTTACTGCTGTCTTCCTTAATAGGTGGCAAGTTCCTTGAGGAC
AGCAATGATGTATTAGTTATTTTGATATCACCAGAGCCTGGTTCACAGTGGGCACTCAGT
AACAGGAGAGAGAGGAGTATAGTGGGAAAGTGAGAGGAGGGAGGGAAGGAGTAAGGGGAA
GGTAGATGGTGGATAGATGTATGGATGGATGAGAGGTGTCATGAGGAGGGGGTCGCAATG
ACTACTCCAGACGATTTGTGTCTTTCCACAATGTCTTCATTAGTTATTAGGCACACAGGT
TCTTGGCTACCCTGGATGCCAGAGATCTCAATTCACCAGGGGAAAGGAGAGGGAAAGCAA
GCAAGCTTACGGCAAATGAGGATGGTATTTGGGCTTTGTTGTTCTCTGGTCCAGGCCAAC
TCTTGACCACGCCATCATTGGTGGCTCAGATGTCACATCAGCCTCGGTCCCTGAGAATCT
CTCGTGGATTTTTGTCATGTCCCTTGAGGACAAGGGCTTATTATCCCTTATCTCTCAACG
TATGACTGAAGCAACATGTGTCGGTTCGGGAGTGAACTAAGGTAAGCCTGGTGAGCTGCT
GCAGCCCACTGTTTCCTAGCTCACTGAGTCTCGACCCTCAATGTATGACCGAGTTAGCAA
CATCCCTAGGACCTGGGAATAAGCCCAGGCGAGCTGCCGCAGCCCACTGCTTCCCAGTCC
GCAACATATGACCGAGTTAGCAACGTCTCTAGGACCTGGGAGTAAGCCCGGGTAAGCTGC
CGCAACCCACTGCTTCCCAGTCCACAACATATGACCGAGTTAGCAACGTCCCTAGGACCT
GGGAATAAGCCCAGGCGAGCTGCCGCAGCCCACTGCTTCCCAGTCTGCAACATATGACCG
AGTTAGCAACGTCTCTAGGACCTGGGAGTAAGCTCAGGTGAGCTGCCGCAACCCGCTGCC
TCCGAGTCCACAACGTATGACCGAGGTGGCTCTGGTTATGACTCCAAGTAAAGCTGAGTC
ATAGTGTCCCTTGTTTTGTACACACTGGAGCTCTTTGAGCCCGTTTGGTTGGTATTGATA
AGTCCTTGTTTGTGACTTCGTTGGTCCCAGTGTCTTCTGTTAATAAGGTGGTTTTTCTCC
TCTAGGTTACATCATCTTCGTTATCTCTTTTCTTCACGTGTTGTTCGCTTCTACATTTGC
TTTCAGCTAGCCTGCTCTCCACAGGAGGGAAGGAAGAAAGGAAAGAAGACGGATGGATGG
ATGGGTGGGAGGATGAATGGAAAGAAGGAATGTTGAATGGATGGATGGAAGAGGAGGCAA
GAGGGAGGGAAGAAGGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGAGGCATGGCAAAGCAAG
TTAAAAGTGGAAAGTTGGGAGAGACTGGGCTGTTGATCCTAGATGAGATAGAACATGCAT
TATTTGAGGAATTTGAGAGAAAAGAGGGAAGTGTGGGGCAGCTGAAGTCAGGTGGTTCAG
GAAAACAAAGTCCAAAACATGGGTATTCTGTAGAGCCTGGGGCCTGCTGTCAAGATATAG
ACAGGATGGGGCAGCCCTAGTCATTCACTGAGCAGCTATACCATTGGTCCAGTATCCCAT
CATGCCATTGGTCATGTAAAACAAAGATGGTGGCCATCTCCCACATCTCTCCTCCGCAGC
CCCCTCTGCCTTCCCACAGGCTCCAGAGGGATGTTTGTGGGAGTAAGGAGAGGAAAGTCC
CTTGGGAAATGGGGATCTCACAATGGGGAGGGGGCCAAACAGCCACAAGGTCAGGCAGTT
GGGTGAGTGTCCTTGATCCTTGGCAGATGTGGGAACATCTGCTTCAAGGGATCCCTGCCC
ATCAGAATGGAATATAAAGGGGTGGTTATAAGTCTCTGGAAACCCTGGTAGCGTAGTGGT
TAAGTGCTACAGCTACTAACCAAAGGGTCGGCAGTTCAGATCCGCCAGGCGCTCCTTGGA
AACTCTATGGGACAGTTCTACTCTGTCCTATAGGGTCGCTATGAGTCAGAATCGACTTGA
CGGCACTGGGCTTGTTTTTTTTGGTTTTATAAGTCTCCATCCACATGCTAGGTATCATCC
ATCTGACGGATATACAATATATTTTTATAACATTTATTTTTTCTCTCCAATTTAAACATA
TATGCTTAGTACAAAAAAAAATTGGAAAAAGACAAAGAAAATGAATCATTTTGTATGCAG
CATAGGTTAATAACAGTCTTTACCAGGATGAATATTTTTTAATTTTTAATTTTGAAATAA
TTTTAGACTTAAAAGTTGCAAAAATAGAGCAGAGAGCTCCCATATACCCTTCGCCCAGCT
TTTCTTAATGTTAACATCTTACATAATGATAGAACAGTGAGCAAAGCCAGGAACTTAGGG
TGGATACCATTAACTACTACAGACCTTATTCAAACCACCAATTGTCCCACTAATGTCCTT
TTTCTCATCTAGGATTTTTTAGGATTGAATCCAGGATCCTACATTGCATTTATTTGCCAT
GGCTCCATAATCTTTTCCCATCTGACAGTTCCTTGGCTTTTTCTTTGTCTTTCATAATCT
TGACTGTTTGGTTAATGTGTCCCATGGCCTGTTTCTTCACTGTGAAGTTACTATTTTTCT
AGGATAATTTTTTAGTGGCTACATGGTTTTCTGCTGTCCAGTTCTGCCAGAATCAGCCCC
TCTTTTTGTATCTTTAGTTTGTTACCTTTTTCCTGTTTTATTGTTACAAAGAGTGTTGCA
GTGATGTTTCCAACTGGCACAGCCTTGCACCTCTCCCCGGTTATTTTGTAAAGATACATT
CCTAGAAGTAGAACTGCTGGAGCAAAGATTATTTGTATTTTTAAGGCTATGGATGCCTGA
GACAGTGTTACTTGTTTGTATGTTTGTTTGTTTTAATCGGCTTTACTGAGATATAATTTA
AATACAGTAGAATGCACAAAAATATATGAAGCATACATTTCAATGAATTTTAGCCAACAT
ACACATCCATATAACCAGCATCTCAATTAAAATATAAAATATTTCCATCACGCTCCCATC
AAGATTGCTCTTTGCCCCCTGGAGGTTCACTCCCCTCACACGCCCTTACCCCAGGCAACC
ACTGATTTGATTTCTGTACTCACAGTTTAGCATTACCTATTCTAGAAAGCCGCATAAACC
AGAATTATATAGTATATACTCTTAGGACTGGTGTCCTTGATTTGACACTAATGTCTATGA
AATTCGTTCATGTTGTTGCATGTCAGCCATTCCTTCAATTCTATTGCTGAGTAGTATCTT
ATCTTATAAATATACCACAGTTTGTCTTTTCCTCCATTATGGATGTTTGGGCTATTTCCA
GTTTTGGGGTATGATGCATGAAGCTTCTATGAACATTTGCATGCAAATGGACATAATTTT
TGTTTTTTAAATATTTTATGTTTTCAGTGAAAGTTTAGGAAATTGGACTCTGATTTAAAA
ATTTCTGTCTGTATTGTTCAGTGACCTTGGTTACATTCTTCACAATGTATCAGCATTCTC
GTTATTTCCATTTTGGTTCTGTTTCTATGAATCTAGCTTCCCTGTCCCCGCTACCCTTCT
CATCTTTGGTCTAGAGTAAATGTTAACCATTTGGTTTCATCTAGACAATTATTTTGAGGA
GTACAGTACTCACAAGTGATATTGTTTGTTCTATGGGCCAGTCAGTCATTTGGCTGGAAG
GTGACCTTTGGGAGCAGTTTGAGTTCCAAGTTTAAAGAGTATTTCAGGGCAGTAGTCTCA
GAAGTTCGTCTAGCCTCTACCGTAAATGGACATAATGTTTATATTTCTCCCAGGTAAATA
CCTGGGAATGGAATTGCTGGCAGTAAGCTAGGTATGTGTGTTTAAGTCTGTTAGAAACTA
CAGGCAGGGTTATTTTCACCTTCATTTTATAGCACAGGCTATGGAAAGCTTGAGGGACTT
GTCCAAGGGCAAAAGGAGGAAGGGAAGTAGAATTTGTTGACCACTACTCTGTACCAGGAA
CCCTGGTGGTGCTGTGGTTACGAGCTCAGCTATTAACCAAAAGGTCAGCAGCCCAAATCC
ACCAACTGTTCCTTAGAAACCCTATGGGGCAGTTCTACTCTGTCCTATAGGGTTACTATG
AGTGGCAACCAACTCCACGGTGATGAGTTTTTGGTTTTGACTCCGTACCAAGAAAGAGCC
CTGGTGGTGGAAAGGTTAAGTGCTCAGCTGCTAACTGAAAAGCTGGCAATTTGAAGCCAC
CCAGCAGCTCTGTGGGAGAAACATCTGGCAATACCAAAAACCGAAACCTGTTGCCATTGC
TTCAATTCCAACTCATAGCAACCCTATAGGACAGAGGAGAACTGCCCAGTAGGATGTCCA
AGGAGCGGCTTAGTGGATGCAGTGGATTCTAACTGCCAACCTTTTGATAAGCAGCCCCAC
TGTTAACCACTGCACCACCAGGGCGCTTCCATAAAGATTACAGCCTGGAAAACCCTATGG
GGCAGTTCTGCTCTGTCACATGGGGTCGACAAAATAATCAGAGACATGTGCAAGGATGTG
CCAATTGGAAACATTATGAACATTCTTTATAACAAAAAAAAGTGACAAACTAAATGTACA
AAAGAGGGGCAGATTATGAGTCAGAATCAACTCGATGGCACCCAGCAAGACTCTGTTCCA
AGTAAAGAGTAGTGGTTCAAGGGTAGAATTCTCACCTTCCATGCAGGAGACCCAGGTTCA
ATTCCCAGTCAATACACCCCATGCGTGGCCACCAGCCATCTGTCAGTGGAGGCTAGTGGT
TGCTATGACACTGAACAGATTTCAGCAGAGATTCCAGACTAGGAATACTAGGAAGAAAGG
CCTGGCAAGCCACTTCTGAACATCAGGCAACAAAAACCCTATAGATCACAACAGTCCAGT
CTGCAACTAATCATGGGGATGGAGCAGAACTAGGCACCGTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGAGACTGAAGAAC
ATCCAGCAATGTCAAGATTCAAACCCAGCTCAGTCTGAGTCCCGGAGTTCATGTTCATAT
ATCAGATATTCCTCCTGCCTCCTTGGAGGGTGTAAGGGGTGGAGCTGGGAAGGAGGGCAC
GTGTCTCCCCAGCTCTCAGCCTCATGGCCTGGCCTCACCTGCACCCTGTGGCCCATACCC
AGCCCATGGCCCCGGAGACAGCCTCCAGTCATGCCTAAGTCAGCCCTCTGGAGATGGTGT
CTGGGTGCAGGGGCAGGAACTGGGCCCCACATTTGGCTGCAGCAGGAGCCAGGGAGTGAC
TCCACGCTCCAGTCCTCTGCCAGAGGTGTACAGTTTCTGCCTCCCTGAAATGCGACACTC
AGTGGTTTGATCTTCAGGGCTGGTGGGCTACAGGCGAGGGCAGTGGGCAGGGGCCGCATC
TCCCCAGCTGTATCTCGGCCCCATTAGGAGTGGGTCTGAGTGCTTTCCAAAGCTGATTAA
TGGTCTGCCAGTGACCTGAAATGTCATTACTGCTCAGGCCAGGGCCCCCCAGCTCGGTCC
TTTGGGTCTTTATGGCTAATAATAATTGATGCTCTTGGTGTGGTTGCAGGGAAAGTTCTA
TCTAGTCATCGAGGAGCTGAGCCAGCTGTTCCGATCACTTGTCCCCATCCAGCTCTGGTA
CAAATACATTATGGGCGACGACTCCTCCAACAGCTACTTCCTGGGAGGGGTCCTGATCAT
TCTCTACAGCCTCTGCAAGGTGAGGTGGCCTGGGGACTGGAGGAGTTACTGGGGAGTCCC
CATGGGACAACCACCCTAATTTCTTGCCTGTGAAGCTCAGCATATGCTAACCTTTCACAC
AGTCCTCTTGACAACAGCCCTTTGAGATACATACCAATATTGCTTCCATTTTATGAATGA
GGAAACTGAGGCCCAGGGAGATAACATAACTTGCCCAAGGTGTCACTCAGCTAGAGATAA
TAGGAAGAGCATGAAACCCAGGCAGAGGTGCCCCCCAAAACCTGGAGTTTTCAACTGACG
GAAAACGTTGCCACTAAACTTGTTTTCTGTCCTTCTTAAATTGCACAACCTGTACCTCCT
CAAATCAGTATGCAGTCCTTCTCTCTTCATCATTATTACAAATTGATTTTTCTCCCTAAC
AATAAAAATACCCTCCTCTTTCTTTCTCTATTTCTGGCTTTAGAGAACTCTGGGGAAAAT
ACGTGTGTTCTTCTCTTTCCTTCCTCCCAGGAGGACTAGCCAGGCAGCGCCAGTCATCGG
AGCTAATCCTACTTGCAGATTCTGATTGACTGGTAGTGGCTGACTGGAGTGCCGGGTGGA
AAAGGATTATCAGGCTCTGAACAGGCTGAGGAGTCCTGGTGGCATAGTGGTTAAGAGTTT
GTTTGCTAACCAAAAGGTCAGGAGTTCAAATCGACCAGCCACTCCTTGGAAACTCTATGG
GACCATTCTGCCCTGTCCTGTGTAAGGTTGCTATGAGTTGGAATTGACTCAGTGGCAATG
GGTTTAGGTTTGGTGGTCAGGCTGAGAAGAAGAGTGCTGTGATCAATTAGCAATGCCTGT
CCTGGGGTCGGGAGGGAAAAAGGTAGTATGCGTGCCACATATTTGCAATCCTGGCCTAGG
CAGAATGGGAGACTATTGATACAAAGCAACAAGACAAAAGGCAAGCAAACCTGACAGGGA
TAAGAAAGTTCGAATCTGATGAGGTGCTCTGAGAAATTCTTGAGTCAAAGACTGGGGTTG
TCTTAATTTCCTAGGGTTGCCTTAGCAAAATGCCACAAAGTGGGTGGCTTTGGAGAACTG
AAATTTATTATCTCACGGTTTTAGAGGCTGGAAGTCCAAATCAGGCTATCAGTCATGTTG
ATTCCTTCTGAGAACGCTGGGTGACAACCTCTCCATGTCTCTCTGCTGCCTTTCGGTGGC
TCCCAGCGATCTTTGGTGTTCCTTGGCTTAGGGATGCACTGTCACGTGGCGTCTTTTCCC
TGTGTCTGTCCTTTTTTATAAGACACCACTCAGATGGGATCAGGACCCTCTTTACTCCGG
TATGACCTCATATTAACCTAGCTGATAACATCTCAAAGACCCAGTTTCCAAACAAGGTCA
TATTCACAGGGACAGGCATTAGGACTTCAACACATCTTTTGGGGGGACACAGTTCAATCC
ATAACAGGGCAGTTGTTCAGGGGTGGTTGGAGAGAACCTGGACAACCCTTTCAACTATCA
CCCTGTTGTTGTCCTTTCAGTCATTTGACATCTGTGGCCGCGTGGGTGGCGTTAGGAAAG
CCTTGAAGCTTCTGTGCACTTCTCAGGTGAGTAGGCTTCAGAGGGTCCCGATGGAGGTCA
TGGGAGCCCAAGCGGTCCTTTTCTCACCCCACAGATCTCACAGTGCCCCCGAGGCTGTCG
CGCCTCTGAGAGTCTAGCACTGAGTTTGTCCCTCTCCTCCCTCACACAGAATTATGGGGT
CCGGGCCACGGGGCAGCAGTGCACGGAAGCCGGTGATATCTGCGCCATCTGCCAGGCTGA
GTTCCGAGAGCCTCTGGTCCTCGTGTGCCAGGTGAGCGGGGTTCGGGTGAGGCCATGGGA
GGCTTGAGGCTGGGGACAGCAAGGTCCCATGAGAAAGCTGGGAAAGTCTGTCCCGTGACC
AGACCTTGGGGCTCAGGGATGGGTCTTTGGGGGCAATCTGGCCTAATCAAGACTGGAATC
AGTCAGACCTAGGTTCAAATCTCAGCTCTGCTTCTTACTAGCTGGGTGGCCCATCTTGTA
GATGAGAAACCTGAGGCTCAAGGACATGCAGTAAGACAAGATTTCAAACTCGGCTCAGTC
TGAGTCCCAGAGTCCATGTTCTTCACCAGATACCCATCCAGTGAAATGATAAAATGGTGA
ATACTTCACCTCCCCGAGCCTCAGGTTCCTCATCGGTAAAATACCAAATTCAGCATGACA
TAGGGTCAGAATATCCTGCATTTGAATCCCAGAGGTACCTGTTATGCCGGGTGGGTCACT
TTGTCACCCAGAGCTGTAGGCATGATAATAACGCCTACTTCATAGAGTTATTATTATGAT
TAAATGAGATCATCTATGAAAAGAGCTACATTTGAATTATTCAGCCATAGAAGCTGCTGT
TAATATCATTACAATCAATATTATCATTTGTTTTCATTATTAGTTGTAGGTCACTGTCAT
ATGGTGGTAAGTGCTGCTCAGTTGCTTTCCACTCCCCAAAGGCATCCCCCCACCTCCTTC
CAGCATCAGGGACAAAGATATCAATTCAGCAAATGTGTATTGAGTCAAAGCATCACAGCA
GACATCAGGGTGGGGGACAGAGGGCACACACACACTGTCCCCTGCTCTCGAAGCATCACG
GCCTCCCTGGGGAGACAGACACATACATAAATAACTANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTTTTTTTTTTTTTTTTTTAGTACCAATGTAGATTTTTTCTTTGTGACGCTTGTACCAC
GGTCATGTGACCTGATAACATTAGGGGAGACTGAAATTGGGTGAGGGGTGCTTTCTTTGC
AACTTTTCTGTAAGTCTAAAATTATTCCAAAATAGTTTACGTGAAAAATGTTTACAATAG
CCAAGGAGCCCTGGTGGCGCAGTGGTTAAGAGCTCGGCTGCTAACCAAAAGGCTCGCAGT
TCAAATCCACCAGCCGTTCCTTGGAAGCCCTATGGGGCAGTTCTACTCTGTTCTATAGGG
TCACTGTGAGTCGGAGCCCACTTGAGGACAACGGGTTTTCCAACAGCCCAAAGGTGGAAA
CAACCCAAGTGTCCATGAACTAATGAATGGATGAACAAAATGTGGCATACATGTACAATG
AAGTATTATTCAGCCATTAAGAGAAATGAGTTCTGATATATGCTACAATATGGATGAACC
TTGAAAACATTATGCTGAGTGAAATAAGACACAAAAGGACAAATATCGTATGATCCCACT
TCCATGAAATATCAAGACTAGGCAAATGCATTGAGACAGAAGTAGATTAGTGGTTTCCAT
GGGTTGGGGAGAGGGGGCAATAGGGAGTTACTAAAAAAATAAAAAATTGTTTTAAGATAC
AAAGAAGAGAATGATGACAAGCCTCCCACCCTCTAGTTACCGAGGAAGGCAAACCATTAT
CGCCAGTTCCCTTTATAGCTGCCTACCGTTGCATTTTATGGCTAGGCCACAATTTTTTTA
ACCATTCTCCACTTGATGGGCATTTAATAGTTTATGATCTTCTGTTATCTTTACACATAG
GGCTGTCACGAATAATCTGGGAGATGGGGAGATTAATCAAACCTACCTGGGCCCATTGTG
TTGATTAAATGAGTTGATCCAGATGAATCATTTAGAAGCACACCTGGCACATGGTCAGGG
CTCAAGAAATACTAGCTCTTATTATCACGCAAGCAGCCCTGGTGGCTCAGTGGTTAAGTG
CTCAGCTGCAAACCCACCAGCCACTGTGTGGGAGAACGATGTGGCAGTCTGCTTCTGTAA
AGATTACAGGCTTAGAAACCCTATGGGGCAGTTCTACCCTGTCCTGTAGGGTCGCTAGGA
GTCAGAATCGACTGGATGGCAACAGGTTTGGGTTTTTGGGTTTATTGTCACACAATACAT
TTCACACATGTGCGAGTTCTTGGTAGGATAAATTCCTAGAGGTGGAATTACTAGGCCAGA
GGGTGTATGGTTTTGACAGATATTGCTAAATTGCCCTCCATAAAGAGCGTATCAGTTTAT
GCCTCCAGAGCGGAGTGTGACAAGGCCTCTTGCTCCCCGCCCTTACCAACACTGCGTTGT
CAAGCCTTTTTTTTTCCCTTGAGCTTTGCCAATCTGACAGGTGAAAAACACTATCTCCGT
GCAGCTTTCATTTGCATTTCCCTAATTATGAGTGAGGTTGAGCATCTTTTCATATGCTTC
AACCATCTGTATTTCCTTTTCAGTAGCAGTGATTATTTGAGCATGATGCCAAGGTCAGAG
TCTTTTTTTTTCTTTCCTTTCTGGCAATCTCTCCAAGCCTCCGTCTGTTTGTCTCTCTTC
TATTCTTCTCCTGGTACCACTACCTCTTCACAAACCTGATAGAATTCTTGGGAGGGGCCA
GACAAGAATCACCACTGTCCCAGATCTGGGAGCAATGACCCTGCCCAGTGGTGGCTCAGG
ACCACAGACATGCCCAGGCCAAGCACAAGCACACACCCTAGTCTTGCTCTGTCGTGGGGA
GGAAAGTGGGCTGTGAGCCAGACCTGGAATGGTAGAGATGACTTTATGGGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGCCCCC
CCAACCGGAACACAAAAACAAAACCATGCCATCCTTATCGCCCGTGCATTTGGACTTCGA
GCCTCCAAGAAACTATGAGAAAATAATTTTTTGTTCTTTAAAGCCACCCACTGTGTGGCA
CTTTGTTATGGGTGATACAAATGGTTAACACACTGGGCTGCTAAATGAAAAGCTGGAGGT
TCAAGTCCACCCAGAGGTGCCTCGGAAGAATGGTCTGGCAATCAGCTTCCAAAAATCAGC
CATGGAAAACCTAATGGAGCACAGTTCTACTCTGACCCTCGTGGAGTTGCCATGAGTCCA
AATCGACTCAATGACAACTGTAGGAACCTAAGACAGGGGTAAAGGAGCTTTCTCCTTTTC
TTGGTATCCAGCAGTAATAAAAGGATGCATCTCACAGATGTGGGTTAGACAGAGGCAAAT
CCCCCACCCAATAGCAGGAGCGTAGTTTACAGCAGGAAGCAGAGGGGAAATAATGCCAGC
TTGAACGGTGAAAGTTCTTAGGCAATGGAAATGCAACCAGTATCCATAACATGCCCTCTT
ACACTGAGGTCTGAGCTGGCACAGGGGTCGATAGGACCTTGCAGACCTTGGCTTGGAGCT
GAAGTGGTTCACTTCCCCTGAGAGGTTAGGGCAGGGCTCAGAGCCAGGCCTCCTGCCTCT
TGAAGGAGTCTGGGAGCACCTGGAGGGCAGGGGCCTGGCCTTGGCCATGTCTGCATCCCC
GCATTCTAGTGCCTGGCTCAGAGCTGGTGCTCAGTTCATGTTTGCAAATGGGTGACGACT
GACTGCACAGGATTCAGTCCCCTTTATTGCAGCCCATCTAATCCCCCTTATCTGGTAAGT
GTCTCCTCATTCACCATTGGCATTTGTGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTTCTGTCCTTGCCTTCTCCCTCACTTAAGCCTCAGGCCTGTCAACAT
TCTCCTGTGGACATCGTCTTCTCCGCCAGTAGCCTTCAGAGCAAAAGGGACGATCCATGT
TATGGGTTTTTCCACAAGCCACAGTGGTGGCAAAGAGCACAGTTGCAATCAGTGTTTCTT
TTTGTAATGTCTGTAACAAAACTCCTTCTCCACCTGTGAGACCCTCCCCCCTTAGAAGTC
TGAGATACGATGGAACAGGTGACCACATAGAAGCCACTGGAATCTTGCCTGCCCTACCCC
TCTCCCAACTCTATTCTCTCATTGTCAGCCTGAGCACAACCGGCTGGTGCCCGCGGCGTT
ACCAAGAAAGCAATCTGTAAGGCTGGTAAGCAGATTAGCCTGCGAGCCCCAGAAGAAATG
GTGGGCCCCTGGCTACCCCCTCGTCCTGAGCCTGTATTAACATGCTCCTCACCCTTCTAG
ATTCAGGGCATCTGCCCCCAGATGCCACCAAGCCAGCACTTTTTCCTTTGCTTGACAACC
CTGGCTCTTTCTCAGTACCCAGCAAGACATCTCTTCCAGGGCAGTGTGGCATCTTTCAAG
CTCTGTTACTATGGAAATGGCCGTGATGTTATAATCCCACTTGCCCAGATAATCAAGTAG
GAAGGGGAAGCCAAGGGAAATGGGGCTGGATGGGTGTGGCTGCTCTATTCTCTACGCCTT
GAGGAGTAACTGAAGGAAGGCAACAGGAGCTTCTGTCATTGGTTTTTGTCAGAAAAGATC
TCCCTGCCTGCAGATGCCACCAAGGAAGCACAATAAATTAGAGCTGGAGAAGACTTTTTA
AAGGGGCCGCTTGGGATGGAGCAGACAAAGCTGTTTGTTGGGAATCAGACCTGGAACCTC
TGATTCCAAACTCTGCAAGGATTTGGGAAGTCACTTTACCTCCCTGTAGCCATCTCCGTG
GTGACAAAATGTAGTATATTACCTGCTGGGTAACAGGGTAGCTTACCAGTGAATATGCCA
GTGGTTTTCTCTAACATTCTGAAAATAATGAGCCATGCCTCGGATGCTGTAAAGAGCATG
ATATGTGGGGTGTGCTCGGGGGTGGGTGGGCTGGTTTAGTTTAGGGTTTTATTTATTCAT
TAAAAACCCTCTGCGGGGAAGCCCCATCTGGAGGTTTCCTTGAGGGTGGGAGGATTTAAC
TTCTGCCCAAAAGAGGAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGGCCA
TGATTTGGACCCGAGTATAATTTCCATCACTTCCAAAAGAAGGAGAGCGTGCTAAACACT
GGAGAGGCATCCCAGACTGCTATGACTTGGAGAGAGGAGATGTGAGATGACTGTTGGAAT
CTTCTAGTACTTGTGCTCTGAGCCAAACAGAGCTGCCTGTGAGTGTTTTTAATGTCGTAA
GTTCCCGTCTGCTGATAAATATCACCCTTCAATGTAACCTGTGTTTGTGGTCTTGATTCT
CCTTTCCCCTGTTGGAACCAAGTGGAACTGTTTTAGAACAAATGAGAAGTACATGGTTGT
TCAATGTATACAGCTTCCAACCGATTTAAACCGGTTTACTCATGGCCCAGGAAGCGAAAC
CAGAACAGACTCAAATTGTTGGAACTCGAGTGATCCAGAGAGATAACTGGAATGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1277, 3957..4033, 7760..7860, 20054..20207, 35569..35718, 37220..37285, 37429..37530, 62293..62337, 62341..62355
1001..1277, 3957..4033, 7760..7860, 20054..20207, 35569..35718, 37220..37285, 37429..37530, 62293..62337, 62341..62355
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved