Loxodonta_africana Locus GCN1L1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana GCN1L1
Loxodonta_africana
GCN1L1
GeneScaffold_959
SNORA42
39373..39507
63759
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGTGAGACA
AAAGTCTCACCATTCTCACTTCTAAGGAGCATTCTGGTTGTACTTCCAAGACGTTTGTTC
CAGACAATCCATGAGTATACTCAATATTCCTTGCCAATACCATAATTCCAAAGGTTTCAG
CCTTGAAAACTCTACGGAGCAGGTATACTCTGTACACTTAGAGTAGCCATGAGTAAAAAT
CCACTCGATGGCAACTAACAAGTCATTTCCCACAACCTCCTTAAGGACAAGAGCCTCAGT
ATAGTTTGCAGTCTCCTTTCTACCTAGTTCAGTTCCTAGCATCGAGGATGCTCTCCAGAC
TCATACTTTTTCTGAAAGGTGCCTTCACTCAAGGAAGGCCCACATGACGGTGTTCAGGCT
CGAAGTGGATTGGAGGCTACAGGGCGTCTTACTGCGTCACAAATCCTCAAAGACCCTCGT
CTCAGCCACGAAGCCAGGGGAAGGGCACCCAGCCCGGGCGTGAGGGGCGGCCCCTGGGGA
AGAGGTTTTGATACTCTCCGGCGAAGGCCCAGGCACCAACGATCCGGCCGCCCTACTGGA
AGATCGGTCTCACCTGCGGCCCAGGAGTAGCCGCCGTCCCGCCCGGTGGCGCCAGGCCGG
GGCTGCAACCCATAGCGAGCAGCTGGCCTCGCCCTGCCGCGTGGGCTCTCACGGTGACCC
GGAAGGACTCCGGAAGCGGTTCCGGGGTCAGCACCAGCAGGATGGCGGCGGACACGCAGG
TGAGGCGGGCAGCTGCGGGGCCAACGCGGCCAGGGACTGGGCACGGGCGGCGGCCGCTGG
GCCAGTCCTTCTCCGACACTCGGCTTCGGGGTGAGGGGCTATGGCGGGCATAGGCTAGGC
GGGCGCGGCCCGGGGCTGCCGAGGACCTGCTGCGTACGGCTCCCGGTCCCTCCCGGCCCG
GCCCCCGGCCCGGGAGGCGCCGACCGGACTCTGCGGACTTGAGACAGGTCAGGGGCAGTC
CGGGCCTCCGACTTCTGCTGCTGGGGGCCGGCGGGACCATTTCCCGACCCCGGAGTTGCA
GAAGTTTGCACTTTGCCTGAAGTACTCTCCGCTCCATTTTCCCGAAATTCTCCGGCAGTT
AGCTACGGGCCAACGCTCAGTCTTCTTTGAACTTTAAATTCAGCAAATGTTTTTCGGCCA
CCTACTATGTTTAGGGACTTACAGTACAGTCTTTGGATTCATACAAATCTGGGTTTGAGT
ACCGCTCGCCCCTCTGTGAAACGCTGGGCTGGTGACTTAACCCCGCCAAGTCTAAGTCTT
GTCATCTGTACAATGAGATTAAACTAATACCAACCTTGTTAGGTTTGTTGTGCACAGTCA
CTGCGATAGAGTAGAACTTGGTATATGTTGACTGTTATTAGGTCCTGAGTCAGATAAAAG
AACTCCTGCTACCCAGGAAGACCTATTGTCACCCAAGAGTGGTATCTGTCTGTACCTTGT
GAGATCAGGGAAGGGTGGGAAAACCTTTTTTCTCCACCCCAACCTTGTTTGTACCTGTGA
GTGTTTTAAGGTGAGAAGACAATGTTAACGGCAAAAAGAAACAGGTTTAAAGGACCACTT
GGCTTACTTGGGACCCGAGGGTGATGAGATTAATTGATTTTTATACGTAGGTTGAGGGCA
GCAGTGGTTCAGTGGTAGAATTCTTGCTTCCATGCAGGAGACCTGGGTTCAATTCCCAGC
CAGTGCACCACATGTGAAGCCACCACCTTGTTTTATCAGTGGAGGCTCACCTGATGGTGA
ACAGCCTTCAGTAGAGTTTCTAGACTGACTCAGACAGACTAGGAAGAAAGGCCCGATGAT
CTACGTCTGAAAATCAGCCAGTGAAAACTCTTGGATCACAACAGTGCAATCCCTGGGGGC
TGACTACGTGGCAAATAACAAGAACATATGTAGGCCCTGTCTGCCAGAGTGACCACTTAC
CTGAACATTCAAGACATTTGTTGAAGGTCTCCTGAGCAGGGGGCTGGTAATTTGTTTTGA
GCAGGTTATATGCAATCCTAGAAAGTAAATTTAGTCTGTTGGGTGTTTCTAGAAGATGCT
CTACATGCTGAATGTTGATCATTTATACTCAAGTGCAAAGGAAGGCATCTTCCCTCTAGA
GGTAGGCAGTGTATGTTGTCCAATATGGTAGCCACTAGCCACTTGGTTAAGTAATAGCCA
CATGGCTACTTCAGTTAATTAAAATTAAGTGACATTAAAAATTGAGTTCTTCAGTTGAAC
TAGCCAGATTTCAGTGCACAGTGGCCACATGTGGCTAGTGGCTGCCGGATTGGATGGTGC
AGGGAATAGTTACATCCTCACAAAGTGAAATTGAACAGTGCTACTCTAGAGAGAAACCTG
TGGACTTTAAAGTTGTTTGCATTGGATCTCACCGACAAATTACTTCTTTGAAGGGTCTTG
GTGGACCTTTTCTCAGTTCTGTTCTGACATAGTCTCAAGTGGGTAACATTCATTTTCTTA
TAAATGAAAAGAAGAGTCTCAAACCTGTGAGAGAAAAGATGGCCAGGAATTTAATATTAC
CATATGGGAAGACAGCTATGTGGGAATTCTGGGTAGAGGGTGGATTGTATATCTGTATCT
ATTTTGTCTGTCTCTCTCTCAAACCTAAATAAAACTAGTAAAACCCATTGCTGTTGAATT
GATTCTGACTATAGCGACCCTTTAGGACAGGGTAGTGCTGCCCCATAGGGTTTCCAAGGC
TGTAATCTTTATGGAAGTTGATTGCCACATCTTTCTCCCATGGAGCGACTGGTGGGTTGG
AACCACTGAGCTTTTGGTTAGCAGCCAAGCGCTTGATAACTGCCACGAGGGCTCCTTTTA
AAACTAGTGAAGGGTTAAAAAAAAAAAGCCACAAGGATTGGGAGAATGAGGGAGTAGACA
AGAGCATGAATTTTTCAAAGCTAGAAACTGACAATGAGTGGTACAGGGTTATGTAGACCA
GAGAAAAATGAATCCTAACCCAGCGTATGGGAAAGCTGAGAGCTAGCCTGATAACAATGC
AGAATCTCTGAATGGATGGGAGTTGGTGGTATCAGTGAACCTCTCGGAGTGAGGGTGAGT
GGGGAGGGGCTAACTTAAGGAGATGCTGAAGTCTGTTTCAGTGTAGTCACTTCCCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAG
GGGAATGAAAAAGCTGTGCAGGATGGAAGCATATCATAGTTTACTAAGTGGAAGCCGGAA
TACCATTTACATATATATAGACACCGGGAAGGTAGCTCATGTAAAATTGAGTTATGTTGA
GGAAGTGGAGAGGATGGGTGGTAGGGTAGAGAGTTAAGGTAAAAACAAACAAACAAACAA
AAAAACCCAAACCTGTTGCCATCTGGTTGATTCTGACTCATAGCGATCCAGTAGGACAGA
GTAGAACTGCCCCAGAGGGTTTCCAAGGTTATAGTCCTTACAAAACAGACTGCCACATCT
TTCTCCCACGGAGTAGCTGGTGGGTTCGAACTGCCAACCTTTCTGTTAGCAGCCGAGTGC
TTAGCCGCTGTGCCGTTAGGGCTCTTTCCAAAAGAAGGAGAACCAAGAACTGGTAGCACA
AACAAGTTATGTGGACATAAGGAGGTAACTACCACAGTGATCACCTGGAATTGGTAAAGA
AGTTGCCCCTGGGACTGGTTTTTATAGCAAACCTCACGGAATGCTTTGACTTTGACTTGT
GTGACTGTATGCACATATAACCATGTATGTATGCCTATAAAAACAAAAAACATTTGAAAC
TTAAAACAAATTTTATGTAGAAGGCAAAGTTTTGGATGTTAGTTGATTCATTGCCCGTAG
TGTTAGAGCAGGAATTTAAGCACAAGAACTTGGCATTCTTTTCTTTCTCTACGCACCCTT
GAATCTTATGGTGCTAGTTAAGCCTGCCTGTGAAATACCCTCAAAAGAAAAAGGTGCAGA
CACCGCTGTGTTAGTTATGAACCCTCCTCACCATCGTGCCCTGCTCTGTTACTCAGGACC
TGTGCCCTTTGTAGTCGATAGAATATTGCTCAGGAGCAGATTCTCCGGAATATTTAGGCT
TCTGCTCGCACCTTTCTTTATACAGGGGACTACAGTCACGGTAACTTGGATGGGGGTTGA
AGCTAAGGATTGTTAGCATCGGTTTATAAACCTAGTTAGTTTCAGGTTTAGTTTCAAATG
TGCAGGTGCTGTGGCACTCAACTCCATTCTGAGAAATGACTTCACTTGGTGGAGGCTGTT
CCTACATCATCTTAAAATGGCGATTTGATGCCTCCCTCAAGGCTTGTCATGATANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTATGCCTTTATCTCTCCCTGTTT
TAGATAGTCAGTGTTTGAGTTGCCCATCCCTAGTAGTTAGGAGCTCAGCGGCTAACCAAA
GGGTCAGCAGTTCGAATCCACTAGCCACTCCTTGGAAACCCTATGGGGCAGTTCTGCTCT
GTCCTACAGGGTTGCTATGAGTCAGAATCACCTCCATGGCAACAGGTTTATCAAACCAGT
ACTCTGAGGAGGCAAGCATGTTCCTTGGTCTAAGAATCTTCTGTTCCGGTTGGAACTTTG
AGCATCTGCGTCCATAAACAAAGTCCAGTCCAGAGCAAGCCACTGAATTGCATCAATCTA
TACCAGCTCACAGTGTCAAACATCTTTCTTATCATTCTCTTGGGTTCTGGGCAGCTCATC
CATAGCCCCTGTGGCCTAGTTCAGTGGGTGCCAGTGGGACATGTCCAAACCCAGCACATC
TCTTCATTGCTGTGCCTCACCCACTTCATTCATGGCCCCATGTGGTCACCTCAAATGAAA
ATACCAGGCTGTCTATTCACTGGCTACCTTTAACTTCCAGTCCTGGAAGGGTGTTCTTCA
TCTTTTTAATTTTTTTATTGTGCTTTAGGTGAAAGTTTACAGCTCAAATTAGTTTCTCAT
ACAAAAATTTATACACATATTGTTATGTGACCCTAGTTGCAATCCCTGTAATGTGACAGC
ACTCTCCCCCTTTCCACCCTAGGTCTCCTGCATCCATTCAGCCAGCACCTGTCCCTTTCT
GCCTTCTCATCCCACCTCCAGACAGAAGCTGCCCGTTTAGTGCCATGTATCTACTTGAAC
TAAGACGCACACTCTTCACGAGCATTATTTTATGTTTTATAGTCCAGTCTAATCTTTGTC
TGAAGAGTATGGCATCTGGAATGGTTTTAGTTCTGGGTTAACAAAGAGTCTGGGGGCTGT
GTCTTCTGGGGTTCCTCCAGTCTCAGTCTGACCATTAAGTCTGGTCAATTTGAGTTCGGC
ACCCAACTTTTCTCCGGCTCTGTCAGGGGACTCTCTATTGTGTTCCCTGACAGGGCTGTT
ATGGGTGGTAGCCGGGCACCATCTAGTTCTTCTGGTCTCAGGCTGATGGACTCTCTGGCT
TGTGTAGCCGCTTTTGTCTCTGGGCTAATATTTTCCTTGTATCTTTGGGGTTCTTCATTC
TCCTTTGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCCT
TATCAGAATGGTTCAGTAGTGATACCATCTAGTTCTTCTGGTCTCAGGGTGGATAAGAAC
CATGGTTCACGTAGAATATTAATCTTATAGACTATTTCTTATCTGAGTCTTTGGTTTCTT
TCTTTCTCTTTTGCTCCGGATGAATAGCGACCAATAGTTGTATCTTAGATGCAAGCTTTT
AAGACCCCAAATAGTACTCATCAAACTAGAATGTAGAACATAAACTTTTTGAACTATATT
ATGCTAGTTGACTGAGTTGTCCCATGAGAATGAGGTCCTAAGCCAAAAGGCCTTCTTATA
ATGTGTCTTACCTGGAGTAAATTTTATAACCATTATGTGCCAGTTGCTCACTGTGTTTAC
TGGTAAATAGTATTTACTTCGACAGCACTGGGTGTTTTGGGCTTTTAGTATTTACTTACT
TGTGGGTTACTGAATGGGAGGGGTCAAACTTGGAGTGTTATGTTTATGGAGCAGGATGCA
TCAGGAGCCTCAGACTGTGTTTATTTTTGTCTGTGTTCTGAATCTGGTTTTTTCCTTGCT
CTTTGCTGTGTTGATCATACACCCAGTTTATAGTTCATTCAGTTGTTCGACAAGTACGTT
GAGGGCCTCCTGTGTGCTGGACGCTGTTCTGACAGGTGGGGAGAAAGCAGCGAGTAAGAC
GGAGGAGGCCCTTGCACTGATGGAGCTTACACTACTATGGAGTGGACAATAAATAAGGCA
ACCCATCACCAGTAACAATGGAAAGTAGTGCTGGAGAAAAGCAGGATAAGAAGGGAGAGT
GTGGAGGGTTTTAGTGGACGTGGAAGTGAAGATTTACACGGGGGAAGGCCTTTCTGAGGA
GGTGTCATCTGAGCAGAGTCCTGAAGGTCATGAGTCAGCAAGTCATGCCCAGATCAGGGG
TTGGCACATTCCAGGAAAAGGGCACAGCAGTACCATTTGGATTGTGGTATCAGCAAGCTT
TAAAAAAAAAAAAAAACTATTTAAAATATTACGATTTTTAAAACAAATGCTTCAGAATTC
GCCAGGTATAGAAGGATACACTAATTGTCCCCCCACTCCTGTCTCCCAGCCACCCACTTC
CACTCTGTTACTAGTTTCTTATGTATCCTTCCAGATAAATTCTCTGTATATACAACCAAA
ATCTTTTTTAGTAATATCTTATTGTGTTTAAGGTGAAAGCTTACATAGCAAATTAGGTTC
TCATTTAATAATTTCTGTGCAGGTAGTTCAGTGATATTGGTTACGTTATTCACAATGTCA
CATTTTTTTTAAATACACTAGCATACTGTACATTTTCACCTTTTTTTTTTAAGTTAACCA
ATCTTAGAATTTGTTCCAGAGCAGTGTATTAAGAGTATCCTGTCCTTTGTGATTGTTTGC
TAGTCCTTTGAGTGGACGTCGCACACGATACACACCCAGCCCCTGTTGATGGCCAGTTAT
GTTGTTTACAGGCTTTATTGGTGCCAGAAATGCTGCAAATGAAGAACTGTACATATGCCA
TTTTGTTCACTTGCAAATGAAGTTCAGCAGACCTCTTAAGCAGGTCCTTTTTCCCCAAAG
TGGCAGTTCACGCCTCTCACCGGTGTCCTTGGGTGTTTGTGGAACGTAGTCTCTGAGGTT
CTGTAGTTGAGCACCTACTATGTACCTCACACTACTCCACACAGCCCAGGATCCCCATGT
AAATCTTCACTTCCATGTCCGCTAAAACCAAACCAAACCCGTTGCTGTTGAGTTGATTCC
ATCCACAGTGTCTGCCATTTAGTCAGTGTTCAGTAAATATTTGTGCAGTTAATGAAGGCA
AAGGTCACGGAAGATAAAGAGGTATATAGAGCAGAACCTTTGTTCTCTTCCTGCACAGTA
CCTCTCTGAAGTTATATATCCACTCGTGTGTTTATTTGTTTAATACCTTATATTCCCTGT
GGACTGACTATAACCCGTCTGCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGAGCCTTAAGTTTCCTTATGTGCTTGTTTTAATGTGT
TAAAAACTTCTTTCTTCAAGATAAATGGAGTATTGGAGAGTTTATCCATTAGTACCAAAG
CTTTTTATAGTTTTAACTATTTTGATTGGAAATATTGCTAAAAATTTCAACAATCTTTCT
TGACTAATTTACTGGATGTGCAAACATGTTACCTGTAGCGTGGGGCACCATTTTTCCCAA
TTCGTGTTCCACGGGCACCGTAAGCTGTTAATAGGTGATTGGCCAGTAAGGGATCCTAAC
GTCAGATAAGTGTGGGAGATGGCTCACTTTCTAATCCCCTCATGGAGATTCACAACGTAC
TCCAGGAAGATGTTTCGACTTCGTTAAGCTTTCTTTAATTCAGTGTTTTCCTGGGACCTC
TTTTTTGCTGAATACCTGCTGAGGGCCTGGGGACCATATTTTGGGAAATGCCAAGCACGT
GTGGTTATATACCGTCACTGAGGGATATCCCTGTCAGGATCTGTAAGACTATTTTGCCTT
CACACAGTAAATCTTAATGAGTTTTCCGAGTATCTTTTTCATCTGCTGGTTTTTACCAGA
CAGCATTGGTTCTTACAGAGTGGTCCCCACACCAGCAGCTCTGCATCCCCTTAGCACTTG
TTAGAGATGCAGAGTCTCAGCTCTGCCCCAGAAACCCCGGGGTAGAGCCCAACATCTTTG
TTTTTAACAAGCCGCCTCAGTGAGTTGGATGCTACAGTTTGAGAACTACAGCCATAGAGT
CAGACCTTCCTATCTGTCTGCTTTCACTTCTAATTGGTAAAGTCTTGCCCTGCTACCCTT
CTTTCTCACCCAAGTTGTAGTTTCCTGCTTCTGACCTGCTGTCCTGAGCAACATACCCAA
GCTTGTTAAAGTTGTGTGTAAATTAAGTACATTGCTGTTTGTAAGCTTCTAAGAGGTTCT
CCTGTGTATTAGTGCTTTAGTGTATGAGTTTTATGGCGTCTTCAAAGGTCTTTCTGGTCA
CTTTCATAACAGGGTACTAGTCAAACAAGGCTGCCAGGTGGCCGAATTCCAGATAGACAG
TAGACTGGCTGTCTGCACCTTCTGACCCATAATGTGAGACTCGCCCTGCTAAATGACTGC
TGAACACTGTACTTCTCTTTTCCCATTTTTTGGAGGAAGGAGTTTGACTCATGAATGGGT
GAAGTTTATGAAGTACTCAGGGCCTTTTCTGGTGATTTTACTCTTCACTCACCCTGCAAA
CGCCAGCTCAGGGTGAATTGTGTTTGTAATGTGCTCAGGAGCCTTTGATGGGCTTGGTGA
TTGTGGAAAGCTGACTAACTCTCTGTGCGTGGAATCCCTCATCCATTGCAGACTGATGGT
TTCCTGGCCTTTCCTTTTGTCAGGGTAGCAGGCAGCCAAGTTAATCACCGAAGGTGGGGG
GAGATTTTTTTCAGCCCCGCTGAGTGATCTGAGGACTTTCTCAGCGCTATCTGACCCTGG
GTGCAGGTGGTCAGCATGGCCCATCTCAGCCTGGTGCTGAGAACTTCTCCGATGTTGTCC
TCAGTCTTGCCTCCAGTTACCTGACCTCTGAGACTCGCTACTGCAGCGTCTCCTGTGTCT
GACCTTCCCATTTATAGGCCTCTAGGTTGTCAGTCAGTGATGAAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACACCCTACACTGATCTGGCCCCTTTACCATAACAGAGAAAACCCAGTCCCAAAT
GGGATTATAACCACAGGTATAGGCATTAGGATTTACAACACAAATTTGGGGGGGGCACAA
TTCAATCCTTAACAAATGTTATTTCTCCTCCTTGTCTGTCCTAAGTAGGCCTGATGCATT
CTTACCCCGCACCTTGGCTCACGCCGTTAAGCATGTCCTTCCTCTCTTTCTTCCATAGCC
CACTAATCGTTAGGCCAAACTCATGTCTCCTTAAAACCTTCAGAGGCCACTCCAATTGCA
GACATTCTTCCCTTCTCTGATCCCTCATAGTACTTTAATTTTAAAATTTTGTACACTTTT
AAAAACTTTTTACAAGGAAATACATAAAGAAAAGTGCACATCTCATAAGTGAACAGTTCG
CTGAATTGTTGCAAACTAAACACACCCAAAACTGGTACCTGGATCAAGAAGTGGAGCCCT
GGTGGTGCAGTGGTTAGGAGGTTGGCTGCCAACCAAAAGGTCAGCAGTTCGAATCCACCA
GCTGCTCCTAGGAAACCCTCTGGGATAGTTCTACTCTGTCCTGTATGATCGCTGTGAGTT
GGAACCGACTCGATGGCAGATGACAACAACAGATCAAGAAGCAGAACGGTTCAGACACTC
CAGAACCTTTCCTCCACTTTAAATTTTGAGGCCACGTGTATTGCCCCAGATTCATTCATT
TAATGTTTGCCTCCTATACGAGTGTTTTCTTAGAATCTTGTCTTTTTGGTGGGTTTTCCT
CCTCTGAATTCTGTTTCAAATACACAGGAGTGTCCAGTAGCGCAGCAGTCATGCTAGCAG
AGTGACTAGACTCAGCAGCTTTCATTGACCGGCTCTGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGAGGCAGTGTAGGGTAATGGTAGGTGCCCAGACTTGGAGCCAGGCTGACAGGGTCCCGA
TCTGGGCTGTGTTACATTCTAGCCGTTGGAAACTGAAGCACATTACTTAACCTCTCTGTG
CCTCAGTTCTTTGTTCTGCAGAATGAGGATGATGCTATTCCCTACCTCATAGGGTGGTGA
TTAATAGGTGTGAAGTGCCTGGTATGGTGCCTATCTGATCATGAGTGTTCGGTATGTGTA
CTGTGTCATTCATCATGTATGCAAAAGCACTGAGGCCATAGTAAGTGCCGTAAATGTGGT
TACTGCCCTTAGTGCCTTAATGGCTCACTTGCCCTGATTTATCAATGACTTCCAGGAGGA
GATAGGTTTATCTAGTTATTTCCTAATCCTGTAGTCAGTGACCCCCTCCCCCGCAGAACT
GTGTGAGAAGTTTTTCCTAAGATAGACGAGGCTTGGCCTAAGCAGCCTTGCCCTCCCCCG
AGCCCACATGTTCACTTGCCCCTTCACTCCTTTCCTTAGAGATGCAGCCTCCCGCAGGGC
CCTGCAGGCAGCCATCCAGCAGTTGGCTGAGGCCCAGCCAGAAGCCACTGCCAAGAACCT
TCTGCAGTCTCTGCAGGCTTCAGGCATTGGCTCCAAAGCAGGCGTTCCCAGGTAGGAGAG
AAAGGTGGGGGCCTGTCTGGGGTTGGTGGAGCTCTATCGGAGAGACACTGGTGCCAGATG
ACCTGCGTCAAGCAGATGTGGTCATGCGTGTCTCTTTCCCCTTTGCAACTCTGAATGTAC
CTGTGGATGACTTCTGAATGGAGGGAGGACTCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAGGGTGAAGAGGAGTTAG
CAAGGTCAAAAGGAACGATAGGGCATTTCAGGCAGAGAAAGCAATGTGTGGGAAGGACAT
AGAAGACATGAGTGGGGTTGGAGTGGCATGAGTGGGTAAGAGAGGTGTTAGATGCAGCTG
GCCAGGTAGCAGACAGGGCCTTATAAACCATGTCAAGGAGTTTAGACTTTATCTTAGGAG
CAGTGGAGAGCCGCGGAAGTTTTTAAATGGGAAGTGACATGATCGGTGGAAGCTCTGTAC
TTGACACTGTGATATTTGGGGCATCGACTTGTAGTTTTTGGAGGCAGTCATGCAAGAGGA
ATCTCTTAGGCTGGTGATCTGATTACTTGGGCATGTTAGGATCTAACCAGGGCGTTGTGC
TCCCCAGAGCGCCCTACTGGATTTTTATATGAAGAATGTCCTGATGAGCAAAGTGAAGCC
TCCAAAGTATCTGTTGGTGAGTGAGAGGGGGACCGTACTTGCCTGGACCAAGCCTAAGTC
CCATTTAAAATTCTATGCTTCTGGGCTGTCCTTTAGTCTTGGTCTGCTCCGTGAGGGCTG
GACACCTGACTCCTTTCTTTCTGTAGGATAGCTGTGCCCCTCTGCTTCGATACATGTCCC
ACTCGGAATTTAAGGATCTGATACTGCCCACCATACAGAAGTCCTTACTGAGGAGTCCGG
AGAATGTTATTGAAAGTAGGTTACTACCCAGCAGGACTGGGGAAGGGAGGCAAGTTGGTG
GGTGAGCTATATCGCTGACACTTGGCAGCAGGAAGTGGTGTTGGGGGAGTGTTTTCACTA
GATCTTTTTACCTCATGGGAACCTTGGGGGAGAGAAGAGGGGACCCTTTTGAGAATATGT
TAAAAGTCATGGGGTCCTCATGCGAGAAGAACCCACAACAGTATATCCACTTAGAGTTTT
GTATACAATCTTTGGGGTCTAAGAGCCTCTTGGAGACCATTAAGAGCCTCAAACTTCTCT
AGACAGTTTGAACTTGGTGTGAAAGTGGCACTTGAACCTACAGGGCATAAAGGTTGGGGT
CTCTGTCTCCGTTTCTCTTGATGAAAGGCATAAGTAAAATGTTGGGGCTGGGGAAAGGGG
CAGTATGGCTTCTCAGCAGAGCTTTGGAACGAAGGTCTGACTGCTCATATGGCCCTCTAG
AGATGAAGAGCGGTCACGGTTCCATGTGGCTAGACATTAGGCCTGATGGCATTTGTTGAG
CACTAAGGGAAAACGAGCATTTATGCTTGAAACTGACGTGGTCAATGGTTTCTGCCCCTG
TAGCTATCTCCACTCTGCTGGCATCAGTGACTCTCGATCTCAGCCAGTATGCCCTGGACA
TCGTAAAAGGACTGGCCGGTGAGCATCCTGACCCCTCTCCAGCCCCTAGAGCCGCACCTT
GGGTTTTGGTTATTCTTGCCCCGATTCTTATGGAAACAGGTGTAGGGGACAGCTCAGGTT
AGATAAGGGTTTAAGCTAAACAACATTTGCATACTTTCTTTCTTGAGACCATTTGTAATA
AGAACCTATAGCTAGGATTAAAGAGTCAAGGCCACAGAAAAGACGAGCATGAACATTTGG
ACACTCAGCTGTCGAGCTGCCCTGAGCAGTTGCTCACTATGCATCCAGGTCAGCTGAAAT
CCAACAGTCCCCGCCTAATGGATGAAGCCGTGCTGGCGCTGCGGAACCTGGCCCGCCAAT
GCAGCGACTCTTCAGTGATGGAAGCGCTGAGCAAGCACCTGTTTGCAGTCCTTGGAGGTG
AGCCAGCCTTGTTGGCCATGGGCATTGGCTGAGGGGTGGCCCTGCGTTCCCCTGGACACT
GGGATCCAGACTGGTGCTTGGCGCTCCAAGTCTGCTCATGGAAAGGCTGGGTGGCCAGAA
GGACGCTCACCGTGTCGCTGGGAATAGTGCATACAATGTGAATGTGAGAAGTGAATAAAT
GCATGTGCAGGGTGGGCCAGGCAGCATGATCGCAGATTTTTTTTGTCAAGTATGTACATG
TTTTATGCATAGCAGAAAAACTAGAGGGAAATGCCTCCAAATAATATTTAATAATAGTTG
ATAACATTTTAAATAGTAACAATAACAATAATAGTGAATAGCAGTTAATGACATCTTTGA
GTAGGAGGAGCCTGGGTGAGTTTTAAAATCTGTCTCTACATTTTGTCAGTTTCTCACATT
TTCTTTAATTGCTTATTTTAGTCAGAAAACCAAAGGCTGGTCGATGTTATTGTAAACCCA
GCTTTATCACAGAAGGCTACTTCTGAGTAATCAGAACCTGTATCTCAGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTGATTTCATAACAGGCTACGTACTC
GTACGTCAAATTGTATTTTCCTGTGTTGACCAACCTCAGGTTTTAGGTTGAGTTCCTACG
CATCAGAGACTTGGTTTAACCTTGTCTCTTCAGCTTGAGCTAGTTCTCCTCACTACTGGA
TACAGACTCATGACATCACCCGAACAAAGTGTTGGTTTTGTTGTGAACATGTTGTGATGT
TCCTGTTCAGTACTTAAGAAAACATGTGTTTAGCTATACTTTTAACTAGTTCTGGTTTTC
TTAATGGGTTTAGTTCATAGATTAACAGATTGGCCTGGCTTTGGAATTTGGGGAAGAGCA
CCAGATTGGAATTGAAAGGCTTAAGGTCAGGCTGGGTTCTGTCTCAACCAGCTGTGTGAT
GTTGGGTGACTCACTTAACCTCTGCAGTCTGTTTTTTCACCCATCAATAGCTGGTCTCTT
TGTAAAGATCCTTCTAGCTCTGATTTCATAGCCGTGGTTTGGCTAAAGCCTCTGATTCCA
GTTCCAGGTCTTTGCATGAGATATTTGACAAATTAATGCAAGGGTTTGGGTCAGCCAGTT
CAGAGCCAGGCAGATAACACCTTTGTCAAGTAATGTTGTCATCCCCAGGATCTGGCCTGT
TCTATGAGGTTTTTGTCCTTTCTCCTCACGTGACACACTGTTGCAGGCCCTTGGACTTAC
TGCCCTTGCTCATACAGACCGTGGAGAAGGCAGCCTCTCAAAGCACTCAGGTTCTCACCA
TCACTGAGGGGGTTGCTGCAGCCCTGCTGCTGTCGAAGCTGTCGGTGGTCGACGCCCAGG
CCGTAGACCCAGAGATGTGCAGATGGTAGGGAGGAGTGTCTTGATGTTAGGATGTACAGG
ATCAGCTTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCCTGGGTATAGTAGCGGGACTGTTTTTATTTGGCTGTATG
TTCTTATGAGCCCAAAATTGAAAAGGCGTGAGAGAGTATAACCTGAAAAGCTTCTCCTTA
GCCCTGTCTTCCACCCACTCAGACCCCCTCTCTGGAGAGTATTACCAGTTTGCTGTCCAG
AGGTGGTTGATGTGTAGTCAATCAGACATGTCACATAGCATAGTATACAGAAAATATCTT
AGAGATGATCCCAAGTCTGGACAACAGAGCTTTCTTGTTCTTTTTTGTGACTACATGACA
TTCCATGATTTCTTAGTCCCTCTCCTCACAGCACACGAACGTACCCGAGCTTTTTCTGGT
TGGAAATGGAGTTAAACTCTCTTCGTATTCTGTATCCACTGCCTATGGGCCATGGCCCCG
GGCTGCCTTGCAGGAATGCAAAGATGAACAAGCCCGTGTTTCAGCACATTTGAGGGTGCT
TACTCTAGGAGGAGAGAGGATATGAAAAGACATCCCTGATTTAAGGCAAAACGTGCCATT
AAAGCAGTTTCGAAGGAGAGATTGCTTTTAGTTTTTAGGGGGTGGGGGATGGAGTCCAGA
AAGACTTCCTGAGGGTGGAGGCATTTGGGGTTGGGGGCCTGAAGGCTAGGAAGGATTTCA
CTGGCCAGTGTGAATCCTAACCAGACTGGAGTCGGGGAAGAGTACAGGAAGCCACAGTGT
AAGTCTCAAATGTTCCGTCTAGGCTAGAGCTCACGTACGTGGGAATGCCCGGTGGGAAGC
AGCTGGCCTAGGCTCCTGTAGCACCAAAGGACCTCTGAAGGTTCTCATATAGAATGACAC
TAGACGGACTATGTGTTCTCAAAATGGGGGAGGGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGAAAAGGGAGGGTTGAGGGCTGGTCATGGAAAAGCCCTGG
TGCCCCAGCCTCCCCTGGACGGTCTGTCCCTGTGCCTGCAGGCAGTACCACCGGGCTCTG
GTAGCGGTGCTCTGAGTCGGACCTGGCACGTCCGCAGGCAGGCCCAGCAGACGGTCCGCA
AGCTGCTGTCCTCTCTCGGGGGCTTCAAGCTGGCGTGTGGACTCCTGGAGGAGCTGAAGA
CTGTCCTCAGTTCTCACAAGGTGAGGACGTCTGGGCTCCGGGACCCGCTTCATGACCCTG
CCTATGGTTCTGAAATTCTGGCTGGGCCTCTCCTGGCTCCTCTTGCTCACTCAGACTCTG
GGTGATGCCAGAAACCTTCTCCCCTGCCCTTGCACATGCTCCAGTAGCATCGTGTTTCGT
ATAATGCCTTCTCCTTGTCAGAGACGTTTTTTTCTTCCCATGCGTTGTAGCATGTAGGTC
GACCATTTGATCCTGGAGTAACTGAATAACACTTTGTGTCTTTACAGTGCTTTATAATGC
TTAAAGTACTTCCTACCCATTTGTCCTTTTAATTTTCCACAATACATTTAACAGACAGAC
GGGGCTATTTAACTAATTTTTATGAGTTGTCTAAGGCTGAAGTGTTGAAACGACCTGTAC
AGGGCCTCCAGCCTGTGGGCAGCAGAACTGGGAGTAGACCCAAAGACCTGACTCCTATTC
AGCGCCCTTTGTACTGTGGTTGCCTGCTCCCTGCCCGCTGTATGCCGCTTGGGGAATGTT
GGCCAGTCCTGGGCCAGGTCTCCTGGACCAGTTTTTGTTACCTTCTTCCCCCACTGTGGG
CTTTTTAGGGGGAAAGTCACAGGTACTTTCTCCTTCTAGACACATCTCAGCCCGAGGGTC
CCAATGCAGGAAGCTGGACGTCAGCCACCCACTCCAACAGGCACCCCAGAGAACCCCATG
AGCGAAAGGCAGCCATGTCCCCAGCATCTTTGTCTCCTGTGTGCCCAGTCTGCGCAGGGC
TCTGAGCAGAGGGGGCTCAGTTGTCATCTCCATGCAGGTGCTGCCCTCAGAGGCTCTGGT
GACTGATGCTGGGGAGGTGACCGAGGCGGGCAAGGCCTATGTGCCTCCACGGGTCCTTCA
GGAGGCTCTCTGCATCATTTCTGGGGTGCCGGGGCTGGAGGGGGACACCTCCAACCTTGA
GCAGTTGGCAGAGGAAATGCTGATCATCTCCCACCACCCCTCCTTAGGTTCGTGGCTGGG
ACGGGTATGGAGGGATAGGGGCTTGCCGGGCAGGAGAGAGCAGGCCCAACAGAGGCCTCA
AAGACCTCCCTCCCCTCAGTGGCTGTGCAGTCTGGACTCTGGCCAGCACTTCTCACCAGG
ATGAAGATCGACCCCGAAGCCTTCATCAGCAGGCACCTGGACCAGATCATTCCCAGGGTC
ACCACACAGAGCCCCTTGAGCCAGGTGATTGGCGTGTAGGAGGGTTCTGGCCTCTGGTGG
GGGCTCGCCCCTAGCAGGGTTCAGGAAGGGGGAATTCAAAGAAGCAGATAGAAGGTGTGA
ATGAAATGTAGGCTAGGCCCCTTGGGTTGTAAGCAACAGAAAACACAAACTGGTTTAAGC
ACAAAAGGGAACTTGCTGCCTCATGTAACTGCCAGGTCCAAGGATATGACTGGCTTTGGG
TAATGCTGGCTGCAGGGCCTCAGATGTTGCCCTCAGGACAGCTGATAGTGCCCCTCTTAC
TCTCTCTCCGTCTCTCTGGCTCATCCATCTGTGTCTCTCACCTTGGCTGCCCACCACGTG
GGCTCTATTCTCACGCAGTCAAATCTCTTTCTGGTGGCAGGGTAGCTGCCGGAGCTTCAG
GCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCCTGCTGGAGAGCTGTATGACAAGTCCATCATCCAGAGGTAAGG
CCCATTCCTGGGTGTCGTGCCTTCCTCCCCCAAGCCTCAGTCTTCCTGTCTGCAAGATGG
AGACACTGCCCCCTTTGCAGGTTGTTGTGAGACATGAGCCGCACAGTTGATCTGTTCTGG
GCGTGGCGCTTTGGCCTGGGAAACACGAGTATGTCAGGTGTCCAGCACTTTCCTGGTGCA
CCGGTTACCAGTTACCATTGAGTCAACTCTGACTCGTGGCAACCTCATGCTTGTCGAAGT
AGAACCACGTTCCATAGGGTTTTCAGTGGCTGGATTTTTGGAAGTCGATTGTGAGGCCTT
TCTTCCAATGTGCCATTGGGTGGGCTTGAACCGCCAACCTTTCAGTTAGTAGCTAAGTGT
GTTTACTGTTTCCACAACCCAGGACTCCTTAAAAGCTGGTTGGGGTGTCATGGTTGGTAT
GAAGCTGGAAGTAAGAAGGGACCAGCAGCCCTTTTCCAGCTGGGCTGATGAGCTGCTCTG
GTGTTTCAGCGCCCAGCAGGACAGCATCAAAAAGGCCAACATGAAGCGGGAGAACAAAGC
TTATTCCTTTAAGGAGCAGATCATTGAGCTGGAGCTGAAGGAGGTGAGTACACAGAGGCA
TTGCACCTGGGTGCCGCAGAGCTTGGTGACCACAACCAGCGGCTCTTCCCGCTGCGCATA
TACTTGGGTCATCCTGATGCTACTCCTCTGCTGTCCCCACATGTCCCCCCGTCCTCCTGC
CACACTCTTTACCCTTTATCCGTAGCTCCTCCCACGCCCCACTCCAGGAAAGCGAATTTC
TCTCTCTGCTGGGTGCCTGCAGCAGTTTAGTGTTTAGCGTTGAGTATTTACCACATAGGG
AACCCTGGTGGTGCAGTGGTTAATGTTCGGCTGCTAACCCAAAGGTTGGCAGCTCTGCAG
GAGAAAAGACCTGGCAATCTATTTCTGTGAAGATTACAGCCAAAAAACCCCATGGGGCAG
TTCTACTCTGTCACAGGTCACTCTGAGTCGAAAACTGACTCGGCACATAACAGCAACATT
TACCATGTGGTGGTACTTGACTCCATGCTGGTCCTCTGGTTCCTTGAAGGCTGGGTCCTG
TCTTACTGCTGCCAGCAGGCACAGGGCCTGGCCCTGTGTAGCCCCCGTGAATCAAGCTCG
AATGCCATATTCAACTTTTAAGAGGTCTGCAGGGCTCTTTACTGTCTTTGCGCCTTGCCT
GCTCTTTGCAATGGTAGGTTTTTCTTGACTTCAGCATTGGCTTAATTGTCTGGTTCTCAG
AGGGGTGACCCCGCCCAGCTATCCAAAGTAGACCCAGCCCCTCTTGCCAGTTAACTATGC
TATTTGTTCCATATCTAGTTATTTTTTCCATGTTGTTTATCATGATCTGAAATCACCTTG
TTACTGCATTTACTTGTTCCATTGTTTTTGCCCATTAGATTGTGAGCTTCCTAAGAAAAA
GGACCTTGTCTTGTTCCCTGTGGTGTCCCCACCACCTAGAACAGTGCCTGCCACAATACA
GGCACTCAGTAAATATTTGTTGAATGAATGCATTATGTCTTTGCTATGTCATCTCAGGCC
ACAGGCCTTTTCTTTTTTTTTTTAATTTATTTATGGTGTTTTAGGTGAAAGTTTACAAAA
TCAAGTCAGTCTCTCATACAAAAAGCCATACGCACCCCACTGTGCACTCCTAGCTGCCCT
CCCCTTAGTGAGACAGCATGTTCCTCCCCTCCACCCTGTATTCCCCGTGTCCATTCAACC
AGCTCCTGTCCCCCTCTTCAATCTCGCCTTGCCACCAGACGGGTCACCCACATAGTCTCA
CACGTCTGCTTAAGCCATGAAGTTCACTCCTCACCAGCATCATTGTCTATCTTATAGTGC
AGGCCAATCCCCGTCTGTAGAGTTGGTTTTGAGAATGGTTCCAATCTTGGACTGTCAGAG
GATTCGGGGACCATGACCATCAGTGTCCCTCCGGTCTCAGACCAGTAAGCCTGGTCTTTT
TGTGAGACTATAGGATCTGCATCCCACTGCTCTCCTGCTCCCTCAGGGGTTCTCTGTTGT
GTTCCCTGTCAGGGCAGTCATCAGTTGTAGCCGGGCACCATCTAGTTCTTCTGGTCTCAG
GCTGGTGGAGTCTCTGCTTTATGTTATGTGGCCCTTTCTGTCTCCTGGGCTCATATTTAC
TTTGTGTCTTTGGTGTTCTTCATTCTCCTTTGCTCCAGGTGGGTTGATGCATCTTAGATG
GCCGGTTGGTGGCGTTTAAGACCCCAGACACCACAGGCCTGTTCTAGGTTTCAGCTTATA
CTATGGGGAGACTTTCTGGGGGAAGGGACCCGGGCAGGACAGGAAGCAAAAGTTTTGATT
CTGAAGCCATGTGGCTACCAAAATACCTTTTTGAGTGCCTTGAGGGTCTTTTTACTTTTG
TAATATGCAAAAGGCCCTCCTTGCCTTTGTCAGTAGGGAATTGCTTTTCTCCTGCTGTGA
CCATGTAGTTTTGCCTCAGTTCTGTGGAAACCAGGCAGTTGTGGACTCTGTGGGAGGTAG
GGGACACCCCACGATGGGTCTGGGGGTCCAAATTGTAGACCGAGAGCTGGCACGGCACTG
TTTGGGGAAACAAGCTCTCCTTCTGTGGTTGAGAGGGAGGCCAGTTCCCTGGAAGTGGAA
TTGGCTTGCCTGTTCCCTCCAGGAGATAAAGAAGAAGAAAGGCATAAAAGAGGAGGTGCA
ACTGACCAGCAAGCAGAAGGAGATGCTGCAGGCCCAGCTGGACAAAGAGGCACAGATCCG
AAGGCGGCTGCAGGAGGTAAGTGGCTGCTGCCACCATGTTCTCGAGCCTGTGAATGCTGG
GCAGCTGGGGCCCGAGCCTTGCTGCCCTGGAGCAGGGCCATGTTGACCTCCTTCTGGGGC
GACTCTGCTTGCAGCTGGACGGTGAGCTGGAGGCGGTGCTAGGACTCCTGGACAGCGTCC
TGGCCAAGAACCCTTCTGGCCTGACCCAGTACATCCCAGTTTTGGTCGACTCTTTTCTGC
CCCTGCTGAAGTCTCCACTGGCTGCTCCCAGGATCAAGAACCCTTTCCTATCCTTGGCTG
CCTGTGTCCTGCCCCCTCGACTCAAGGCTGTGGGTTAGTGCTTGTCTGCTGGCTGCAGGG
AGGTTGGGATGGAGGAAGGTGAGAGAGTGTGGGAAGGCCTGTGGTGATCCAGGCTACTGA
GTTTTCCTTCTCCATGTGGAGGCAGTCTTGGGAACTGCAAGCTACATATCCACGGGAGCA
ACATTGTGCCTCTTTCTTGTCTGCTTTGTGTCCGCTGTGCCTGTGCTCAGAGGACCAGGT
TTTAGACTCTAGTCAGCGTCTGCTCTTTCTGTAGTAGTTTTAAACGAAGGAGTCGGACAT
TCAGTGCCAGTCAGGATGGTTTGGTGTAACAAGACCCATCAGAGCAGCCCAGGGCTCCTG
AGCAGCCATCTGCCAGTGGTGGTCAAGGTGTCAGTGACTGTTGGCTTTCTGTTAAAAAAA
AAAAAAAAAACCCAGTGCTGTCAAGTCGATTTCGACTCATAGCCACCTTATAGGACAGAG
TAGAACTGCCCCATAGAATTTCCAAGGAGTGCCTGGTAGATTGAAACTGCTGACCCTTTG
GTTAGCAGCCGTAGCACTTAACCACTACACCACCAGGCTTTTTGTTAGTTGTGGAGAAAT
CAAAAGCCAGGTAGAGCGGCTGGCAGTTAAGGTGGTCTTACTTCTGTGGGTGGTTTCATG
ACCTTAAGCAGATACCGTTTTAGCTTAAAGGGTGAGGCTGGAATCTGGGAATGGTTCTGA
GTGGAAACTTCAGTCTGTGCCCTGTGGAGCCTGTCAGAAGTGTTGTCTGGCTGGCTGAGC
TTATTGCGTGGAAGGTGGAGGAACTCTATGGGTAGAGCTTTACTCTTGGCTGAGTAACCT
TTGGGTGGGCCATGCCTCCTCTCAGGGTTATAGTTTCTTGAGTATCCAAAGGGCAATTCC
TGCCTACCCACCCTCCAGCGTTGTCTTGATCCAATGGGAAATGAGGTCAAGGATGTCTTA
GCATGGCAGAAGAGGGTTTTAAATCAGGGACCAGGCACCGCTACACTGGGCCCCTGGTTC
TGTGGGGCTGGATCCTGCATATCTGCCTGGGTCATCCCCCATGGGGCTTCTTCTCTTGGA
CATAGGCACTCTGGTGAGCCATGTGACTCTGCGCCTCCTGAAGCCAGAGTGTACTCTGGA
TAAGTCATGGTGCCAGGAGGAGCTGGCGGTGGCCGTGAAGAGGGCTGTGAGCCTGCTGCA
CTCCCACACCATCACCAGCAGGGTGGGCAAGAGTGAGCCAGGTAAGGAACAGATGGAACG
CAGGACATGGGTGGGCTGAGCTGGGTGGGAAGGCTGTGTGGGCTGGGGCATCCCTGGCCT
TGGTTTACTCATCTAGAAAGTGGGGAGTTGGGCCAGAGGAGGGTTTCTGAGTCCAGTCCT
GGTGTTCTGAGTTGCCATGACTGCCATTGAGGTTTACGTCTTGTCACTGGAATCTCCTTC
TCTGTTTTAACTCTCACCTTCTGGAGCTGGGCAGTGTTTGGGGTAAGGGCAACGTGAGCT
TTAGAACTGGGCTACCTGCTGTCACCTCTGTGTCATAGTATGCCTTTCTGTGTCAGAAAG
AGCATCCCGCCTCCCTCACTGCCCTGAGGATGGGGACTGCAGCAAGGTGGCCCAGTGCCC
CACCCGGCCTGCAGGTTTGTGCCTGCTTCTTGCCCGCACAGATGCTGCGCCGTTGTCCGC
ACCAGCCTTCTCCTTAGTCTTCCCGTTTCTGAAGATGGTGCTGACCGAGATGCCCCACCA
CAGCGAGGAGGAGGAGGAGCTCATGGCCCAGGTCCTTCAGATCCTCACTGTCCATGCCCA
GCTGAGGGCCTCGCCCAGCACCCCGCCCAGGCGGGTGGATGAGGTTGGTGGGGAGCTCTG
CTCTCCCTTTTGCTTAGGGGGACCAGGGTGGGGGCAGGAGCTTCTGACACCTTCTGACCC
ATCAGCAATCCTGGCGGGAAAGCAGAGAGTATGTTTCTACCTAGAATAGCAACTGTTGGC
AAGGAGGACCAGAATGTCCTCTGTGCAGTTCTCAGGGCCTCAAAGAAGCTTCCAGGTCCC
CTGTATCTTCAAAAAGTGGAAGGACTCTGCATTTATTTTATTGTGTTTGCTTGAGTTTTA
ACTCAAGATATCAGCGTCAGTCTCACTGTGACTTGCTCATGATTACGAGATTGCGCCTTG
GTTCGGTAAGAGGCTTTCTCTTTTAATACATTATGTCATAAAAATTTGCCAAAGTAAGGC
ATGCATATTTAAAAAATTCTAACCATACAGAGGCTAAAAAGGAAATACCATACCCCAGAG
GTAACTACTGCTAACACTTTGATGTGTATACCCTTGTGAATTTTTTTTTTAGGCACGTGC
AAAACTTACATCCACATGCATGGGTGGGTTTTTTCATATAACCATACGTCCTGGGTCTCA
TCTACCTTATTGATTTTCCTGGCTGCGTGGTATTCCATACTGTGGGCGCCATGTTTTATT
GACCTGTTTACTTATTGGTGGACATTTAAACTTTTCTAGCTCTTCCCTGTTTTGAACAGT
GCTGTGATACAGACCTTTGTATGTATGTGCACCTCATATAGCCCGTGGGAGCATTTCTGT
AGGAAGGAGAATTGGGGTGAGGTACTAGGTCATGTGGCATGTTCTGAGATACGCCCTCAC
TAAGAGTTTCCTTTCTCCAAGCCTACTCCAACCTCAGATGGTGTTAGTCTTGCCAGCGAT
GTGCAAAAGAACGGTACCTCATTTTATTTTGCATTTTTTATAACTTGTAAAGCTGAGTCT
CTCTATATGTTTATGGGCCTCCTGCATTTCCTGTTCTGTGAATCTCAAGCCAGCCTCAGA
GTTGTTCTTGTTTTAATCACCGAGGACCATAGTTGACTGGGTTCGGGGCCTGTTTGGACT
TAGTTGTAAACCTCAGGGGTTCCTACAGTAACATCTGATATATGACCCAGGATGTGTCCC
TGAGGGTGAGAGGATGCCTTCATTTGCTGCTAGGCTTGGTTACAAACCTTCCCTGTGCCT
CGCCCCAACTTGTCTGCTGTTTTCTCCTAGAACGGGCCAGAGCTGCTGCCGCGTGTGGCC
ATGTTGCGTCTGCTGACGTGGGTGATCGGGACAGGCTCCCCCCGCCTGCAGGTGATCTGG
TTTTCATTTGTAGTTACTGTCATTCAGTCTGTGACCACAGATCCCAGGATAAGGGATTGA
GTGCTAGTTCTCTGTTCCCTCGGCCCTGATTCTTGGACTTGGGCAGAAGAGCTGCTGTTG
AGAGCTGGCCTGCACTGTTCTCAGTTAGTGAGAGACTGCTTGGGCCCTGCCACTGAGCCC
TGGCCTGGAGATAGGGTCTTAGCTGTAGTGGGGCTGCGGGGGTGGACATTCTCAGTTCAG
ATCCCTCTCTGAGTCTTTCAGCCCGTCATTGCCTGGCATTCTGCCTGGGCCCAGAGTAGG
CACTTGGTAGACATTGCTGAACTCAACCTGGCAGATCGATGCTCTTCTTAGGTTCTGGCA
TCAGATACCATGACCACCCTGTGTGCCAGCAGCAGTGGCGAGGACGGCTGTGCCTTTGCA
GAGCAGGAGGAGGTGGACGTGCTGCTCTGTGCCTTGCAGTCCCCATGTGCCAGCGTGCGG
GACACTGCGCTCCGGGTACGTGGCCACTCCCCCTCGGGACCACTGCCAGCATCCCTTGTC
ACTGTACGTGAGTTTGAGCTGTGTGATGGGCATTTGAGAGACTGTCCCTCACCCTGATGG
GAACTGCTTCGTGCCTGCACCACTGTGTCCTGGAGAGGCAGTGAAAAGAGGCCACGGGGG
TGGGTCGGGGATCTACCTGAGAATTGGAACAACCAAATAGTTGTCGCGATGTATTGCTGT
CTACTTCTTCACCTGCAAAGACTTCACCTGTGTTCTAAAACGGAATGCGGATCTTGATAC
CTTTATAGACAGATATAACTCACAAAATTAGTTTGTTTTTTCAACCCACCACCTTGTACT
TGGCTTTCATTGTTGGCTTTTGTGCACAAAACTAAACAATCCCCTTGGAGCGATGAGTAA
GTGGTTCCCAAATGCTAGTCTGAAGCCTCCTACCGTTGGCCTGTGACCGAGTTTTCACTG
GCACTTGGTTAAAAATATGGAAGATACGGGCAAGGTGGTAATTTCTGTTAAAGCTAAATT
CATTCAATCAGACTTCCCTTTTTCTGAGATCATGTATGTCTTACTTAGAGTTAGACTTTT
TAATTTTTACGTTACAGAGTTCTGCCATTGTTGTTGTTAGCTGTTGTTGAGTTGGTTCCT
ACTCCTAGTGACTTGATGTACAATAGAACGAAAAGTTGTCCGGTCCTGTGCCATCCTCAC
AATCATTGCTATGTTTGAGCCCATTGTTGCAGCCACTTTGTCAGTCCATCTTGCTGAGGG
TCTGCCTCTTTTTCACTAACCCCCTGTTTTACCAAACATGATGTCCTTCTCCAGGGATTG
GTCCCTCCTGATAACATGTCCAAAGTACGTGAGACAAAGCCTCACCATGCTTGCTTCTGA
GGAGCATTCTGGCTGTACTTCTTCCAAGACAGATTTGTTTGTTATTCTGGCAAAAGAACA
CCAGTTTTACCGCACCTTCATTTCACTAAAGAAAAGCTGTCTTAAGACACACTGAGTAGG
TCGTGAGCTGAGCTGACTCACAGCACTCCCTAGACCAGTGCTGTCCAGTAGAACTTTCTG
CAGTGATGGAAATGCTGTCCAGTATGGTAGGCAGTAGCCATGTGGCTATGGACCATTTAA
AATGTGGCTGGTAGAACTGAGGAATGGCATTTGTAATTATTTCCAATTGATTTCACATCA
AGTAGCCACATGTGGCTAACGGCACCTTGGGTAGCACAGCCAAGAGGAAGGTGAGGAGGC
AGGTTAGAAGCGCTTCCTAAAAGGTTGTGCCTCACACAGTCTAACCCCTCCCCCTTGCAG
GGGCTGATGGAGCTCCACATGGTATTGCCTGTGCCTGATACTGATGAGAAGAATGGCCTG
AACCTTCTGCGGCGGCTCTGGGTGGTCAAGTTTGACAAGGAGGAGGAGATCCGGAAGCTG
GCTGAGAGGTGAGCGCTGCTGGAAGGTCTCGTTTTCCTCTTCTGTCTTCTTCCCCTATAA
AAGAACGCTCAGCCTGCAGTGTGCTCAGCCTACAGTGGAGAGAGGGGCTGGGTGGTCAGG
TTTGGCAGGCAGGAGCTGCAGAGCCTTGTCTGACAAGCCCCCACTGGGGTCTGCACAGGC
TATGGTCGTCGATGGACCTAGATCTGCAGCGTGACCTCTGCTCCTTGCTGATTGATGATG
TGATTTATCACGAGGCAGCCGTGAGGCAGGCTGGGGCTGAAGCCCTTTCCCAGGCAGTGG
CACGGTACCAGCGGCAGGCGGCGGAAGTCATGGGCAGGCTCGTGGAGATTTACCAGGAGA
AGCTCTATGTGAGTAATGACGTGGTCTGGGCAGTACGAGATTGGCTTGGATTCTGCCCAG
CTCCTGGCCTAGTCCAGACCAGAGTCTGAGAGCTCACTGTGACTCCGGTGGCTCTGACTA
ACTTCCTGCCTCACGGTCCTGGTGGCCAGGTGGTTGGTGTACCTGGTGGGCCAGGGAGAG
CACCACAGTGCATTTATTGAGCTATCTGTTGCAGCGGCCGCCCCCGGTTCTGGATGCTCT
GGGACGAGTTATTTCTGAATCTCCTCCAGATCAGTGGGAAGCCAGGTATTCCAACTGTTC
CAGTCTTGTTCTTGTCTCACCCAGAGCTTTTGTGGATGTAAAATGCAGGCAGGCTGGGTG
GGTGCAGTGAGGAGGCGGCATGAATAATGGCACAGTAGAAGGAGAGAGCATGACCTCAGA
GTCAGAGGCCTAGGCTCTACTGCTGGCTCCTCTCTGTGCTGGCTGTGTGGCCTTGGGCAC
ATTTCTCTTTCTTCCGGCCTGTTTCCTCATCACTGTGAAGGGCACAGTGACAGAGCCTTC
TTTGCGGAGTTGTTAAAGTTAGCTGCCGGACAATATGTAAAGTGCCTGTGAGTGTTAGCT
CGCTCCCCCTCAGAGCCCAGCCATAGCAGTTGGAAGATTTGGGAGATGTCTGGGAGCAAG
TGACCTTAGAAGATACTTACCTACCAGAGTAGGTGAGTGACAGACACGCAGTCGATGTTA
GCTTTCTGAGTGGCTGGCCCTGGCATTCCCCATCCCAGGGCTGCTTCGTGTGTCAGTTTA
TGGGCCCGTCTAATGCATGGAGATTATTTCTTTTTTGTCCCAGAGCATCAGCCAGGGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCGTGGGGGAGATGAGCAGCGCTGGTCCCCGACCCAGAGTCACCT
GCTCAGAGTTAGAGGAGCAGGCATTGCACTCACACGTGGGGAGATGAGCAGAGCTGGTCC
CCGCCCAGAGTCACCTGCCTTGGAGCTAGAGGAGCGGGCATTGCACTCACACATGGTGAA
CTGAGGCAGAGCTGGTCCCCTGCACAGAGACACCAGAGCAGATGTCAGAACTCTATTTGA
CAAGTCAGTTGTGCAAGACCATTGGATAAGCCCTGGCCATGGGCTCTATGCTGTGCTCTA
TTCCCCTGGAGCCGTGTGTGCTGCAGGCATGCTCCGTCTCCTGGTGACGAGCTGGAGTAG
CTCTCATCAGCAGAGGAAACCCTGGCTGGCTCTTGCCCCACTGACACACTGCCACTTCTT
TCCCAGGTGTGGCTTGGCTTTGGCCCTGAACAAGCTCTCCCAGTATTTGGACAGCTCTCA
GGTGAAGCCCCTCTTTCAGTTTTTTGTCCCTGATGCCCTCAACGACCGAAACCCAGATGT
CCGGAAGTGCATGTTAGATGCAGCCCTTGCAACGCTCAACACCCATGGGAAGGTAAAAGG
ATTTCAGCCAGCTGAGGGGGCAGGGAGGGTGGCTGGGCCCAGGAAGGAGGCAGGGCTGAG
CAATGGCAACACAGGTACTGAATGCCAGAAATTGTGGAGGGGTGGTAGCCCTGCCAGCGG
AAGACTGCCATTGCATCCCTTTTGATCCAAAAAGATCCTGAAAGAATGTTAAAGTCTTAC
AGGCCTGCACCAATCCTGCCAGAATACTGGGAGAGCTGCTGGTATTGCTGGTTGGCTTGT
CAGGAGGCCCGCCCCAGAGCCAGATTTGGGTTTGGTCACTGGGGCAGAGATCATTCTCCC
TGCACGCAGCTCCGTAAGGTTGGCCTCAGGTCCTGAGTGGGCTTGGCTTTCCAGGAGAAC
GTCAACTCACTGCTGCCAGTGTTTGAGGAGTTCCTGAAGGATGCGCCCAATGACGCCAGC
TACGATGCTGTGCGGCAGAGTGTGGTGGTCCTGATGGGCTCCCTGGCCAAGCATCTGGAG
AAGAGCGACCCCAAAGTGAAGCCCATTGTTGCCAAGCTCATCGCTGCCCTCTCCACCCCC
TCCCAGCAGGTATGTGCCACCTGGCCTTAGGCCCATGGGGCCAGTTGAGGAACTGGGGAC
CCGGCTCTGGATAGGCAGCAGGATGGCGGGGGCAGGGTTAGGTGACCAGGCTCCAGATGG
TCCTGTTTTCTGCGAGGAGTAGCCCCCTTTCCCACGGGACAGCCTGGTTCATGGCCAAGA
GCACCCCCGGAGAGCATTGTAGTGAATTTATGGCAGGCCTCCTCTGTGGGTCTTGCATAG
TGTGTCCATGCCACAGTAAACTGTAGCCTCAACTACTGGCCAGCCTCCTTCCCCATGGGC
TGTGGGCACGGAAAGGGATGACACAGTGAGCAGACTCTGGCAGGACAACCCAAAAATTGC
AAACATGCAACAGGACACAGTATAGTATTTATCTATATTGCATTTCATTGTCATGTTTGT
CATTACAGTGCTCATTCGTGTTTGTATTTAAAAATAAAAAGTTACAATACAGAGAACACC
CATGGAAAAGGGGTTCCTTTAGTCTTTGTATAATTTGTTTTTGTATATTTTCCTTTTTTC
CATTCATTTACTAACAATCATTTTTTGCACTTTGTGTAAACCTTGCACTGGGATCCAAAC
CAAACCCAGTGCCGTCGAGTCGATTCCGACTCCTAGCGACCCTATAGGACAGAGTAGAAC
TGCCCCATAGAGTTTCCGAGGAGCGCCTGGAGGATTTGAACTGCCGAACCTTTGATTAGC
AGCTGTAGCACTTAACCACTATGCCACCAGGGTTTCCCACTGGGGTCCAGAGACTAAAAA
AGATGGGCCCCTCTCGTCATGCTTTTTCCCGACCCTCTCCATATGTTGGTTCCATGTATC
AGGTGCCTTTTACTACAGCCTCAAGCCACAGTGCAAAGGGTTTTTTTTTTTTTCATTTTT
CTCTACTTGGAGAAACATTTGTGTACATTTTCTGTGACTTGCATTTTGGGTCACCCAGAG
TACCCTCCTCAAATGCACAGTTGAGAAGAGTAAGTTTACAAAATTGTGATCAAGTAAGAT
GTCAGAAAACCCGACCTGCAAAGGGCCCCACATGGGTACCGGAAAGTGCTGCGCTTTGTT
GCTCTTCAGTTGGGCTTATGGGCTGTGGCTGGAAGGGAAAGTTTACAGTGTCTCTTGGTT
CTGCTCAACTTGGCCCTGGTCCTGTAGGGCGCAGCCTGGTCTTGAGACATTTGAAAGCCC
AAAGACCTGGACTGCTTATATGGGGGAGCTGTAACACACTTCATCGTAGAGATCTTTCGC
TGAGTGGGTTTGGTCTCTCTGGAGTTTTTCCCACCTGTCCAGGCCTCGGTTCTTCGTTCA
GACCAGAAATAGCGCCGTGCTTGCTGCTGCTGCTGTGTCTGACAAACTGATACGCACACT
AGCATGGGCATGTGTGTCACGTGCGAGAGGGCGTGTGAGGGCGCCATCCTGCTTCTCGGA
CATCCTGGGAAGGTGGGCAGGCAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTGGTGGTGAGCGGCTGCACAGGATGGTATCAGTCACCCAGACCCAGCTGTGGT
GTGGCAGAGCTGCCGCTCTGACAAAGACGTGCCCTCCCCAGGTCCAGGAGTCCGTGGCGA
GCTGCTTGCCGCCTCTTGTGCCGGCCATCAAGGAGGACGCGGGAGGGATGATCCAGAGGC
TGATGCAGCAGCTGCTGGAGTCGGACAAGTATGCTGAGCGCAAAGGGGCTGCGTACGGGC
TGGCAGGCCTGGTGAAGGGCCTGGGCATCCTCTCCCTGAAGCAGCAGGAAATGATGGCAG
CGCTGACCGACGCCATCCAGGACAAGAAGAACTTCCGCCGGAGAGAGGGTGCGTGTCTCT
GAGCTTCGGGTCATCCAGTGTGTAAAGCCAGTCCCGATGGTTGCCAGGGAGGGACGCAGG
GCTGGTGTTTGTGTGTGTGCTGCGGCGGTTCTGTAGGGGCATGTGTGTGTCCCCGTTCCT
CCTGGGTCCTAGATGATGTGGCCTGGGCGTTCTTATTCCTAACTCAACAACACCCTTAGG
TGGGAGAGTTGTTGCCCTTCTAGCTGCTAGTGCCAAGGAGTGACAGGCGGCTCCCCTGCC
CTTTTCTTTCCTCTCAGCCACACCGCTGCTCTGGGATGCTTCAAGCTGGGACAGAGGGTG
CTGCTCCCTCGTGGGAAAGCCACATTAGTCCATAGCTGCCCGGGGTGTTTCTAGAGGGTG
AGGAGGTGGTAAGGGAGGCTGCTGGGCTTCTTCTTGTTCCCAGTGGGCAGGCCTCAGAGA
ACACTCTGTTCCCAGCTGTCCCCCTGCTCCTCCCCAGGAGCCCTCTTCGCCTTTGAGATG
CTCTGCACCATGCTGGGAAAGCTCTTTGAGCCGTATGTGGTCCACGTGCTACCCCACCTG
CTGCTGTGCTTCGGGGACGGGAACCAGTATGTGCGTGAGGTAAGTCCTGACGCTGCACGG
GGGAGCCAGGGGCTGGCCCAGGTGTGAGATGCAGGGCAGCCTCTCAGGTGGTCTAAGGCC
CCCGTGGCTTCTTCTTCCGGTGTAGAATGCCTTCTGCCCACACCTCGGGCACTGGTTACT
GGTGTAGACTATTCTCTGGTTCCCCATAAAGCACTGAGTAGGATGGGAAACTGCCTCGTG
TTCACAGTATCCCAGACCTCAGCACAGGGCCTGACACAGACCCATGAGTGCTAGTCACTG
GAAGCACACAGGGCATGGCATCAGGCCTTAACCCTTGCTTGGGCGAGGACGCCCCTGAAT
GCCTTTTCTCCTCCCTTGAGGCTGCAGATGATTGTGCCAAGGCTGTGATGAGCAACCTGA
GTGCTCACGGGGTGAAGCTGGTGCTCCCCTCCTTATTGGCTGCCCTGGAGGAGGAATCCT
GGAGGACCAAAGCTGGTAAACCACTCTCTTCCTGCCCCTCTTCCTCAACTTCCTGTTTTG
GAAAGTACCCTTGTAGGGATCCAAGTCACGGGCAGCCCTTGTCCTGTATGTGGCCCTCAG
TCCCTAGCCCAGGGAAAAGGCCAAGACTCGGTGCCCTTGGGCAGCTCCATCTTTCTGTGA
TTTGTGCATTCCCATGCACAGGACAGGAGCCACAACCCCAGGTCATGAAATCACAGGGCT
TTAAAGCTGGACTCTGAAATCACCTGGTTCTGTGACTCTAAAGCTGTTTTCCCCATTAAA
ATTCTTCTAAAAGAGAGAGTCTTTTCTGGAACCTTGTACGCAAAACAGACATAGCAGGTG
CTTTAGTTTGGGCGGCGTCTAGTCTGGGGCTCTCCAATTGGCTTCTTCGTTGGTCCTTCA
GACTTGGTTCTATATTGTTTGAAAAATCACACCTGTAAATCTGTTTCCTCAATTGTGGGT
GGGGAAACCGAGGCCCGAGATATGAAGTGAGTTAGCCTTTGATCCCCACCAGGACTGAAC
CTGGCCTCCCTCAGCCCGGTCTCACCTGTTTCCCCCACACTGCACTGCTTCTCAGCCAGG
ATCCCATGGCTTAGCAGGCCCCAGGAGCCTTTTGTACTCTCTGCTGGAGGCAGCCCCTCT
GGCCCCTCCCAGGGAGGGTGTGAGCATGGCCTGCAGAGGAGCAGGCTGGTCACCCCTTGC
CCATGCAGCCCACCCATGTGACTTGCAGGTCTGTGCTCAGTGGGTCCAGTGCTGGGTGTG
TGTCTGTCTGCAGGGTCGGTGGAGCTGCTCGGGGCGATGGCGTACTGTGCTCCAAAGCAG
CTGTCATCCTGCCTGCCCAACATCGTGCCCAAGCTCACGGAGGTGCTGACTGACTCTCAC
GTCAAAGTGCAGAAGGCTGGACAGCAGGCGCTAAGGCAGATCGGGCTCCCGTCATCAGGA
ACCCGGAGATCCTGGGTATGTCTTTTCCACAGGGTCCCTTGTATTGGCTCTCCCCGCCCT
TGGACATTGCAGGGAAGATGCACCTACCCAGGCTGTTGCCCTGAGAGGGCACATTATTGT
CCGCAGTGAATTAACTTCTAAGTCCTAGGTGGGCCACCCTTTTCCTGGAATAATTAGTTG
AGGTTGTATGGAAGCGGTCTGTTTTCCGACTGGTCCAGAGCAGTCGTCATCATTTGTACT
TGTTGTTGTCTTCTTGAATTTAGTCATCATAGTAGTGGGTATAAAATGAGCCCTGGTGGT
GCAGTGGTTAAATGCCCAGCTACTAACTGAAAGGTTGATGTTTTGAACCCACCCAGCGGT
GCTGTGAAAGAAAGGCCTGGCTATCTGCTTCCGTAAAGATGGTTGTTGTCGTGTGCTGTC
AAGTTGATTCTGACGCATAGCAACCCTGTAGAATAGAGTAGAACTGGCCCATAGAGTTTC
CAAGGTGGTAATCTTTATGGAAGCAGACCGTCACATCTTTCTCCTGCAGAGTGGCTGGTG
GGTTCAAACCGCCGACCTGTCGGTTAGCAACTGAGCACTTAATCGTTGTGCCACCAGTGG
TCCTTAATTTCAGGGTTAAACCTGTTGCCGTCAAATCAGTTTTGACCCGTAACAACCCCA
CAGGACAGAGTAAAATTCCCCCACAGGGCTTCCAAGGCTGTAATCTTTATGGAAGCAGAC
TGTCACATCCTTCTCTGGTGTGTTCGAACTGCCGACCTTTAGGTTAGCAGCTGAGTGCTT
AATTACTGTGCCGCCAGGACTTCTTTTCTGTAAAGATTCCAAACCATAAAAAACCTAAAC
CCATTACCGTCGAGTCAATTCCGACTCATAGTGACCCTCTAGGACAGAGTAGAACTGCCC
CATAGGGTTTCCAGGGAGTGGCTGGTGGATTCGAACTGTTGATCTTTTGGTTAGCAGCTG
AGTTCTCAGCCACTGTATCACCAGGGCTCCTCCATAAAGATCATAGCCTAGAAAACCCTG
TTGAGCAGTTCTGCTCTGACACACATGGGGCCGCCATGAGTCTCAATTGATTCACGGCCG
CAGGTTTGGTTTGGTTTAGTGGGTGTGAAGTGGCACCTCCTGGTTTTGATTTACATTTCC
CTAATGACTAATGATGTTGAACGTCTCTTCATGTGCTTGTTGGCTATTTGCATATCCTCT
TTGGAAAAATTTCTATTCAAATCTTACATTTTTTAAAATTGGGTTGTTTTTTATTGTTGA
TCAGCATGGGTCTTTATTGTAGTTAGATTCCCTCGGCTTGTGGATAAGACAATCCAGGTA
TTCGTCTCATGGAATTCCCTGGGCTGGGCTTGTTTATGCAGAACTTTGAGAGCTCGTTTT
ATCTGCGTGTAGCTGCTCTGACCACCTTGGACTTCACTCCCACCACTGGTTCAGGGGCCT
TTGGTGTCTCAAAACAGTTTTCTTCACAAAACCACAGTTGAGTTGCTGCTTCCAGCATAA
AGTCCCTGGTGCCTGGGTTGCTCGCACTGTGGCTGCAGCTCATTGCCCACTGAAATCAGC
CCACAGGTGCCCCGCCAGTCTCAGCTCCACAGTGTAAAGGGATGGCAGCTGCCTCCACAC
AGCGTCTTCAGCTTCCTGCTGGTGGGGTGAGGGTGGCTCTTAGCAGACAGGCTAGCTTCC
TCAGCTGGCAACTTGTGGGGCCTCGGGGAGGAGGGGTCCCAGGGCTCCCTCCTCTCTGAT
CCACGCTGGTTCTGGGGCCACTGGCTTGGCCTCTCGATAGACTTGTACAAACCCACCCCT
CCCCTGTTGGCACCTACAGCCATTGCCCCCGTCCTGTTGGATGCCTTGACGGACCCGTCC
AGGAAGACACAGAAGTGCTTGCAGACCCTGCTGGACACCAAGTTTGTCCACTTCATTGAT
GCCCCGTCCCTGGCCCTCATCATGCCTATCGTTCAGAGAGCCTTCCAGGATCGTTCTACA
GACACGCGGAAGATGGCAGCTCAGATTATCGGCAACATGTACTCCCTGACAGACCAGAAG
GTAACAGCCCAGCTGGGGCTGGGGCACAGAGTCTCTACCCACAGCAGACGGGAAGGGATG
TTGATATTTGGTCCCTGGCTATGTTGGGGAGGAGAAGTGGGCTATTTTTGGAGAATAGGG
AGTAGAAGAAATCTACACTCTCTGGGCATCTTGCAGGTAACAGTGGTTCAGGTGTTTCTT
GGCTTCGTACCCAGTTGAGGCCTGTCCCACTGGGCCTCTTGTGCGGACTGGGGTGGAGGA
TAGGTCCAGCTCCTCACTGAGCTTTCAGGAGTGTTGGTAAAGTGGCTGCTCCTTTGACAA
CCTGCCATGCTTGCTTGTCACAAGTGTGGGCTTCTGGAGGTCACCCAGAGGAAATGAGGC
TTGTTTGGGAAATGTGTTTTATTTGTTTATTTGCTCCCCAAAGATTGCATGTCTGATCTC
ACTGTCTACCACAGCTCTGCATCTCCCAGGAAAAGAAGATAAAAATGGAAATGTCACCAT
GTCAATCATAGAAAATTTGGGAAGTTAAGCAGAAAAACAAAAAATTTTATCCTTAAGTCC
CCCAACACCAAAACAATTACTGTTAATTTTTTTATTACATTCCTGAATATAAACTTATTT
CCAGTTACAGCAAGTAGTTCATAAAATGGATTTTTAAGAGCTACATAATATACCGACAAG
TTTATGTACCTTACCTTATATAGTTCTATCGCCAGTCATATAGTTGCCAAGGTTTTTAGC
TATTTTAAATGATGCCGCAGAGAGCATAAGGCTTTTTCTATATTTGAAATTATTCCCCAA
AGCTGAATGGTACATCAAGAGACACAAACATTTTAAGGTGAAGAAAATGGTAACGAAATT
TGGAAAGTACCAGAAATTTCATTTCCTAAAGATTCTGGAGGCTGAGCAGGTCTTGGTCCC
AGGAGAAGGGCAGGAAGTGTAAGAGCACTGAACTGTATAGGTGCCTGTTTGATCTGTTGA
GGGTAGTCCTGGGTTCACTTCTTGGGTCCTTGATAGGTTTCCTCTAGCAATTGCATGGGA
CCTTCAAGGAAACTGGCGAGGAGTGCTTCATCAGTTACCTTTCCTCATCTATTCTGTGAG
CTGCTAGGCTTTCTTGCCGGGGCTCTTCTTGAGTGCTCCTTCTCAGCAGAATGGTGAGGT
CAGGGTCCACCACAGAACAGGCCCAGAGAAAGCAGCAGTCCTTCTCATGTCATTGCAGGA
CTTGGCTCCTTACTTGCCAAGCGTGACGCCTGGCCTGAAAGCATCCCTTTTGGACCCTGT
GCCTGAGGTGAGTCTAGTGAGGGGAGTGGGGGACTCATTATTTCAGCCTAGGCCTCAGAA
AATGGATTCCTGAGAATTCCCATAAGCGGTTTTTGTGTCTGTCTGGTAGAGGGAAGGAGA
CCGTAGGGGCCCCTCCTTGCTCCTACATGGTTGCCTTTTTGCGCTGTGTCTCATCCCCGT
CCTTGATCTTGCTTGCCTGACAGGTGCGGACGGTGTCTGCAAAGGCTCTTGGGGCCATGG
TAAAGGGCATGGGGGAGTCATGCTTTGAGGATTTGCTGCCGTGGCTCATGGAGACGCTGA
CCTATGAGCAGAGCTCCGTGGACCGCTCTGGTGCTGCGCAAGGTGAGGCCGGAGCAGCCG
AGGCCAGACCAGGAATTCCCTCTCGGGGCCTTCATGTCCAAGTGGTTCATTTCCTTCTGT
CTTCTTATAGGATTGGCTGAGGTCATGGCTGGTCTGGGGGTGGAAAAGTTGGAGAAACTG
ATGCCGGAAATAGTGGCTACAGCCAGCAAAGTGGACATTGCCCCCCACGTCCGAGATGGC
TACATCATGATGTTCAACTACCTGCCCATCACCTTTGGGGACAAATTTACGCCCTACGTG
GGGCCCATCATCCCCTGTATCCTCAAAGTAGGTACCAGTGAACATGCTGAGGATGGTGCT
AACGAGGGAGGCAGGGTGCATGTCTTCTCCTGAAGGGCTGGTGGCTCCCTGCTGTTGGGG
GCCGGGTGGCAGGCATCCTCCTCCTGCTAATTTGGGAGTCCCACTTCCTTTGAGTCTAGG
CTGCCCTGGTTGACCAACCCTCTTTGTGCACAGGCTCTTGCTGATGAGAACGAGTTTGTG
CGTGACACAGCACTGCGAGCAGGCCAGCGGGTCATCTCCATGTACGCCGAGACGGCCATT
GCCCTGCTGCTGCCCCAGCTGGAGCAGGGCCTGTTTGATGACCTCTGGAGAATAAGGTGC
AAATAGGGGACCCACTCTTTGCTATCTGGAACTCCACTTGAGAAATGGAGAGCAGAGTGT
TGCCAGGAACTCTTTTCAGCTTTTTCTAGACCCTTGCTTTTAACCATTTTGTAACTCTAC
CATTTTGTGTAGCAAAGCCTTCATCCTGATTCTCTTTTTGAAAGATTTCTCTATCCAGTC
TTCTAGCTGTATTAAAATTGCAAACATGGGTACCCGTTTAACCTGGAAATTCCAATTTTA
GAAATTTATTCCAAGGACGTATTTGGTCAGGTGCTTGAAGATTCATCTAAAAGGATATTT
GCTGCAGTATTGTTTACCATTTGAAAAACTGGAGATTGGCACATCCGTGCAGTGTCTTTT
TTTTTAAGTCAAATAATGGTAATAATCTTATAGGACTGTATGAGCTGACACAGAGAGCCC
ATGACCTCCTGTTGCCGGCACAGTGTAGGCTATGGTCCCACACGTGTAGTGCGGGCCTGT
TTCTCATTTCGTGTGTGGTTGGGCGCCTGTCTTGGTGAAGAGGGATATGTGTGACAAGGG
TGTCACAGAGTGCTTGGTTGCCTGGATGGTGGGAGTTTTGGTGATTGTTTTAACTCTGTT
TATGTTTTTCCGTATTTCACGAATTTTTAGTCTGAGTATGACTATTATTTTTATAACTTT
AAAAACGAAGCCTTATTTAATTCGACAAGAAAGAAAGTTTATCGCCTAGGCCTCTCCTGG
CTCGTCCATTTCTGTTGGTCAGGATTCCTGGTTTCCTGTTAATGCTTCCCTTTTGTGTGC
ACTCTCTTTCTTTGTGACTTTTATTATAGAAATTAAACATACTGAAAAGTAGAGAGAGTC
TCCATGATTCCATCACTTGGATGCTTTTTAAAAATGTTTATTCTTTCCCATTATAAAAGT
TACACACGTGTTCAGTAGTCGAAAGCTTGGAAAACATGCGGGAAAGTGTAAAGAAATGAC
AGTCGTTTGTAGCTCTTCTCCCATTTCCAGGTTACCGCCTTTAATTTGAGGGCATTTCCT
TCTAGTCTTTTTTCTGTGCAGTGCTTGGTTGTGAGACTGTCCCTTGCAGCTGTGTGACTC
TGTGCTTGGCATCCTTCTCAGGTTCAGCTCTGTTCAGCTGCTTGGGGACCTCCTGTTCCA
CATCTCAGGTGTCACTGGGAAAATGACCACGGAAACTGCCTCTGAAGATGATAACTTTGG
AACTGCCCAGTCCAACAAGGTGCCTGCCCTGGGTTGGTTTTCCTCCCTCTGTGGGTGGTC
GGGTCACTTGGGGGCTGGCAGCCCTGGCATGCCTGCCGTGGAGGCTTTGTGCTCTGTTCA
CACCCTATGTGCTCTGTTCCGTTGTGCCACCACTGGCCGCAGGCAATCATCACCGCCCTG
GGGGTAGATCGGCGGAACCGGGTGTTGGCAGGGCTGTACATGGGCCGCTCGGATACCCAG
CTGGTGGTGAGGCAGGCGTCTCTGCACGTCTGGAAGATTGTGGTCTCCAATACCCCCCGT
ACCTTGCGTGAAATCCTGCCCACCCTCTTCGGGCTCCTGCTTGGTTTCCTGGCCAGCACC
TGTGCGGATAAGAGAACAGTAAGTCTCTCAGACCTTGCTTCTGACCCAGCAGCACCTGAC
GACTCCCTTCAGACCCTTGAAAGCTGGGCCTGCAGAAACTAGGGAGAGAGAGGGGCTAGG
CCAGAAGTTAACCCAGGCCCTTTATTTATTTACTAATTCATTCGTTATGTGTCAAGCATG
TAGTAGGTACTAACTAAGCAGGGGTCTAGAACCTGGGGATATAATGGAGAATAAAGGCAG
CCTCACTCCTAAGCCTTGGGGAGCTACAGTCTGGTAGTGGAGATGGACATTAACCAAGTA
GTCATACAGTTGTAAAACGCAGTTGTGGCAAGTGCTACATGGCAGTACAAATGCTTATAA
ATAGAGGCATTTGACTTAGCCCAGGGGGCCAGGAAAGGCTTCTCAGAAGACAGGATGTTT
AAAGATGAAAGATGAGTAAGCATTAACTAGGAAAATGGCAAAAAACTGTTCTAGGCAGAG
CAGATATAGTGCTTCAGATGTAAGAACAGGATGTGCAAAGGCCCTGTGGTGGGTGGGAAC
ATGGCAAATGTGGGGCTGAGCATAGGTCAGTGTGGCTGAAGTGAGAAAGCAGGGAGGAGC
CAGGGTGGTGTGAGATGAGGCTGGTGAGCGGGGGCTGGGGCCGGCCATGGTCAGTGGTTG
GGAGGAGGTGCCCAACCTGGACTGCTTATCACTTCTTCCAGTCTGCATTACCCCTCTTCT
AACCCCATCCCTGGCAAGCACATTGTGTATTTGGCCCTAAAGAGCCCTGAGGCTCATGAG
GCCTTGGAGAGAACTGGTTTTTTTTACTTAAAGCGTTTGTTCCAAATTCAGCTTCCCTGG
AGCAAGGGCGTAAGCTTCAGTAACTTCTAGGCTGCAGTTTTAAATCCAGGGATACTGGCC
CTTGACTGTGGAGCACATGGAACGTCATGTTCACGTATCAGGTGCCGGCTCTTGCCCTTG
CTTGTGTATTTTATTTTGTAGTGTTTTGCAAGCACACTCCGACCTCTTTAGGGGTAGGAG
CGCTTGGGGAAGTTAAGCCAGTGGCTCACATAAAGTCCAGGAGGTTCTAGAGGTCTCATT
CTGGAGGTGCCGTCCTGACTTGATCCCTGCTGACAGATCGCAGCGAGGACGCTGGGAGAC
CTGGTCCGGAAGCTAGGGGAGAAGATCCTCCCCGAGATCATCCCCATCCTTGAGGAAGGC
CTGAGATCTCCGAAGAGTGATGAGAGGCAGGGGGTGTGCATCGGGCTGAGCGAGATCATG
AAGTCCACCAGCCGCGACGCCGTGAGTATCTCCTGAGGGCCCTGGGCCCTGGTGACCCGA
CTCAGGGCAGGGGAGGGTGGCTACCAGGAGAAGCTTCAGCCCGAGAGGTTTTGCCCTGCC
CTCAGAGACCTGAGAACCTCTCTCCGGGGGCACTGCTGAGAGTGGGTGCTGGCTAGGCCC
TACAGGACTTCAGTGTCCCTCCTCTGAGCTTCCCTACCAGATTCACAGGCTAAGAAATAA
GTGATTTGAGGCCTCAGATGGCCTTTGGTGAGTGAAGGTGAGCCTTCTCTTACCTCTCCT
GAGGTTATGCCAGATCACTCCACTCCGTGTCTCCTCTTGGGTGTAATTAAGATGTGTGGT
ACCTCCTCGGCAGAGAAAGGAAGGCGTGCATGAGTGCCAGGTGGAGGGCGGTGGGGAGCG
GGAGAGGTCTGCGCTCATTCTTAGAAGGAGTGGAGTAGGTGAGAGCTTAAGTACCCCGTG
GGTGGAAATGTATTGTCTGTAGTAATGATACTGTTTCCATAGTAGCAATATTCGAGAGCT
TTGGAGTACTTTACACTGACATTGCTTTCTAAGGTAATTGATCCTCGAAACATCCCTGGG
AAGTAGGTTGAGCATGTAGTCTCTCAGTGTAGATGAAAGCACCAAAGCCACTGATTAGGT
GGCCAGGGAGAAACGTAAGCAAGTAGCTGGTTGCTCAGTCCAAGCATCCTAGTCTGATTT
ACGGGGTCTCTCTTCTCTGTGTGTATTAATGTACGAATTAGATCTGTTTTTTATATTTGC
CTTTAGCAAGAACAGAGTTGTGACTCATTGAATAGTTACCAAGTGCCCCAGAGGCCGAGT
CCTTGCCAGCAAGGTGCCCACGGTCCAGTGGTGAAGCCGACGTGTCAACTAGTATCTAGA
ATTCAGAGTGAGCTTTACTAGAATGGAATTCATTCCAAAGGGAGCAGAGAGCCATCACTG
ATCCCACTGTAGAGCTGAAGACTTCATAGAGGAGGAAGTATCTGAGCTGAGACTTGAAGA
AGGACTTGGAGTTTTCCAAGAGGATAAGCAAAAGAAAGAGTCCAGGGAGAGAGGAGGCCA
GGTCATGAAGGGCCTTGCCAGGTGAAGGTGATTGGACTTGTTGTAGGACGTGGGGCGCAT
CAGAGAATTCACCTAAAAAAATGAAGCTATTGATTCTTAATACGTGGGGGTACATTACAT
ATCTTCTTTGCTTTTTTATATTTGAACATTTTCCCAATAAAGAATTGAATAAAAAGAAAA
GTCAGGCAAAGGAAGTTGTGCTGGCCGGGCCCGGGTTTCCCTCACCGGGAGCCCTGGCTT
CTCTGCCCTTGTCTTCCCCTTGTCTCAGTACAGTGGTGTTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATGTGCACAG
AGCGGCTCCTCAGGGCTCTCCCCCATCCCCCTGTGCAGGAAGACGAGAAGGTGTCAGAGT
TTGCCTTGGACGGTCTGAAGCAAGTTATGGCCCATCAAGAGTCGTGTGGTGCTACCCTAC
CTCGTGCCCAAGGTAAATCCCAGCGAACACCCTCCTCCCACAAGTCATAGCCATAGCATT
AGCATGGAGAGGCTCATGATAGGCTGCAGTGTAGGCAGGAAGTTCCCCTGTTCTCTGAGA
TCCATGGAGCAGACGTGCCGCCCTGGGCAGTGGGGATGGGTCCCTCCTCACCCTTCTATT
CCCAGAGCCTAGTAACGAGTGCTTAGCATGCAATGAGTTGATGATATTCATTGTTCTCCC
AGCTGACAACACCACCTGTCAATACCCGGGTCCTGGCATTCCTCTCGTCTGTGGCAGGCG
ATGCCCTGACCCGTCATCTCAGCGTGATCCTCCCAGCGGTCATGTTGGCCCTGAAGGAGA
AGCTTGGGACTTCGGGGGAGCAGCTGGTAAGAGCCATCATGGCCACACTGGGAGCTTTCC
GACTGCCCTGCCCTCCAGCGGAGGATCCGTGCTCAGCACTCGTGTACCCTGTGGTGTTTA
GGAGATGGCCAACTGTCAGGCTGTGATCCTGTCTGTGGAAGACGAGGCCGGGCAACGCAT
CATTATTGAGGACCTGCTGGAAGCCACCCGTAGCCCTGAGGTGGGCATGAGGCAGGCTGC
CGCCATCATCCTCAACATCTACTGTTCCCGCACGAGGGCGGACTACACCAACCACCTGCG
GAGCCTGGTCTCAGGCCTGATCCGCCTCTTCAACGACTCCAACCCTGTAGTTCTGGAGGA
GAGCTGGGATGCCCTGAATGCCATCACCAAGGTGAGGGGCTGCTGAGCCCCCAGGCGCTT
GTCCCCACTTTGAGCACTCACCGCTGATCAGAATCTGGGAGAGAGTCAGCCTTTCTGTCA
ATCACTGGACATTAGGTGTGCTTAGAAAGTTACTCCCTGGCCCCGAGTTAATAAGACCTA
GTAATAAATCCCACCACCCGTCTGTCAGCCTGTTGTACTGTGGTGGCTTGTGTGCTGCTG
TGATGGCGGAAGCTGTACGAAAAACCAAACCCATTGTTGTCGAGTCAATTCCTGCTCATA
GTGACCCTATAGCACAGAGAAGAATTGCCCCATGGGCTTTCCGAGGAGTGGCTGGTGGAT
TCAAACTGCTGACCTTTTGGTTAGCAGCCAAGCTCTTAACCACTACACCACCAGGGCTCC
TGGAAGCTATGTAACCCTGTTTCAAACACTAGCAGGGTCGCCTATGGTGGACAGGTTTCA
GTGGCACTTTAGGCTAAGACTAGGGAGAAAGTCCTGGCAATCTACTCCTGAAAATTCGCC
GCTGAAAACCCTGTGAATCACAGTACTGTCTGGTATAGTGCTAGCAGGTGAGCCCACTCG
GTCGGGGGGTACTCAGAATACGTGGTGGCTGCAACAGTGGACTTGAGCGTAGGAAGAATG
GTGAAGATGGTGCAGGATCAGACGACATTTTTTTCTGTTGTAATGGAGTTGCCATGAGTC
AGAGCCTACTTGATAGTAGGAACAGAAACAGTAATAAACCATATGCAGCCTTAAAAAAAT
AAAGCCACTTGATTATAGAAATTTCAGACATTTTAAGAGTAGACTCCTGCCTTCAACATT
TGTTAATTCATGGCCCATTTCGTTTATTACCCCCACCCTCCAATGTTATTTTGAAGCAGC
TTTGTGAGGGTTGTTAGAACTCTCTGACATTCTCTGCTTTTCCCTGGATTCCCACAGAAG
CTGGATGCTGCCAACCAGCTGATGCTAATCGAAGAACTGCACAAAGAAATCCGGCTTGCA
GGCAATGAGAGCAGAGGCGAGCATGTGCCAGGGTTCTGCCTCCCCAGGAGGGTAAGCCTG
GGTCTCGTGGTGCAGGATGCTGTGGGCAGGCGGCCTTGCTTTGCCTCTGCTCCGTCACAG
CCTGTGGTAGGGCAGCTGGCTTAGTACTTTGAGGTGCTATCAGCACCTTCGCAGACAGTG
TGGGAACAGGGTTCATGCTGCCTTAGGTGTAGGCTGTGGAGGCCACCATAGCGAGAGCAA
GTGGGGCATGTGGCCTGGTTCATGCTACCTCTGTGTGAGAAGCCTGCTCTGACAGGAAGG
GGCACTTGTCTTCAGTTACATGCAGTTCTTGTCACCATCAAGTTAAGATAGGTCTCTTTT
CTGGACACTGTTCCCCCACTGGCACCCAGTCAGGCGGACCCGTGAAGTTGAGGGGAGGGT
GGCTAAGTGCCTTGCTTTTAGTGGGAGACACCTGGGTCTGAGCCTTTGACTTGACTCACA
GGTGTGATTTTCTTGTCAGGGAGTAACCTCCATCCTTCCAGTGTTGCGGGAAGGAGTCCT
GACTGGCAACCCGGAACAGAAAGAGGAAGCAGCCAAAGCCTTAGGCCTGGTGATTAGACT
GACCTCAGCGGATGCCCTGAAGCCCTCTGTGGTCAGCATCACTGGCCCTCTGATTCGCAT
CCTGGGAGACCGCTTCAGCTGGAATGTGAAGGCGGCTCTGCTCGAGACACTCAGCCTCTT
GTTGGCCAAGGTGAGCGACTAAAAGAAAAAGCTGTTCAGCATTCGGGTCTCAGAGAACAG
ATCTGCCTGCAAGAGACTGACAGAGGTGTCCCATGGCAGCAGAGGGCCAGCTGCATTGGG
GGAAATGGTATAGCAGAGGGGGTTAAGAGCTTGGACTCTAGACTCACTACACCAGGGTTC
CATACCAAGTTCTTCCACTTCATATGACCTGAACGGCCTTGGAAAGTCATACAGCCTCTG
AGCCTATTTCCTCCTCACCTATAACATGAGAGTAATAATACCGCCTACCTCACGAACGGC
TGTTAAATGTGGGCATTACGTGAAATAATGTTGGGTACGATGCCTGGCATACACTAAGCC
CTCGACGCACACTAATTGCTTTTATTTTGAAGAACTGCTGGTTCAAAGGAAAAAACTCAG
GGCTACGTAAATACAATTAAAACATGGTTTAAATATGCTTCAGTTTTTATTACGGCCACA
TGAGAGATGTGAAGAATATGATGAAAGAATGAGAAAGAAGTCTGTGAGCCACTGAAATGG
CTTCAGTTTTTGCCAAAAGCGAAAGAGACAAAGGCCCAACACATTAGCCACTTCCGATGC
TTCACGGGGTGATAATTAAACCGTTCAGATTTAAAAAAGCATAAACAGCAGCACCAAGAT
TGGCGGTTGAGGGAAAATAATCAAATTCTTACCTGAGGTTTGGAAGCAAAAACTACCTTA
AAGTTTGTAGCATTTTCCTTTTGGGATTCTGAATTTCAGCCTCATTTTGTGGAAAATTGA
GTCTTTTTTTGATATGTATCATCTTTACCTTGCGTTACACACTGTTCTTTTTCCATGGTG
TTTAGACGCAAATGGAGTCCTTACCTCGTGCCCCTTGTCCCTTAGGCCGTGAGTCACATG
TCACCCCAGATTTACCAGCTTCACTCTGTGGCATGGCTCCAGCAAATCTTGCACCCCCCC
AACTCCAGGCCCTTCCAGACCTATGTGGCATTGAACCTCCAAACAACTACTTTGCTTTGG
CGTTTAACAATAAGTAAATTCCTAGTCTTAGACATCTGTATTTTATCAAGAGTGCGCCTG
TTTTTCCTGTACATAATGACAGATTAAACTGGATTTTTAATTAGATGGGTGCACATGTAC
GCAGGGAGGAGTTTCTGAGGTCACTTGTTTCATGGGATTGTTCTGAGGGCCACATGTAAA
GTGCCTAACCTGTGAAGTAACTGCTCAGCAGCTGCTAGCTGCTGTTAAGTCCATTTCCTT
GTCTTGCCAGTAGAACTGTCAGTTGTGTCAACAATGCTGACAGTGCGTGCCTGCTCTGCT
CTGTAATGCATTCAGACATGGACAGGTATCCACTGAGCCAAGACCAGTGTAGCCAAGGCT
GTAAGACAGCTCCTTTGGATGATGGCTCCTGCTGCCACTGCCTCCTCCTCCTCCTTCTAG
CGTGATGAAGGGTGCTGAAAATGGATGAGGAGACTGAGCAAAGCCTGGCTCGTCTGGCTC
TCCTCTCGCATGGGATGTCCATTCCTAGCCTCTGCGTGAGGGCTGTGTTGGCGCATGGCG
GTTTGTGATTGCTGTTTGGGCACCACCACAGCTGTGTCTTTTGGGCCTGGGTTTCTCATA
CAGGTTGGGATTGCCCTGAAGCCCTTCCTACCCCAGTTGCAGACCACTTTTACCAAAGCT
CTTCAGGACTCCAACCGGGGCGTGCGCCTGAAGGCTGCAGAGGCCCTGGGGAAGCTCATC
TCCATCCACGTCAAGGTGGACCCACTCTTCACCGAGCTGGTGAATGGAATCCGTGTTGTG
GAGGACTCAGGCATCAGGTGCATGCTGGGGAGAGAGCCGTGCCGTGAGGAGGCCAAGCAG
CTGCCAAGAGCCTGACTCAGGCTGTACCTGTCCACGTGGGAGGGAACAGAGGTGAAGGGG
AGCCCAATCTAAGTCGGCTATTTTGGCTCTGCAGGGACACCATGCTGCAGGCCCTGCGAT
TTGTGATTCAGGGAGCAGGGGCCAAAGTGGATGCAGTCATCCGGAAAAACACCATCTCAC
TCCTACTGAGCATGCTGGGACATGATGAGGTAAGGCCATGGATAGATCACAGGACTGGTG
GGCTCAAGTGGTTTTTTGGTTTGACATCTGCTTTGTGTTAGAAGAACTTGGTACAGCTGC
CAAATGGTCAGTGATAATAGTGATTTCTGACATCTGTATCACCCTTTATGGTTGACCAAA
CATTTCCTCAGGTTGTGAGGGAGACAGGGTGGGTATTTTTGATATTGATTAGTCTATGTA
ATAGATAAGGAAAGTAAGGTTTGTAGAGAATCCAGGTTGCTTATAATTTGCTCTCTGAAC
TTAAGTCACGTTCCCTCTCTGCCCTTCATTTTTCCCATTTGTAAAATGAAGGAGTTCACT
TATTTATTCAAGAACAGTCACTCTCCTGGGCCTGGCCCAGAGGTGAGGCAGGCATGGTCA
CAGAGATCGAGAAACATGATGGAATTAATAATCTCTAGTGCTGTAGTGCCGTGGGTGGGA
CATCTTCAGTTAGAAGGTGAGACTTGCCTGGGGCCATACACTAGTGAGTGGTAGAGCGAA
ACCCAGAGTCTGGGCCCTGTGACCCCTGTTTCTGTCCTGCATCCGTTCTCATGACCCTGC
CTTACCCAGACGGGGAGCATTGAAGTACCATTGGCTGCCCAGCACTGTGGCGGGCTCAGG
AGGGGGTTGAGCCTGTGGATAAGAATTTTCTCTCCCTTCTCACAGACAGCCCTCTGTGTG
GTGACCTAATTTACATTTGTAGGGCTAATCTCTGGAGAGAGGGCTATGGGACTCACTTGC
ACTCCATCATGTGCTCACACATGGGGCCACCATCATCCTGCTGCACGGATCACGGCTCCT
CTATTCGGCTTCTAATCCCCAGCCACCTGCTCCCTGATTAAGGCCTCAGGCCTTCTCTGT
GGGTACAGACGGAGTCATCTAGCTTCTCTTGATCACTGTCTGGGCTTTTACAGGGCCATG
CCAAGCGTGAGCAAGAGTTAGTATTAAACAAATTTGCATCTCACCGCACTGGAGTTTAAA
ATAGATCCAGTTGGAGAGAGTGGGTGTCAGAGAGCCAGCTTTGGCCTTGTTTGGTATCTG
GGGTTCTGCTTAGAGCCCAGAGGCCTAAGCGGCCAGCAGGCCACACCCTCCTCTACCTCC
GAACTTCCACTTGGGTTGGAAGTGGCAATCCAGGGTGGTGGCCTGACATCAGCTTCCCCA
GAGGTCCCTGTTTTTTTTTGGAGGTGGATGGGAGATGGATACCTAGTAAACTAGCACATA
GGCTAAAATCCACTCTCCGGATTCCCTAGTCAGCTGGCTAGGGAGGAACAGCACAGGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCCTCGGTTCTGGGCCTTGTAGCTGCTCGGCCCGGGTGCCTG
GAGCTGTGCCGTTGCTTGCACGGCCTTTCACTCCCTTCTCTGCTCCATCAGGACAACTCT
CGGATCTCCTCGGCTGGATGCTTGGGGGAGCTGTGTGCCTTTTTGACCGAGGAGGAGCTT
AACACTGTCCTCCAGCAGTGCTTGCTGGGTAGGTCTCTCTGTACACCGGGGAGTTTCCCT
TCAGGAACCTGGGCCCTTAACGCGGGGGGGGAGCCCATGTCTCCCTTTCTTCTCAGAGGG
CCTTTGTGTATCTAGACTGCCTGTTCCCTGAGAGTCCAGCTGTTCAAAGTCAAATGGATG
GTGGTAATTTGGAAACGTTAAAATAATGGTTGCGCGGCATGAGGATTGCAATCAGTGTCA
CAGAATTACACATGTAGAAATTGTTGAATTGGGAAAAACAGATGGGCTTTTCATTGGTCC
CGTAACTCTGAGTGTCTCTGTTAAAAGAGCACAGCCCAAATCTGAAGCGGTTTGTGAGAG
ACCTCTCCTTAACTGACCACGTTAGAAGGGAGGTTTGTGTACAGTGTGGGCTGGGGTTTC
CTCTCGTTCCCAGGCGGCACACTGGTCTCAGAGGGTGCTCGCCAGGGATGGATTACCCAG
TAAACAAGGTACACACGGGCTTACTTGTGCTTACTTGCTAATCTGTACTGCACAGTCAGT
TACTAATGTTTCACCACATCTATGATGTGAAATTGTGCACTACAGATTAGTAAGTAAACA
CAATTAAGCCCGTGCGTACCTTGCTTACTGGTTAATCCGCCCCTGGGGCTGGCCCACGAC
TTCATGGGGGTGGAGGCCTGCTGTAAAGTGCAAGTTGACCCCAGTTTTGTCCTCCCTCCC
CAGCGGATGTGTCTGGCATTGACTGGATGGTTCGGCACGGGCGGAGCCTAGCGCTGTCAG
TGGCTGTGAGTGTGGCTCCCTGCAGACTCTGTGCGGGCAGGTACAGCGATGACGTCCAGG
AAATGATCCTCAGCAATGCTGTGGCTGACAGGGTGAGGCTTTTGGGCAGTCAGACACTCC
CCCTCTCTCTCCCCCTCTCCACAAGGCCATGGCCATAGCCTCGCTGACACAGCACAGGAA
GGAAGAAAACCCTAGACAGGGTGTTAAGAGGCCTGGGGTCAAATTTTACCTCTTCTGGTC
ACTTATTATAAGCTTAGATGAGTACGTGATCTCTCTGGACCCCAGTGTCATCATCTAAAC
AATGAGTTTAGGTTAGAGGGCGTCCCTTCTAGATTGAAAAGTCCCGGAAGCCAGCGACTC
AGACTTTGTTCATCTGCCCAGTTGCCAGGGCAGCCTATCTGAAGGAGAGCTGTCACGGAG
TCTTCAGTGTAAAGCAATAAGGATTGAGATGGGTGGTGAAGAGCCAGGGGCCAGGGACCC
CGGGAATGGACTTTGCCCAGCCCTGCCGCTCCGCAGAAGGAGTGGGAAATTATCCTGTCC
AGCTCTTCCACGATTTACTCTTTACTTTTCCACAGATCCCCATTGCGGTGAGTGGGGTCC
GGGGCATGGGCTTTCTGATGAAATATCACATTGAGACAGGAGACGGACAGTTGCCAGCCA
GACTCTCCAGCCTGTTCATTAAGGTGAGTGGGGCAGGGACTAGGTTTGACCCACAAACCT
GGGCTGTGTGAGAAGGACCTGGGATCACAGAACACCAGAGATGTACGCTGAGACTCGAAG
TTCTCCAGGGAGAGCCTTTAGTAGATCTCGGAACCTTGGAAGTGGGATGCAAAATGTTTC
TATGTGTATTTTTCTCTGGTAGAGTGTTTAACTTGTTGTCATATTCTCAGAGACCTTGGT
TCAAACCAAGTTAAGAGCCACTATTTTAGGCTTTTTTTGTAGGCACCCTACTGGCCCTGG
TGTTGTAAAATTAGGGACTGGTCTGGGTTCAAATCTTAGTAAATCTTCTTTTCCCTTCCT
CCCTTCTTTAGCTGGCACAGCACCGTTGTTAGTGTGGGCATTGTGTTGGGTGCAAGGCCC
TAAATAGGGGAGCTGGGGACTCTTGACAGTGGGGCTCCCGCTGCCGGTGTAATACAGTAC
ACTTCTCAAACTGTTGTGTACACACAAGTCAGAATGAGAATCTGCATTTAGTAAGCTGGG
GTCAGGCCTAGGACTCTGCCTTTTCAGCTAGCTCTGGGCAATGTGAGTGCTGCTGGGGGA
CAGACCTTACTGTGTGTAGTGAGCCTCCAACAAGTGATTGCCTCCACCCTGCAGGCCCCA
GGCCCCTACTGAGAACTTCATGGGGGCTCCGATTAGACTGGCCCGTGTGAGCCTCACCCT
GCATTCAGTTGTTCATCCAGCATTTATTTACTAAGCACCCACTGTGTGTGCCCGGCTGGG
CTAGACCCTGAAGGCATAGAGATGAACAGGATCTCTGGGGTCAGAGACACGCAGGAAACC
CCATGGGAGGGCCCTCATTTAGATAGGCTTGTCTGGGAAGGCCCCTGAGGAGATGGCATT
TGAGCTGAGACCTGCAGGATGAGAAAGAACCAACCGAGCAAAGCACCAGGGGCAAGTATG
TCCCAGGCAGTGGGAGCAGCCAGTGCAGAGGCCCTGAGGCAGGAAGGCACATGGCATGTT
TGAGGAAGTGAAAGCCCCCTGTGGGCCTGGAGTAGTGAGCCCGGGGGAGAGGTGGATGAG
GCAAGATGGGAAAGCAGATGGCTGAGTGTGCAGCACGCCTCCCCATAGGAGGGGACCGTG
TTGGAAGGGGATAGTCGGGACCGTTTCCAGGATGGAGAGTGTCCGACCAGGAACTGGGGC
TTCTCTGTGATTAGAGAAACAGAGTGGGTGTGCCTCACCGGAAGTCTGTCTCTTCCTGTC
CGTAGTGTCTGCAGAACCCATCCAGTGACATCAGGCTGGTGGCCGAGAAGATGATCTGGT
GGGCAAACAAGGACCCGCTGCCTCCCCTGGACCCCCAGGCCATCAAGCCCATTCTGAAGG
CACTCCTTGACAACACCAAGGATAAAAACACCAGCGTCAGGGCCTACAGTGACCAGGCGA
TTGTCAATCTCCTCAAGATGAGGCAGGGTGAAGAGGTGTTTCAGGTGGGAGCCTGGGACT
GGTGTGCCCAGGGTGTGCTGCAGGCAGTTGCTTTGCATTTCTTCTTCTGCATGACGGTAT
TCAGGCCTCCTGCTCTTCTCTGCCACCTCATAGGTGTGCTAGTTCTGAGCACCAGCTTGT
GATTCGGGTGCCTGGCCTGGTGCCTGGAAACACACCTTCCTCCATTTCTGTGGCTTCTAA
ACATCTTTCAGTGGCAGAGCTCTTTCTTCAAATACATCCTCACGTGGCACCCAAAGCTAT
AAAACGGATCCAAGTAAAGGTGCCCAGTTGAAGCCTAGAGCTCTGTCCACTCAGCCTCCT
ACCCCCAGGCAGCCCTAAGGCTCTAAAAACCGCAACCACCTGCACCTCACCACCTGAAAA
ACATCATGAGTGTTTTTCTCAGCTTTCCCCTGGCCCATCTCATTTCTCATTTCGCCAAAT
TCCACCTCAGTGGCACTAGTTCTAAGGTTACATTCATTTTTGTTTTTACTTGATTTAAGG
AGAAGTCTGGAGCCATATGTTCTGACTACGTCTCCTCTCTCCCACCCTTGCCTGCAGTCT
CTCTCCAAGATTCTGGATGTGGCCAGTTTGGAGGTGCTGAGTGAGTGCCACCGAAGGTCA
CTGAGGAAGCTGGGCCAGCCAGGCGACTCACGGAGCAGTGGACGACACCATCTGACCTGA
TGACTGGGCCCTGCTCATCACTGAGCTCATGTCAGCATTTCGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCACTGTTTTCATTTTGAAAATACGTTTGTTCGATGAG
GAGCTTTAGAGAATGGCATTCCCAGAAAGTATTTTAATATATCAGCAGACCACAGCCAAA
GCCTTAAATCAAACCCACACACAACTCAAGATTGCCTCCTCCATCTCACACCCTTTTCTC
TGGAGAAGAGAAGAAAAAGCACATGCAGACACCTCACCACATGGTGGCTAAGGAGCTGCT
CACCCCGTGTGGTGTGGCAGGGTCAGGAACAAGGAGGGTCAAACTTCCAGTTCCTCTTCT
CCTGTGCTTGAGCTCAGGGTCGAGAGTGGGTGCCAGCAGCTTTTTGCCTAGATCCTGAGT
GGGGCCCAGAACCGTGGCAGGCTGCCCAGTGTGGGGTGTCTCGTCTTGGCTTTTTGCTGG
TGTACACCCTGATGGGATCTGACCCATCATATGAAAATGGTACCCACACAGCCCTGGCTG
GTGACATATCTGGGGAGGGGCATAGGTTTAGATGCAGGCTGTTAGAAGGAGGAGTGTTTA
ATAAAGGCTTTGATTTAATCTTGATAGAAGCCGGTTTTTTTTTTTTTTAATCTTCTAATA
TCCATTAAACATGAAGCTACATGCATCAGGAATAAGGAAAGGTTTGCAGCTATTTTTGTA
AGTATTAGCAGACCAGTAGGCTTTCTAGTAGCCCTGGTGGCACAGCAGTTAAAGTGCTCA
GCTGCTAAGTGAAAGGTCGGTGGTTCAAACCCACCAGCCATTCCATGGGAGAGAGACTTG
GCAAACTGCTTTTGTAAAGATTTATGGCCTTGGAAACCCTATGGGGCAATTCCACTCTGT
CCTACAGGGTTGCTATGTGTTGGAGTCGACAGCAATGGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 7181..7283, 13367..13430, 14259..14390, 16322..16430, 16531..16629, 16730..16868, 17230..17231, 17407..17475, 17606..17714, 18303..18377, 18648..18776, 19458..19508, 19609..19707, 19808..19981, 22409..22430, 22432..22562, 24702..24794, 24895..24970, 26081..26111, 26114..26239, 27037..27226, 27319..27443, 28255..28433, 28929..29022, 31102..31215, 31334..31532, 32585..32740, 33161..33342, 34530..34610, 34971..35114, 36420..36547, 36718..36907, 37114..37184, 38466..38631, 38994..39188, 40841..41087, 41557..41678, 42020..42134, 42913..43063, 43066..43094, 44899..45119, 46318..46386, 46583..46721, 46810..47006, 47193..47315, 48442..48558, 48702..48917, 50016..50180, 51892..52053, 52478..52531, 52533..52571, 52802..52945, 53041..53310, 54237..54350, 54799..55029, 56643..56836, 56974..57088, 59091..59187, 59883..60031, 60515..60622, 61865..62083, 62637..62712, 62714..62721, 62724..62726, 62729..62737, 62740..62751, 62754..62759
1001..1018, 7181..7283, 13367..13430, 14259..14390, 16322..16430, 16531..16629, 16730..16868, 17230..17231, 17407..17475, 17606..17714, 18303..18377, 18648..18776, 19458..19508, 19609..19707, 19808..19981, 22409..22430, 22432..22562, 24702..24794, 24895..24970, 26081..26111, 26114..26239, 27037..27226, 27319..27443, 28255..28433, 28929..29022, 31102..31215, 31334..31532, 32585..32740, 33161..33342, 34530..34610, 34971..35114, 36420..36547, 36718..36907, 37114..37184, 38466..38631, 38994..39188, 40841..41087, 41557..41678, 42020..42134, 42913..43063, 43066..43094, 44899..45119, 46318..46386, 46583..46721, 46810..47006, 47193..47315, 48442..48558, 48702..48917, 50016..50180, 51892..52053, 52478..52531, 52533..52571, 52802..52945, 53041..53310, 54237..54350, 54799..55029, 56643..56836, 56974..57088, 59091..59187, 59883..60031, 60515..60622, 61865..62083, 62637..62712, 62714..62721, 62724..62726, 62729..62737, 62740..62751, 62754..62756
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved