Loxodonta_africana Locus ENSLAFG00000005568
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000005568
Loxodonta_africana
ENSLAFG00000005568
GeneScaffold_7115
SNORD61
1152..1223
5977
ATGCCTCGAGCAATTTTGGAATGCTGCCTGCGGGAATGGTGGCGGAGGTTGGGGCTTGC
AGGCTGGAGCAGGACAAGGAGAGCCCGCGCCACCGCGGTCCTTGCATTGGCATGGCGCTA
GCGCTAAGGATGTACATGAGGACTTTGTGCAGGGTCCTTGTTCACAGGCGGCCTCGGAGA
GGAAGCCGTTTGAATTTTTCCAGCCTTTCTGGGTGGTAAAAGTTCCTCATCTAATCGATG
TTGATTGTTCTGGGCGGGTTCCAAGTGTCGCCATTTTGTCTTCTCCACGCGGTATTTAAT
GACGGGTTTTAATTAGGTTCTGCCGCAGTTGGGGAGTGTTGAGTGCTACAGTGTGCGCTT
CCACGTCCCGTTATTTAATATGAAACCGAGTGAACGCTTCGTTTCTTTTTAGTCTAATAG
TAACCTATTCGGCGGAGCGCGGAGGCTGGTGAGAGGGGAGGCAGAACTTGGCTCAAACTT
TAGTTCTCCGCTTAGATGTACCAGGGAATCCTGAAGAGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTTTTCCTGTGGT
GGCTTGGGTTTGGAAAACATTCCGTAGATCCGGTAAATTAGAAGTAATGGTTTTAGTGAA
ACAAATGAAAAATGCACTTCTAAACATGTGCCTGGTAAACTTTCCCAGAAAGTTAAATCC
TATTTTTTTTCCAACATATATAATCACCCAAGGGAAAAATGGTTGAAGCTGATCGTCCCG
GAAAGCTCTTCATTGGTGGGCTCAATACAGAAACAAATGAGAAAGCCCTTGAGGCAGTAT
TTGGAAAATATGGACGAATTGTGGAAGGTAAACTGTCTGAGAGTATATGCTGGGCTATTA
TGATAAAAGTAAGCTGTGATGAATTTTATTGCATTGATCTTCTGAAATGATAATGTATTT
TGTCCTCTAAGAAGTTCTGAGCTTTCTCACTACGGAGTGTCTTTTGTTATTTCGTTTGAA
CTAGAGTAACACTGTTTTCCCTACCCCCAAACTATTTTTTAGTGCTGTTGATGAAAGACC
GTGAAACCAACAAATCCAGAGGATTTGCTTTTGTCACCTTTGAAAGCCCGGCAGATGCCA
AAGATGCAGCCAGAGATATGAATGGAAAGGTGATATTAACTGCATAATGATTCCATGTTT
CCTAGTGTGTAAAAGAGAGTACAGTCTGTTCTTGTCACAGTTTGGTCCAGAGCAGCTTCT
GAATTTTTGAGTTGTGTATATTTCTAGAGTCCTCCTACCACAGCCTTTTGTAGCAATAAT
CTCAATAGCCTATTCTGCGATTTTGGAGCAAAACTTTGTAGCAAAAGTTAAGGATTATTT
TAACGAAGTTTCTCAGCAGATTATTAGGTGGCAGTACTTTGTCTTGGGATCCATAAAATG
AATTAATAACCTCTTTGGTTATTTTTAAGTTTTAAATTTCATCAAACAGCTCTGGATTCG
CCTTGTGTTTTAGTTTAAAGCATGAGTACCCCCCCTTTTTTAAAATTGTAGTTAGTATCA
ATCTTACAGATAGCAAGCATTTAACGTAAATGGAAAAGTTTTTACCTAAGTATACTTTTT
AACATTTTTGCTAGGATGAGTGAAATTTACCTTTTGGATTGAGTATTTAGTAACTATTTT
GAAGAACATTTTGGTGTCACAGTACAAGGTGGATGTGGGTGTTCCTTTTCATTTTGATAT
AATTAACGATTTTGACTGTTTTATTTTTTTAGTCCCTAGATGGAAAAGCCATCAAGGTGG
AACAAGCCACTAAACCAACATTTGAAAGTGGAAGACGTGGACCCCCTCCACCTCCAAGAA
GCAGAGGCCCTCCGAGAGGCCTTAGAGGTGGAAGAGGAGGAAGTGGAGGAACCCGGGGAC
CACCTTCACGTGGGGGTCACATGGGTAATGACTTTGGTGTATGATAGGGAACTGCAGATT
CCTTCTAATGTATGTTTAGGTTGAGTCCTTGTTCAAAGGCTCCAGCTTTAGAAATTGAAC
AGTTTACGTACCATAAATTATAAACAAAGGACAATATTTCCAAGTACTTCATTTTGTAGG
AAAAGGTTAAGGGAAGTTTCCTTTCAGTAGGCAAAGGTGATGGGCCTATTTTTCTTTGAA
GTAATTTTTAAGACTAAGTTTAGTTTTATTTTCCCAGTCTTTATGACTTCCTCATTACCT
GATCTTGTACAAGTTAAAAGCTAAACTCCCCAACTAAATAAATTATGGTCATATTCTTTC
CCATTAGAAAGAAAACTTTTCAGCTTTTTGATTGAGTTTTAATGTACTTGTCTTTTTTTT
CTTGTAATACAGATGATGGTGGCTACTCTATGAATTTTAACATGAGTTCTTCCAGGGGAC
CACTTCCAGTAAAAAGAGGACCACCACCACGAAGTGGAGGTCCTCCTCCTAAAAGATCTG
CCCCTTCAGGACCAGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGGTAAAGTTCCATTTA
TAACAGTTTGTTCTCCCAATATAATACAAGAATTGAGGCAAACCCTAAAAATGATTTTTA
CTATTGACTCATGGACTTCAGGGGACCTGGGTACATGCAATTCATGAGCCCTGAAAATAA
TTTAGGTACAAACAGGAAATAAACATTTTAGAGAAGAAAATTTATTGATCTAGCTCCATG
TCGAATCAGTACTTTATTGTGCTTTAAGTGAAAGTTTGTAAGTCCATTGAGTCTCACACA
AAAAGTTAAACACAGCTTGCTATGTACTCCTAGCTGTTTTCTTCCTAATGGGACAGTACA
TTCCTCCTCCTGTACCCTGTATTCCCTGTGCCCATTTCAACCAGCTTCTGTCCCACTCTG
CCTTCTCATCTCCCCTCCAGACAGGAGCTGCTCACATAGTCGCATGTATTTACTTGAGCC
AAGGAGCTCCTCACCAGTATCATTTTCTGTCTTAGAAACCAAAAAACCCACTGCCATCAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGGATTTGAACTGCTGACCTTTGATTAGCAGCAGTAGCACTATCGCTGTGCCAC
CAGAGTTGCATTCTGTCTATAGTCCAGACCAATTCCTATCTGAATCAGTACTTGTTAATA
ACTGAGTGTAAATTCAGATTTTCATTTTCTCTTTTAAGTATATTTTTAAAATTATTTTTT
TCGTTTAAGCTCCTGTGTCACGTGGAAGAGATAGTTATGGAGGCCCGCCACGAAGGGAAC
CCCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCCAGAGATGATGGATATTCTACAAAAG
ACAGGTAAGAGTTCAGCTGCCTTCTCATTGGTAGTTAAGGTTGAAGGAGGAATTCAGCAA
ACCATGGATCAAATTACTTTTGTTTCTGCAGCTATTCAAGCAGAGATTACCCAAGTTCTC
GTGATACAAGAGATTATGCACCACCCCCAAGAGATTATACATACCGTGATTATGGTCATT
CCAGTTCACGTGATGACTATCCATCCAGAGGCTATAGGTAAGTTGTTTCGCGTGTGTGGC
TTGATTGTCAGTATTGCTGTAAAACCTGATGCTCTGGGACTTAAAGACTTTGTTTTGTAG
TGATAGAGATGGCTATGGTCGTGACCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTA
CAGAGACTCTTATGAGAGTTATGGTAAGATACTGGTTGAGGGTCTTGAATGTCACCAGCT
TGACTTTAGGTTCATGAGCCATTTTATTAGGCTGTGTGGTGCTTGCTATAAAAGGGACGT
TTGCCTGCTTTTTAGGGGGCGACTTTATCAGCTGGGCTTTTCCTAGTTTTGTGAGGGGCT
TTTGTTCTTTTCTGAGTTTTTTTGGAGGCTGTTTGCTTGCTTTGGAGGGGATTTTGCTTG
CTTAAATTGGCAGCCTTATGTGTTTTCCCCCAACAGTGAAAATACAATTTAAAAATTTTA
TTAACAAGATCAGATGTTTACCATTGCAATATGAAGGAAAGTCTACAGTTCAAAATTGCA
ACTTATCACTGGCAAGTGGCTGAGTTTCTACTCTAAAATAACAAGCTGTCTGGAATATCC
TCTTGAAATACACACCGTCTTCAGTCTTTTCAAACAAACATTAAAATCAATCCATTTCCG
TATCTCAGCAGAGGAGCAAATCCCTGTTATGGCCAGCAATGGCAGAGTTTAAAACTTCCC
AGTTGAGAAAGTAAACGTTTAATACAGAAATTCTGTAAATTCAGATTTAAATGTTGTATA
TATACAATTTATAGTGTTGCCATATTACCTGACCATTGACCCTGCAGGTAACTCACGTAG
TGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATGATTA
CAGCAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAGCCGAAGTGA
CCTCTACTCAAGTGGCCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCTTCTAT
GGAAAGGGGCTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAG
AGGTGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATACTAAAA
ACAAACAAAACTTTGGACCAAAATCCCTGTTCAAAGAAACAAACAAAAAGTGGAACCTAT
TCTGTCATAACTACCCAAGGACTACTAAAAGGAAAAATTGTGTTACTTTTAAAAATTTTC
CTGTTAAGTTCTCCTCCATAATTTTTATGTTCTGGTGAGGAAAAAAAAAAGTAAAACATG
TTTAATTTTATTTGATTTTTATGACATTGCTTTCAACAAGCAAATGTTAAATGTGTAAGA
CTTGACTTGTGTACTAGTGTGTTATTCTCTAAGTGTCCCTAAAGGCCACTTCCTATTTGA
TTCTTCCCAATAAGGCAAGCAATACTAAGATCTTCCACAAACATCTAGCCATCTAAAATG
GAGAGGTGACTCATTCTTTCTACACAAACAAGCTAGATATTAGAAGGGTGGTTGGGTTTG
CTACTCTTAGGATTTCAGGGTGCCTTCAAACTGAAATCTCAAATATTCTCAGTGTGAAAA
ACCTGAGATCAGATGCTTACATAAGGAAAGTGCTATTCACCCAGTAAACCCAAAAAAGCG
AGTGGATAAATGCTGGCCACATTTTGCCTTTCTGACATTTCCTTGGGAATCTACAAGAAC
CTCCCCTTTCCCCCCTCCCCCAATAAGACCATTTAAGTGTGTGTTAAACAACTACAGAAT
ACTAAATAAAACGTTTGGCCAAAACCAACCATGAAGCTGCAAACAATACTTGCTCTTACT
GTTTCAAATTTTTGCAACTCTGTAGTGTCTCACTTTTAAAGGAACAGCTTGATTGCAAAG
GAGAAAATAGATAAGCAATGAAGTTATCTCCAACTTCTCAAAGGCTTATGACTTCTAAAA
AGTGACTCTGTCAGCATTCCACATCAGATTTAAAGCATCAAATGCCTGTGAAACAGCAAA
GATGGTAAGCAAAGCAAACTAGTTTTTCCGTCTAAGTCGAAATTGAACAGTTACCTTCCT
CATAGTACAGTGAAACATACTGTACATCATGGCAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 1302..1408, 2012..2183, 2592..2744, 3549..3663, 3751..3876, 3960..4042, 4667..4977
1001..1106, 1302..1408, 2012..2183, 2592..2744, 3549..3663, 3751..3876, 3960..4042, 4667..4974
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved