Loxodonta_africana Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana CWF19L1
Loxodonta_africana
CWF19L1
GeneScaffold_1673
SNORA12
28406..28554
33096
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGATTAGCTGAAACATTACTTA
TCTGGGTACGTTGATATTTTTTGTGCTTGTGACATTAACGCCATTACTGCCTGAGAAAAT
GGGGTAAGTAGATTCTTTTCCAAAGTCTGTGCCCTTAGGACTATGAAATTTTTCCATTCT
TGTCTCCCCTACCTCCCCCAAATCTTGTGTCCCCACAACCCATCATACACTCTTTTAGCC
AACTAAAGTGATAAACTCCTTGACTACAGTATATAGGGTACTTAGAGTATAAATTATATT
CAAATAAAGGAACTTCCATGTATATGTAACCTTGTCAAGATTATATATAACCTTGCTAGA
CATACAGCTTACTTATTAGACTCCTAACTAGCTATAGCTCTGTGCCTCACTATAAAGTCT
TGGCAAGTTTTTAGTTCATGCTGATACTTGGGGTGTTTTTGTTTCTTTTTTACTCCCTTT
GTCTTTTTTTCTGGTTCCAGGTCTACTCTTCAAATCCAGTTTAAATTTGTTCCCTCCATC
ACCCCCTGAATCTCTTTTAGTGGTTCTTTTAATGTCTAGCTGTTTTAAAAACCACTGTCA
CATTTGCTTCTGTTTTCCCCCCACCTGCTGTCCTACTGCTTTTTGGGTTATTCGACTCAT
TTTTTCTAAAATGGCTCCACTGCTTCACATTTCCTCTTTGCTGGTCTCTCATTTCTCTAG
ACAGCTTCCACATTTCCTTTGCTGTAAATGCCTCCCTCCTCCTTCAGTACTCCATTTTAA
CCTTTATCCTCTACATCTGGTTATGGGCCTTCATGTGATCAATCTCGCTTCAATCATTTG
GGGCTCCTTTAAGCAAAAAATTGGGAGAGGGATTTTCGTTTGCTTTTTTTTTTTTGAATT
GTGCTTTAAGTGAAAGCTTACAGTTCAAATTAGTTTCTCGTAAAAAATTTATACACATAT
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTATTTTTGTGAAATAGACTTTTTGAGATCCAATAGGAGAGCAGGCAG
TGAGCTTGACAGTGAACATGTTGAGGTTGAAGTGCTGACAGAACATTGAATGTATAGTTG
GAAGTGATAGTTCTTCGTAGAGTATATAGCCAAGATTAATATTGAAGAGCATAGGCTTTG
GGGAGTTGGTCCCATGAGGATGAAAAATAAAGCTGAGGAGGGGATGAAATTATTAAGGAA
GAAATAAAAGGGAAGCCAGTGACTGATAGTACCTTGGGGTACATCTTCATCTAGTGGGGA
AGCACAGAAAGGTGACGGCGATTAGAAGAGTGTTTGGAGAGGTCAAGATATTAAGTCATA
GAATTTAAGGGAAGAGAGCATCATTTTAGAAGAGATCATTGGCAATTATGGGGTAATCAG
TGACCTTCAAGAGAGTGGTAGGAGAGGGAAACAAGATTGCAGTGAGTGAAGGAAGTGGGT
TAATTAAGAGGTAAAGCACTTAGAAAATGCGGACTACTCTTTTTAGAGTTTGAAACAAAA
CAGGAGGAAATTCCTTTGTTAGTATGTGTGTTCATTTTGGATGGGGAGTCCCAAGCTGAT
TCCATTTTCTGCAGTTTCATTTACAGCAAAGGAAAGAGCTAGTTGAGAAGATACTCAATA
GATGAAAGAGAGCTGAGAATTGATGGAGCACAGTCTTAGAGGGAACAGGAAGGAACAGAA
TCAAGGAGATAACTTTGGAAGAGAGTAGGCTCTAATTCCTCCCAAACAACTGCTTCTTCC
AGATGTTTCCACCCACTGGGAAGTTGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTATTGAGTATTTTAGCTCTTGGTATCTTTCAGTAGAAATCTTTTG
TGACTTTTTTCAGGAGAGTAGAAGCTGTTTTAACTGACCAAAGCAAAAAGTCAGTCTTAA
AGAAGCATGATCCACAGATGAAATTGCTGAAATCTTAATTATGAATGAATGGGTCTTTAT
ATTCTCTGCTAAAAGTGCCTTCTCTGGAGCCTCCTCTTAAGAATATATTTTGGGGGTTCA
CTAAGTTTCAGTGAAAAGATTTACAGCTAGTGGCAGCTCTGCAGTTGTATTTCCCCTCTT
CCAGATGGTAGCTTTTTGGCTATCAAGATAGTTAAAAAAATTGAGTCATTAAGGGATTGA
GGAGATTGATCTAAATGTGGGAAACAAGATGTTGAAAACTTGGTACTTCTCTAATGAGAA
AGCTTTAATGTTGGGATGCACTGGAACTCACCATTGTATTTGATCTTAGTATTTTTGTAA
GTAATCTGGAAGAGGGTGTACCCCATGTTGGTGGGTGACACCTATCATGGGGAGTGAAAT
ACTATATTGATGGAAATAAGCCTAAGGAAGATCATGAAAGTTTGTGGTAGGGCAGAAAGC
ATCTGTTGAGCTTCAGTGAAGGAAAATGTAAGAATGCATTTAGGTACAAGAAATCTCAAT
GAATGGACTCAGAGTTATCAGTAATGATGCAGAAAATGAACCTATAGATCACTTCCTGCC
AACTTCAGCACAATGTGTCTATGACCAAAAAGGCCAACAAGATACCTGGCATTGTCAAGG
AGGATATTGAAAGCAGAAGGAACAGTGCTATCTTCCCCTTCCACAAACCCGTGATTATTA
CTCGCCTAGAATTTTTTTTTTTTTTTTTAGAATAAATACAAGGGGTAGTGCTGGCTGTGG
TACAGAGAAGATACTGCCAAACTAGGGAAGATCCAGAGAAGGGCTAGTAAAGTGGTGCTG
GAAGGGAGAAAGAGTACAGGTGATGCTCTGTAAGGAAGGATGAGAAAAATGAGGCTCTTT
TATTGGGTTGGGGATAGGGCTAAAAGAGGATTTTGATTAAAGTTTATAAATAATCATAAA
AGATATTCATGGGGAGAAAACAGAATAATTCACCAGTTCCTAAGGTAGTATAACTAACCT
CGAGGCCAATTCCTTGCCCTTCAGCAGAAATCTGAAGGAGGCAAACATGAGACAAAAGGA
AGGTACTGCTTTACTTAATAGAAAACAAAGTTTGGTAATTTCTTTATTTTCAGCTAATAC
ATTTTCTTAAAATAGAGTTGTAAATAATGTTATTGATGAGAACCCCCATAACAAGTCTAA
CTTTTGACAAGCTTTATTTTACAAAGGGCAGTTGTGCCCTTGTACAAACCATACCTTCCT
TGACTGAAGCAAATAAAGAATTACGTGCTTAATGTCATTGAAAAAAAAAAAATGTTATTA
GGTCCTTGAATATTCCATACCAAATATTCTGTATGATCCTAGGGGCCCTGAAGGCTAGTT
TTTAATTGTTGTTTTCTGCATTGACCATGACTATCAGCATTGTTATAGGTATGCTACAGA
GGTATGGTATGCTATATGTATGCTACAAAGCAAATTCTAGATAGAAGCACAGTCTGTGGG
CTCCACAGAGAGCTTACTTCCCCCAAAAAGCATTAATAAACCATCTTTTGGGGACTAATA
TGGAGGAATTACCTTACCCTTTAACCTCTGGCTTCCAACAATTGTTCCTTTTTCTATGTT
CATACTAGTCCAGTTCCCCTTTTGTGTTTGAGATTTCTCTGATTGCTATAAGTATTCAAT
TCAATGTGTAAATCCCAGTGCCCACATTTGTATCCACATATAAATTTCAAAGACATTTCA
AAGTGTTTTGGTATTTCTCAATAACTAGTACGCTTGTTATGGATGACCGAGTTTCTATTC
AATAGGGAGAAATAGATACCAAAAAGTGTGGCTCCGCTTTGGTTTCCAGTCTTGCTACAG
CCTTGAAACCAAGATACCATTTTGTTGCTTTGGAAAAGACCTATTACGAGAGGCTTCCAT
ATCGGTGAGTAGCATTTCATTCTTTTTGACTTCTTGAAGAATTTGCCTTGATCTTCTGTG
TAAACCTCTCTTGTTCATTTTTGAGCATATAAGATCTTGGTTCCTTTTGGCTACTCAGGC
ATTGAAATGACTGACTGAAGTCATTCAGCTTCTCTGAGTTTGGTTCCAAATTTGAAAGTC
AAGTGATTAGATTGTGAAAGTTCGAGGGGTTGAGGTAACCCAAACCAAAGCCCACTTCCA
TCGAGTCAATTTCGGCTCATAGAGACCCTATAGGACAGAACAGAACTGCCCCACAGGGTT
TCCAAGGCTGTGAATCTTTATGGAAGCAGGCTGCCACATCATTCTCCCATGGAGTGGCTG
GTGGGTTGAACCGCAAACCTTTGGTTAGTAGCTGAGCGTTTTAACCACTGTGCCACCAGG
GCTCCTTTCTGAGGTAACAGTACCGTTTAATCATAGCTTTATGTAGCGCATTAGGTCCTG
CTTTGATCAGGTCAAACTGGCACTCTGTACAGTCTTGAAAACTCAAGTTCTTAGTATAAT
CGCTTTGGAAGTATTTCAGTTTGGGAACTTGTAACAATTTTTTTTTAAGTTTAAGTTTGG
AGGTGGAGTATTCTTAGGATGTATTGCAGAGAAAAGTAAACCAGTGTTTTATAGATAATA
GAGTTAAGTAAAGTTAACTCTGAATTATCTTCACTTGATAAAGGGCATCGGTAATCGCTA
AAATAAAAAAACCAAAAACCCATTGCTGTTGAGTTGATTCCGACTCATAGCAACCCTATA
GGACAGAGTAGAACTGCCCCATAGGGTTTCCAAGTAGCGCCTGGTGGATTTGAACTGCCA
ACCTTTTGGTTATCAGCTGAAGCTCTTAAACACTATGCCACCAGGGTTTCCACCACTAAA
ATAATTTAAAATAAAAAACTTTTTTCCCTTTTTGTTCTTTTTTACAAAATACATGTGTTT
GTTGCCGAAAGTTAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
TGTCTGTATATATGCATTCCAGAAAAACCTCCTGTTCTCTAAACCCAAAAAGCATGTACT
AAAAACAGAGCTTATGGGGAAAATAGGATTGGCACAAGCCACTCAAAACCTGTGTAACTT
TTAAGGACCTGAATGCACATTTCTCCAAAAAAGATATACAGATGGCCAGTAGGCACACGC
GAAGATGCTCCCATCTTTAGGCATTAAACCAAAGCCAATCCCATTGCCGTCAAGTCCATT
CCAACTGACAGTGACTGTGTAGGACACAGTAGAACCGCCCCATAGGATTTCCAAGGCTAT
AATCTTTACAAGAGCAAACTGCCACATCTTTCTCCTGTGGAGTAACAGGAGGGTTCAAAC
CGCTGACCTTTTGGTTAGTAACCGAGCACTTTAACCACTGCACCATCAGGACTCCTAAAG
GAGACTAACATGTGGTTGTAATAGAGGCATTAATTAGAGGCCTGATAAGTTCAAGGTTAA
CCTGTTGCCATTGAGTTGATTCCCATTTGTAGTGACACTATGGGACAGAATAGAACTGCC
CCATAGGGTTTCCAAGGCGGTAATCTTTATGGAAGCAGACTGCTACATCTTTCTTCTGTG
GAGCAGCTGGTGGGTTCGAACCACTGACCTTTTGGTTAGCAGCCCAGCACTTAACCATTG
TACCACTAAGGCTGCTTTCTTTAGCCATTACGGAAATGCAAATCAAAACCACAATCATAT
CCCTTCATATCCACTAGAATGGCTATAATCAAAAAGGCAGATAATAGCAAGTGTTGGTGA
GCATGTGGAAAAATTGGAACTCTCGTACACTGTTGGTGGACATGTAAAATAGTGCAGCTA
TTTCCATGAGAAATGTAAACACCTATCTACACAAAACTTGTACTTAAATAATCATAGCAG
CATTATTCATAATAACCAAAAAATGGAAGCATCCTAAATGTCCATCATCTGATGAATGGA
ATATTATTTGGCATGAAAAAGGAATGAAATACTGGTATGTGCTACAACATGGATGAACCC
TGAAAACATGTCAAGTGAAAGAAGCCAGCCACAAAGGACCACACAGTGTTATATGAAATG
TCCAGAATGGGTCAATCTATAGAGATGGAAAGCTGTTTAGTACTTGCCTAGGCCTGGGAG
AAGGTTGCAGGGTTCGAGAAAAATGTGCATGACTGCTGTTGTGTAAGAAGTTTCTTCTTG
GGATAATGAAAATATCCTGAAATTAGATTGTGTTGATGGTTGGAAAACTCTGTGAACAGA
CTAAAAACCATTGAATTGCCATTTTAAATGGGTGAATTTTATGGTATGTGAGTTATATCT
CAATAAAGCTGTTAAAAGCAAGAACAACAAAAAAACCCTATTTAACTTTTTAACCAGAAC
CATAGCAAAAACAAATAGCTATTATAAGAAAAATACTCACATAGTTAAATCTCCAGTAGT
GTTTGCACGGAGAATTACAGTCAGTTCATGTTTTGCATCCTTACACTATGGGGATTGTGC
TTCCTCCTTGGAGATGTGGGCCCTTGGAGACATTGGTTTCTAGTAGAGACCTAACCCAGC
TGGTGTTGAATCCACTCTGACTCATGGTTACCCCGTGTGTATCAGAGTAGAGCTGTGCTT
GATAGAGTTTTCAGTGGCTGATTTTTTGGAAATAGATTGCCAGGTCTTTCTTCTGAGGCA
TCTCTGAGTAGACTAGGACCTCCAGTCTTTCTGTTAGCAGCCAAGCAAACTGTATGAACC
ACCCAGGAACTCTGTGTTTTCAGTACAATAAAACCTAAAAGAACAAAATAGGAGGCTTCA
CACTACCTGATCTCAGAACCTACTATACAGCTACGATAGTCAAAATAGCCTGGTACTGGT
AGAATGACAGACACATAGACTGATGCAACAGAATCTAGAATCCAGATTAAACCCACCCAC
CTATGGTCAGTTGATCTTGACAAAGGACCAAAGTCTGCTAAATGGAGAAAAGACAGTCTT
TTTTTAAAATAATTTTTATTGAGCTTTAAGTGAGGGACAGTCTTTATAACAAATGGTGCT
GGCAAAACTGGATGTCCATCTGTTAAAAAATGAAACAGGACCCGTACCTCACACTATACA
CAAAAACTAACTCAAAATGAACCAAAAACCTAGAAATAAAACCTAAAACAATAAAGATCA
TGGGAGAAAAAATAGGGACAACACTAGGGGCTGTAATACATGCCATAAATAGAATACAAA
CCATAACTAACAGTGCTCAAACACCAGAAGATAAACTAGATAACTGGGAGCTCCTAAAAA
TTAAACACTTATGCTCATGAAAAGACTTCACCAAAAGAATAAAAAGAGAACCTATAGACT
GGGAAAGAAAATTTTGGCTATGACATACCAGACAAGGGTCTAATCTTTAAAATCTATTGA
ATACTTCAACACCTCAACAACAAAAAAACAACTCGATTAAAAAATGGGCAAAGGATATGA
ACAGACCCTTCACCAAAGAAGACATTCAGGTGGCTAACAGACACATGAGGAAATGCTTGT
GATCATTAGCCATTAGAGAAATGCAAACCAAAACTACAATGAGATACTATCTCACCACAA
CATTACTGGCACTAATCAAAAAAAACCAAAAAGACAACAGAAAATAAATGCTGGAGAGGT
TGTGGGGAGATTGGAACTTTTATGCACTGGTGGTGGGAATGTAAAATGGTTCGTTCAACC
ACTATGGAAAACGATACGGATATAGTTGTTGTTGTTGTTAGGTGCCATCGAGTTGCCATC
ATGGCTACCCTATGCACAACAGAATGAAACACTGCCCGGTCCTGCGCCATCCTTACAGCC
GTTGTTATGCTTGAGCTCCTTGTTGCAGCCACTGTGTCAATCCACCTTGTTGAGGGTCTT
ACTCTTTTCCACTGACCCTGTACTCTGCCAAGCATGATGTCCTTCTCCAGGGACTGATCC
CTCCTGACAGCATGACGCAGTCTCACGATCCTTGCCTCTAAGGAGCATTCTGGTTGTACT
TCTTCCAAGACAGGTATGTTCGTTCTTTTGGCAGTCCGTGGCATATTCAATATTCTTCGC
CAACACCACAATTCAAAGGCATCAACTCTTCTTTGGTCTTCCTTATTCATTGTCCAGCTT
TCACATGCATATGATGCGATTGAAAATGCCATGGCTTGGGTCAGGCGCACCTTAGTCTTC
AGGGTGACATTTTTGCTCTTCAACACTTTGAAGAGGTCCTTTGCAGCAGATTTGCCCAAT
GCAATGTGTCTTTTGGTTTCTTGACCGCTGCTTCCATGGCTGTTGATTGTGGATCCAAGT
AAAATGAAACCCTTGACAACTTCAGTCTTTTCTCGGTTGATCATGATGTTGCTCATTGGT
CCAGTTGTGAGGATTTTTGTTTTCTTTATGTTGAGGTGCAATCCATACTGAAGGCTGTGA
TCTTTGATCTTCATTAGTAAGTGCTTCAAGTCCTCTTCACTTTCAGCAAGCAAGGTTGTA
TCATCTGCATAATGCAGGTTGTTAATGAGTCTCCCTCCAATCCTGATGCCCCGTTCTTCT
TCATATAGTCCAGCTTCTCAGATTATTTGCTCAGCATACAGATTGAACAGGTATGGTGAA
AGAATATAACCCTGACGCACACCTTTCCTGACTTTAAACCAATCAGTATCCCCTTGTTCT
CTCTGAACAACTACCTCTCTATCTATGTAAAGGTTCCTCATGAGCACAATTAAGTGTTCT
GGAATTCCCATTCTTCACAGTGGTATCCATAGTTTGTTATGATCCACACAGTCGAATGCC
TTTGCATAGTCAATAAGACACAGTAAGCTTCCTTCTGATATTCTCTGCTTTCAGCCAGAA
TCCATCTGACATCAGCAACGATATCCCTGGTTCCACGTCCTCTTCTGAAACCGGCCTGAA
GTTCTGGCAGTTCCCTGTCGATACACTGCTGCAGCCGCTTTTGAATGATCTTCAGCAAAA
TTTTGCTTGCGTGTGATATTAATGATAACCCAGATATTAATGATATTGTTCTATAATTTC
CACATTCGGTTGGATCACCTTCCTTGGGAATAGGCATAAATATGGATCTCTTCTAGTCAG
TTGGCCAGGAAGCTGTCTTCCATATTTCTTGGCATAGATGAGTGAGCACCTCCAGCGCTG
CATCTGTTTGTTGAAACATCTCAGCTGATATTCCATCAATTCCTGGACCCTTGTTTTTCA
CCAATGCCTTCAGAGTAGCTTGGACTTCTTCCTTCAGTACCATCAGTTCCTGATCATATG
CCACCTCTTGAAATGGTTGAACATTGACTAATTCTTTTTGATATAATGACTCTGTGTATC
CCTTCCATCTTCTTTTGATGTTTCCTGCATTGTTTAATGTTTCCCCCATGGAATCCTTCA
GTATTCCAACTCGAGGCTTGAATTATTTGTTCAGTTCTTTCAGCTTGAGAAATGCTGAGT
GTATTCTTCCCTTTTGGTTTTCCATCTCCAGCTCTTTGCACGTATCATTATAATACTTTA
CTTTGTCTTCTTGAGACACCCTTGAGGGACTGAATTACTGGGGCTGAGGGCTGGAGACCA
TGGTCTACACGGACATCTAGGTTAATTGGCATAACATAGTTCAGAAAGAAAATGTTCTAC
GTCCTACTTTGATGAATAGCATCTAGGGTCCTAAAAGCTTGCAAGCAGCCACCTAAGATA
CATCTATTGGTCCCAACATACTTGGAGCAAAGAAGAAAACCAAAGGCACAAGGAAAATAG
TAGTCCAAAGAATAAATAGACCACAAGAACCATAGGCTCCATCAGCCTGAGCCCAGAAGA
ACTAGATGATGCCCGGCTGCCACCATCAACTGCTCTGACAGGGATCACAATAGAGGGTCC
AGGGCAGAACAGAAGAAAAATGTAAAACAAAGTTCAAATTCACAAAAAAAGCAGACTTAC
TAGTTAGATGGTGGCTGGAGGGAATGCCTGGAACTATGGCCCCTGGATACCCTGCTAACT
TACAACTGAAGCCACTCCTGAAGTCCACCTTTTAGCCAGAGATTAGACAGGCCTATAAAA
CAAACAATAACATGTGAGGCACATACTTCTTAGTTCAGTCAAGTATACGAGACCAAATGG
GCAACACCTGCCCAAAAGCAAAGATGAGAAGGCGGGAAGGGACAGCAAATTGGATTAATG
GACACTGAGAACTCAGGATAGAAAGGGAAAGGGGGAGAATGCTGACACATTGAGGGGATT
GCAACTAATGTCATAAGACAATTTGTGTATAAAATTTTTTACTAAAAAACTAATCTGCAT
TGCAAACTTTCACCTAAAACAATTAAAAAAAAACCTGTAAATGCCGGAACCTGTGTTAGG
TGGAAACTTGTCAGAGAAAACTAAAAAACCTATTGCTGTTCAGTCAATGCTGACTCACAG
TAACCCTAAACAGAGGGAGAACTCAAATATTTCCTGCTAATAGCAGTAGAAAAGTGGTAA
GACTGCACTCTGTCAAAGGCAGAAAACTTGTGAGACCCGGAAAAACAAGGCAGTCGTGTC
GAGTTCCTGCTTTCACAGATTTCACTGTACATGTTCTCATTTTTTCCTAACAGCAGCCCT
GTGAGGTAGAGGTTATTATCCTACTATAAGAATAAGTTATTTATCTGAGATTACTTGCAG
TGATGGACTCTGATCCTGTGCTCTTTTCATGGCCCCATGGAGTCTACTCGATTTCATAAA
TGCAAATCAAATGTGAAGTTTGTTGGTAACCTATTCTCTATCAAATGTTTTAGAAACCAC
ATTGTTCTACAGGAAAATGCACAGCATGCCACTCGATTTATAGCTCTGGCAAATGTTGGA
AACCTGGACAAGAAAAAGGTAAAGGTTTACTTATTTGCTGGTAGGTTAATACTCCTTGTG
TTCCTGATAAATGCTCCTCTTCCCAGTTCAGCATTCAGTTCTTCCTTTCTCCCCAACTGC
AAGGTCCATAGTGACTCTTGAGAAGATATGGTAACAAAAGGTCAGGTTTCCTAGAGTCCT
TTCTGGGAGATTTTAGAAAAAGGTTTAGGAACAGGCCTCATGGAACAAAGGCAAAATTTG
AAATGAACAGTGTTCGTTTTCCCCTGTATCCCTGTGGCTGTCTATATGGGTAATCATGAA
TTTGCCCTCAGATGTTACTCTTGCTTTGCTTCTTTTAGCAACTTCATTTAGCAGGAATAA
TAAAACCCTTCCAAGGGTTTATGTAAGCCCTCCTTGGCTCTGGGAAATCTTAGTGATAAC
TGAAGTCTGTCTTTTTATTGCAAAGCAGTGCAGGTGAGTGAAAGATAATACCAGAAAGGT
AGGTTATTTTTCTCACGTCCCTGAGAGCATTTCTGATGCCTTAGGGCCAAAAGCAGGGTA
CTGTGGATTGAGATAGCTAACATCAAAGTGATCACTCAAACGGGAAAATAGTAAATAATC
TGAATATTATTCTGCTGTAACATGTCATAGACCCTGTGCATGAAAAGATAACCAAATACA
TATTTATTTCTATAACATTTTAAGCTTTTAAACCCACCTTATTCTTAGTAAGCTTTAGAT
TTATACTTTTGTACAGCCCTTTCAAGACTAAACATCATTCACAGTGTTTTCAGCCTACTG
CTTTACCATCAGGGACATGCTAGCCTCAGCTGTAAACAACTCATACTTCGAAGGGAGTGC
ACATTTTTAAAAAATTTGGTCAGCATTACTAAATTCACCTCCAAATTTTGTTCCAGTTTA
CACCCCACCAGCAGTGTATGGGGATTCTCACTGGGTAGTGTCAAATTTTTGTTAAGGTTT
TACCAGTCTAATAGATGAAAAAATGGTGCATCATTGTTACTTTGATTGCATTTCCCTGCC
GAGTACTGAGGTTGAGCATCTATGCATATCTCATCTAAGCTTTTCCAGTTGTGTTTCACT
AGCCTAAGTTCTAGATATTTATATGAATATTTACTTTTTTGCTACTGGTCCCTAAGAAAA
CTTACCAGCATGTATAGTAAAATTTGTATAGTATCAGAGAGGGAAGCCCTAAGTTGTCCA
GTTTTGTAGTTTCCATTAGGAAAGAGGAATGGCAGAGCTCTGATTGTCTTGACAAAAAGT
ACCCAAAGATAAAGGACTCAGAGACAGAAGCAACTTGCCCTGGGGCTTCTAATACTGGTT
GTCATGATGCCCTCCTCTGAGTGAGGACCCCTGACTTGTGTGAGGGCTGGGGATTTGATC
TGTTGCTCGTTCCGTTGTCAGCCCTTGTCAGCCCCTGTAGAGGTCACTGAATTGGCATTT
GACTTACTATGTGTTTTCTGAACCACAGATGAGCAGTTTGCTGCTTTAAATTTACTCAGC
TTCTAAAGCTTTCTATGGAATCTTCCCCCCTGCCCCCCCAAAAATAGGATGATTACATTT
AGATTAACAGCATTTCCCTTAAGATTATTCTTTTTTTCCTCCAAAGTATCTTTACGCATT
CAGTATTATTCCCATGAAACTGATGGATGCAGCAGAACTGGTAAAGCAGCCTCCAGATGT
CACGGAAAACCCGTATAGAAGATCTGGGAAGGACGCAGCCATGGGAAAGCAAACTCCTGC
CCCTGAGGTCTGCTCTGGTGGAGAGCTGGTGTTTTCCGGGCAGAACTGCCCGTTTGTTAC
ACGTGTACTTTTCCTGATGGAGACTTCCTTTCCTTATGGTTTAGTACATTAGACAAGTTT
AATACTTACAGTATAAAACTTTCTTTTTCTCCCGGGGAAATCATGGTGGTGTTAAGAAAG
CTTCAGTAGATTTCGAGTAAGCTCAGAGTTTTTTTTAATTGTAGTTTACGGTTAACAGTT
TTTTATGTTAAATCTTTCCTTGTCTAAACTTGATTCATACGTTGGGATTAAGAATTTCAT
ATGTTAAGTCTTTCTTTGTGTAAACTTGATTAGCTGTTCTTAGCTGTTCAGACAAGATCT
GAATACTTGGGCAGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGAGCTCTTGACAGCCAGTTCAGTATTCTTTTACTGCAGCATACTTCC
AGTTTCATGCTATTTTAGTCATAGGTAGTTATCCACTTGGGAAAGGCCTACCTGTGGATT
GGTTACAAATTCAGAACTTTTCTAATAGATACTTAGTTTCATTGATAATGGTGGTATTGA
TGAAGGTGTCATACTGAGGAACACAACAGGCCCAGCAATTGTGGCAGCACAGTATACCAG
TCTTTGCAAGCTGTAAAGACCAGACAAAGGTTGAGTTCTCTAGGGTAGTTTTGTGCTATA
GCGTGTGGACCTTAGTAACATTTGTCTTCCTTCACATACAGCTCAGCCTCCAGGACCCTG
CTGGTTTTGTCTAGCCAGCCCTGAAGTAGAAAAGCATTTGGTGGTCAATGTTGGCACACA
TGTGAGTTACTTTCATGGACCTTTTACATAGAAGGAGACAGCTGTGGGGTGTTTTTTTTT
TTTTTTCTCTAGTTTTATTTATTTTATTGAAGGATAATGTTGTTGTTGTTAGGTGCCTTT
GAGTTGGTTCTGACTCATAGCAACCCTGTGTAAAACAGAAGAAAACGCTGCCTGGTCCTG
CACCATCTTCACAGTTGTTGCTATATTTGAGCCCATTGTTGCAGCCACTGTACTGATCCA
TCTCATTGAGGGTCTCCTTCTTTTTTGCAGACCTTCTACTTTACCAAGCATGAAGCCCTT
CTCCAGGAACTGGTCTCTCATTATAACATGTCCAAAATTAATACGTAAGACAAAGTCTTG
CCATCCTCCCTTCCAAAGAATTTTCTAGCTGTACTTCTTCCAAGACAGATTTGTTTGTTC
TTTTGGCAGTCTATGGTATATTCATTATTCTTCACCAACATGTTAATTCAAAGGCATCAG
TTCTTCTTTGGTCTTCTAATTCATTGTCCAGTTTTCGCGTGCATATGAGGTGATTGAAAA
TACCATAGTTCAGGCCAGGTGCACCTTAGTCCTCAAAGTGACATCTTTGCTTTGTAACAC
TTTATAGAGTTCTTTTGCAGCCGATCTACCCAATGCAGTGCATCTTTTGATTTCTTGACT
GCTGCTTCCATGGGCATAGATTATGGATCCAAGTAAAATGAAATCCTTGACAATGTCAGT
CTTTTCTCTGTTTATCATGGTGTTGCTTATTGGATCAATTGTGAGGATTTTTGTTTTCTT
TATGATGCGATGTAATCCATACTGAAGGCAGTAGCCTTTGATCATCATCAGGTAAGCGCT
TCAAGTCCTATTTGATTTCAGCAAGTAAGGTTGTGTCTTCTGTATATTGCAGGTTGTTAA
TGAGTCTCCCTCCAATCCTGATGTTGTGTTCTTCTTCATATAGTCCAGCTTCTCTGATTA
TTTGCCCAGCATCCAGAGGCATAATGTACTTATAATAAAAGTTACCTATTTTAAGTATAC
AGTTCAATGGTTTTTAGTAAATATACCAAATTTTGTAACCATCGCCATAATAGTTTTAGA
GTATTTCCATCACTCCAATAAAATCCTTCATGCCCATTTACATTTGATCCCTATCCCCAG
TTCCCAGCAACCACTAATATACTTTCTGTCTCCATAGTTTGCCTTTTCTGGATATTAGAT
AAATAAAACCCATTGCCGTCGAATCGATTTCGACGCATGGCGACCCTGTAGGACAGGATA
GAACTGCCTCATAGGGTTTTTAGGGAGTGCCTGGTAGATTTGAACTGCCATCCTTTTGGT
TAGCAGCCGTAGCTCTTAACCACTATGCCACCAGGGTTTCCTTATATATAAATAAAATCA
TACAATATGTGGTCTTTTGTGTCTGGCTTCTTTAACTTAGCATAATATTGTTGAGATTCA
TCCATGTTGTAGCATGTATCATTATTCCTTTTTATTGCCGAATAGTATTCCATTGTGTGG
ATACACCATATTTTGTTTATCTCTTCACCAGTTGATGAACATTTAGGTTGTCTCTATTTT
TTTGGCCATTACAAATAATGCCGCTATGAACTTCTACATCCAAATTTTTTGTGGACGTGT
TTTTATTTCTCTTGTGCGTGTACCTAGATTGCTGGGTTGTATGGTAGATTTATGTTTAAT
TTCTTAAAAATATGCCCAACTCTTTTCCCAAGGGGCTTCACCAGTAGTGTAGGAGGGCTC
TAGTTTTTCTACATCATCGATAACACTTGTTACTGTCTATCTTTTTGATTATAGCTATTC
TCCTGTGGTTTTGTAGAGCTGGTCTCACAGATCTCTTCTGCTCTCCTCCCTCTTTTACAA
TAAGTATGGATCTCGTAGGATGATGCTTTTATATACTTCTTTGATTGATCGATTGTACAT
TAGATGAAGGTTTACAGAGCAAATTAGTTTCTCATTAAACAATTAATACACATACTGTTT
TGTGACATTGGTTGCCAACCCCATGACATGTCAACACTCTCCCCTTCTCAACCTTGGGTT
TCCTGTTACCAGCTTTCCTGTCCCCTCCTGCCTTCTTGTCTTAGCCCCTGTACTGGTATG
CCCATTTAGTATCATATTATGGGCCTGTCTAATCTTTGGCTGAAGGGCTTTTATATACTT
GAACTTTCTGCATTTTTAGTTCATACTGCTTGGGAGAAGTGATGAAATTGCTTTTGTGAA
TTACTCACTGTTTAAAAGAAGAATTTTCTTTGTCCTAAAAGGGAAGTCCTCTTTTGCTTA
AATATCCAGTTTGGGTTTAAAACGGTGATATCCTTTTTTAGCTCCAGATTCAGAAACTTG
AGCTTATCGATTTTTATTTAGAATTATCTAGTTGGGGACTGGTTCATACTAACCAATCAT
ATGAGAGATTAAAGTAGTAAATTTTCAGTTTTGCCTAGTAGTAGAGGATGTAGCTTTCTA
GTGTCAGGAATACCCATATCTGATTTTTCGTGTGGGTACCAAGATAATAACTATAATGTT
GCTTGGTAGGCACTGAATCAGATTAAAGGAACTGGATGACTTTGAGGAGAATTTTATTCA
GGCTGTGGAAAACCCTGATGCACTGTGTGTGTCTCATAGTAAAGCCAGCCTATTGCAGAC
TTCTTAAGATACGTTTCCTTGGGTAGGGCTCAATTAAACATTATATAATACTATTCTTTA
ATGCTCACATGTCTGGGCTGTATATAAACCATCATCCTCATTTATTCACTTAGAATGAAG
AAAGCTTAATTTTCAGGCTTAAAGTTGTGCCCTAATCACCTGTGTCTAGAACTGGATGTT
TTTCAAGGCTTGTGAGGGAGGTACTTACACACCATTTCTTAGCAGACGGATCCTTTCATC
CACTTTTCATTGATTTTTTTCCTAATTTTGGAATGCGAGGATGATCTTTTTCTCAATTTA
TTCTAACACTCTTAACGGACCTTTATTGTGACCTCCTATAGACTGACTGGAAACCCTGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAGTACTGTAAACAAA
CAAAACAAAAAAACAAAACAAACCCGTTGCTATCCAGTAGATTCTGACTCATAGCGATCC
TAGAGGGCAAAGTAAAACTGCCCCATAGGGTTTCCAAGAGGCAGCTGGTGGATTTGAGCT
GCCAACCTTTTGGTTAGTAGCCATTGCTCTTAATCACTGTGCCACCAGGGCTCCTGAAGT
ACTGTAATGGGGGCCTATTTAGTCTCGACTAGAAGATTTCAGTAGCCTTAGAGTGCACAT
CATGGTATCCTCCCTTCAGAGAGTGTCTGAGTGGCAGAGCAGTCCTGCATATTCTGGTTT
TGACAGAAGTATTTTTATTTGTTATTAAAGGCTGACATCCATCATTGGGAACCTTCGTTC
TCTACCTCTTTGCGTGTATCTGGGTTTGAGGTTTCTCCTTCATCCTTCTACCCCATTAGG
TTATATGTTTGCTTTCCTTTTGTAGAGATCAGTCAGCAGCTTAAAGCTATAGGGTGCTAA
TCAGGTCATCTTAGCCTTTCTTGTGAGCTCAGGGGGTATATTTGGCAAGAGGGGTAGAGA
TTGGTGCTGTTAATAGGGAGGCAGAATGTGATCATTTTTAAATCAGAAGTGATATCTTTC
TGTGACTGAGGGTGATAATAACTGAAAAATTGTTTTCAAGTTAGGAGCCTGGGAGCAAAA
ACGAGCTGTTTGTTGTTCCAGCCTCTTTCAGCCCTGGTGTGTTTGAAGCTAAAAGTCTGT
TTATATTCCTCTCCCAATTCATTTGATACTAAATCCCAATTTGATTCCAATTTGTTGCAT
CTAACCTTACTCTTATAACCATTCACCTACAAGGAAGACCACTTAATACGACTATTATTG
AAATTTACACACCAACCACTTAGGCCAAAGATGAAGAAATTGAAGATTTTTACCAACTTC
TGCAGTCTGAAATTGATCAAACATGAAGTCAGGATGCACTGATAATTACTGGTGATTGGA
ATGCTAAAGTTGGAAACAAAGAATGATCAGTAGTTGGAAAATATGGCCTTGGTGATAGAA
ATGATCCAGAGATGCATGATAGAATTTGCAAGACCAACAACTTCTTCATGCAAATATCTC
TTTTCAGCAACATAAACAGCGACTATACACGTGGACCTTATCAGATGGAATATACTGGAA
TCAAATAGACTACATCTGTGGAAAAGACGATGGAAAAGCTCAATATCATCAGTTGGGACA
GCTTCCTACTACAGATCAGAGCATCAATTACTCATATGCAAGTTCAAGTTGAAATTGAAG
AAAATTAGGAGCAAGTCCACGAGAGGCCAAAGTATGACCTTGGAGTATATCCCACCTGAA
TTTAGAGACCATCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACA
GTCTGAGGGCCCTTTATTGTGACCTCCTATAGACTGACTGGAAACCCTGGTGGCGTAGTG
GTTAAGAGCTGCAGCTGCTAACCAAAGGGTTGGCAGTTTGAATCCTCCAGGCGCTCCTTG
GAAACTCTAAGGGGCAGTTCTACTCTGTCCATAGGGTCGCTATGAATCGAAATTGACTTG
ACAGCAATGGATTTGGTTTGGTTTTTCGGTATAGACTGACTAGAGTTTCAATTTCGTCTA
ACACTTTAAGTCATATGCCTCTCCTTCCTTTGTTGTTTCATACTGAAGGGTCAGTCTTTT
ACATTTTTTTATTTTTTATGTTTCTGCTTACTGAAACGCTTCTATCTCTAGGGGAGCACT
AATGGGGTCAAGGCCCATGACACAATTGGGCCATGGAGCCTTTGTATGAACTCTTCAGTG
GGAAGAAGAGCAAATGTGAAAGCTCTTGCTTTTATGGAAATTTCCTTTCTAGATCATCTC
TCCTAGACCCATTTTTCTTCTTTGAGTTAGTTTGTGCCGTTCTTTTCTCCCACACAACTT
GTATAGTACCGCAGACTTTGGCCCACCTTCCTGTTGGGAAGCCCCAGCAGGTCCAGATTC
CATGTAAGGGAGAAGAGATTTAGAGTGAGTGACTTACCTTAGTTGTACTCTAGGCATCAG
GGAAGAATGACCTTTGGTTTCCATTCTCTTTTCTCTAACCCAGGGTATTTAGCTTAGGGT
TTGGGTATAAGGGAAGATCGAGAAAACCACCCTGTTTGCTTCTCATCTAGGCCTGAAGCT
AGAGGGACAAAAGGCACCTCAGGTTTTATTTGCGGCCCAGCCCAGCACCGTTAAGTAGGA
GGCCACCGGAGGATTTTAGTTCAGAGCCTGCCTAGTAATCAGTTCTACATTTACCTGAAC
TATCCTTTGTTGAGAAACCTCTCGGGAACCCGTGGTGCCTTTCAGTGTCTAGCAAAAGAT
TTAGGATTCCCTCTCTGCACCCATTCCTCTTGATCTCATTTTATTACTTTTTTCCTGGCT
CTCCCTGTCTTTGCCATGTCATCCTCAAGGGATGTATATGGAGTGATGCTGATGGCCCAT
GGCCACGAATGGACAAAATGGGAGGAAGGCTGCTACGGGTCCAAAATAACTGTTGCAAAA
TCCATGTATTTTGCTTATGAGAGAAACATTCATTTAGGTTCTAGTTATATATTGTTAGAG
CTAATGAATCGGAATCGACCCATCGGCAAAGTAGAGCAGAGATAATCCAAGCATAAAACA
GAAGGTGACTGTTTGAAAGAGAGGGAGAAGATTGGGCAAGTGTGAAACTATTCACAAGAA
CTGGAAGTACTTGTAAACAAAACAAAACAAAAAAACAAAACCAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCTGGTTTTGACAGAAGTATTTTTATTTG
TTATTAAAGGCTGACATCCATCATTGGGAACCTTCGTTCTCTACCTCTTTGCGTGTATCT
GGGTTTGAGGTTTCTCCTTCATCCTTCTACCCCATTAGGTTATATGTTTGCTTTCCTTTT
GTAGAGATCAGTCAGCAGCTTAAAGCTATAGGGTGCTAATCAGGTCATCTTAGCCTTTCT
TGTGAGCTCAGGGGGTATATTTGGCAAGAGGGGTAGAGATTGGTGCTGTTAATAGGGAGG
CAGAATGTGATCATTTTTAAATCAGAAGTGATATCTTTCTGTGACTGAGGGTGATAATAA
CTGAAAAATTGTTTTCAAGTTAGGAGCCTGGGAGCAAAAACGAGCTGTTTGTTGTTCCAG
CCTCTTTCAGCCCTGGTGTGTTTGAAGCTAAAAGTCTGTTTATATTCCTCTCCCAATTCA
TTTGATACTAAATCCCAATTTGATTCCAATTTGTTGCATCTAACCTTACTCTTATAACCA
TTCACCTACAAGGAAGACCACTTAATACGACTATTATTGAAATTTACACACCAACCACTT
AGGCCAAAGATGAAGAAATTGAAGATTTTTACCAACTTCTGCAGTCTGAAATTGATCAAA
CATGAAGTCAGGATGCACTGATAATTACTGGTGATTGGAATGCTAAAGTTGGAAACAAAG
AATGATCAGTAGTTGGAAAATATGGGCCTTGGTGATAGAAATGATTCCAGAGATTGCATG
ATAGAATTTTGCAGACCAACAACTTCTTCATTGCAAATATCTCTTTTCAGCAACATAAAA
CAGCGACTATACACGTGGACCTTATCAGATGGAATATACTGGAATCAAATAGACTACATC
TGTGGAAAAGACGATGGAAAAGCTCAATATCATCAGTTGGGACAGCTTCCTACTACAGAT
CAGAGCATCAATTACTCATATGCAAGTTCAAGTTGAAATTGAAGAAAATTAGAGCAAGTC
CACGAGAGCCAAAGTATGACCTTGAGTATATCCCACCTGAATTTAGAGACCATCTTAAGA
ATAGATTTGACACGTTGAACACTAATGACCAAAGACCAGACAAATTGTGACATCAAGGAC
ATCATACATGAAGAAAGCAAGAGATCATTAAAAAGGCAGGAGAGAAAGAAAAGATGTAAA
TCGATGTCAGCACAGACTCTGAAACTTGCTTTTGAATGTCAAGTAGCTAAAGCAAAAGGA
AAAAATGATGAAGTAAAAGAATTGAGCAGAAGATTTCAAGGGACGGCTCAAGAAGACAAA
GTATTACCATGACATGTGCAGAGACCTGGAGATAGAAAACCAAAAGGGAAGAACATGCTC
AGCATTTCTCAAGCTGAAAGAACTGAAGAAAAAATTCAAGCCTTGAGTTACAATAGTGAA
GGATCCTATGGGGAAAATATTAAATGACACAGAAAGCATCAAAAGAAGATGGAGGGAATA
CGATAACAAAAAGAATTGATCAATGTTCAACCATTTCAGGAGGTAACATATGATCAGGAA
CCGATGGTACTGAGGGAAGAATTCTAAGCTGCACTGAAGGCATTGGCGAAAAACAAGGCT
CCAGGAATTGATGGAATACCAATTGAGATGTTTCAGCAAATGGATGCAGTGCTGGAAGTG
CTCACTTGTCTATGCCAAGAAATCTGAAAGACAGCTATCTGGTCAGCTGACTGGAAGAGA
TCCATATTTATGCCTATTCCCAAGAAAGGTGATCCAACTGAAAGTAGAAATTATCGAACA
ATATATCGTTAATATCACATGTAAACAAAATTTTGCTGGAGATCATTCAGAAGTGGCTAC
AGCAGTATATCAACAGGGAATTGCCAGAAATTCAGTCCGGATTTAGAAGAGGACATGGAA
CCAGGGATATCATTGCTGATGTCAGATAGATCTTGGCTGAAAGCAGAGAATACCAGAAAG
ATGTTTACCTGTGTTTTATTGACTATGCTAAGGCATTCGACTGTGTGGATCATAACAAAT
TATGAATAACATTGCAGAGAGTGGGAATTCCAGAACATTTAATTGTGCTTATGAGGAATC
TGTACATGGATCAAGAGGCAGTCGTTCAAACAGAACAAGGGGATACTGCATGGTTTAAAA
TCAGGAAAGGTGTGTGTCATGGTTGTAGCCTTTCACCATACTATTCAATCTGTATGCTGA
GCAAATAATCTGAGAATCTGGACTATACGAAGAAGAACAAAGCATCAGGATTGGAGGAAG
ACTCGTTAACAACCTGCGTTATGCAGATAACACAGCCTTGGTTGCTGAAAGTGAAGAGGA
TTTGAATCACTTACGGATGAAGGTCAAAGACTACAGCCTTCAGTATGGATTGCACCTCAA
CATAAAATAAAAATCCTCACAACTGGAGCAATAAGCAACATGATGATAAATGGAGAAGAG
ACTGAAGTTGTCAAGAATTTCATTTTACTTGAATCCACGATCTATGTCCATGGAAGCAAC
AGTCAGGACATCAAAAGACGCATTACATTGGGCAAATTGGCTGCTAAAGACCTCTTTAAA
GTGTTGAGAAGCAAAGATGTCACTTTGAGCGCTAAGGTGTGCCTGATCCAAGCCATGGTG
TTTTCAGTTGCCTCATATGCCTGTGAAAGCTGGATAATGAATAGGGAAGACCGAAGAATT
GATGCCTTTGAATCGTGGTGTTGGCGAAGAATATTGAATATACCATGGACTGCCAAGAGA
ATGAACAAATCCGTCTTCGAAGAAGTACAACCAGGATACTCCTTAGAAGCAAGGATGGTG
AGACTATAGCTCACCTGCTTTGGACATGGTATCAGGAAGAATCAGTCCCTGGAGAAGGAC
ATCATGTTGGTGAAGTAGAGGGTCAGTGAAAAGGGGGAAGACCCTCAATGAGATGGATTG
ACACAGTGGATGCAACAATTGGGTCAAGCATAGCAACCATTGTGAGGATGATGCAGGACC
GGGTAGTGTTTCGTTCTGTTCTGCATAGGGTCGCTATGAGTCGGAACCGACTCGACAGCA
CCTATCAACAACAACCTCACTCTTGGACGGATACCTGAGAACATTGTTGTAACCTCTAAA
ATCAGATTGTTAAAAGTTGGAGAATTTCTACTGAGCACTTTTTTCCACTCTTCAGGTTTG
CTCTCTGCATAGGCTTTTCTTCCTGGAGAATCACACATACAGTATTGATGTCTCGATTCT
GTGTGCATCCCCTTTAGTGCTATCTTGCTCTGGCCAAAGGAGGCTTGTCTGATGATCATG
TCCTCATCCTGCCCATTGGACACTACCAGTCAGTGGTGGAGCTTTCAACAGAGGTGGTGG
AGGAAGTGGAGAAATATAAGGCTACGCTGAGGCGGTTCTTTAAGAGTCGAGGGAAATGGT
GTGTTCTCTTTGAGAGAAATTATAAGAGCCATCACCTCCAGCTACAGGTAGGTGGTCCCT
GCTCAGGAACTTGGAGGGGTTCTGTGAGGACTTTGATATTGATAATATTTAAGTGCTATT
TATTTTAAATAATATTAGTACTGAATTTTAATTAATATTTAAATATTTAACTTTAATATT
TAAAACATTTAATATAAATGTTCATGTTAGTATTTGAATAACATTCACTTAAAAAGTTGG
AGTGTCAGGTGATAACTCCAGAGATTTCACAGGGAAGTGCACGGTCAGTGCAAGTGAACA
GCACAGACAGTAAGTGCTTTGTGTAGAAAAGGAGTGGTAGTTGAGGAAGACTGTGAAGAC
TTGGACCTTGACAGATGGAGTTTGGAAGGGTGTGTGTACTTTGTGTGGTGGCCCAACATG
AGCAAAGGCTTAGAGGTAAGTAATAGTCACAGAGCCTCACAGGCTAGCACCTCTTAGACG
TTTGCAGACTGTAATGAATAATTTGTCGTTGTGGTGGTTTTCTTTGTGGTACATTTGTTA
AGTTTTCAAATGGCCCCTGACTCTGCCACATATATTACACAGGAGCTGGCAAAGGCTTGA
TGAGAAAGAGATCTCTCTCTGGCTTTTCCCGTGTCAGAGATTGGCTTCCACACGTGGCAG
GCTAGCTCGTAAGTTTAAGTCCTTACAGGCAGGCTGACACAGGCCTGCCTGGCATGAGGA
GAATCTGTGCTGAGGGGTGTTTCTCTGCCCCAGTGATGGATTTGCTACTTCTCAGGGACT
GTGCAGGCACATCTTCCCTGGGACCTACACAAAGAAATTCTCCTGTCTTGCCCCCCTCCC
CCAGGTTGTTCCGGTGCCACTGAGCTGCTGTGCCACTGATGACATTAAAGATGCCTTTAT
TTCCCAGGCTCAAGAGCAACAGATAGAGCTATTAGAAATTCCAGAGCACTCCGACATCAA
GCAGGTGAGACAGGAGGGGAAGGTGATGTTCCAAAAAGGAAAAAAAAACAAACCCAGTGC
TGTCGAGTCGATTCCAACTCATAGCGAACCTATAGGACAGAGTAGAACTGCCCCATAGAG
TTTCCAAGGAGCGCCTGGCGGATTCAAACTGCCAACCCTTTGGTTAGCAGCCGTAGCACT
TAACCACTATGCCACCAGGGTTTCCGTGATGTTCAGGGAGAAGTAAATATTCGGTTTTTG
ACATGTCGATCTGAGAAACTATCAAGGCATTCCAGAAATGTTAGGTAGGCAGGTGACAAT
TTGGAACTAGAGCACAGAGTTTTGATTAGACTGGAGATTCAGGTGGCATTACAGCTAAGT
CCTAGAGTTTTCTGGTATGAGCAAGAAATTAGAAATTTCATAAGAGGGAAACTTAGGAGG
ATAAATGTCACTCCTAGGATCTTGGTAATATCTGCCAGTTTGGCTTTTTAAAATCTGGAT
CCAGTAAGTGTTTTAGAATCTATAGTTACTTGCATGTTTTTATTTTTTTTTATTTCTTCT
GTGCTTCTAGGCTGAATTCTTTGCCAAATTAAAGCTCACAAGAGATGTGCATGGATTTTA
GATTTTTAAAGCATTATTGTATGTTTTCATACAACTCTGTTTACTTTAGATTGCACAGCC
AGGAGCAGCATATTTTTATGTTGAACTTGACACAGGAGAGAAGCTTTTCCATAGAATTAA
AAAGAATTTTCCTTTGCAGTTTGGAAGGTTTGTATGTTTTTCTTCTGCTAAATGTATTTT
TACTAGACCTACTATGAACAAAGTATTAGGTTCCACGGACAATTGATACAAAGCAAAATA
AGAAAGTCTTTGCCCCAAGGACTGTACAGTCATAGGGCAAGTCAGTTATTTACATATATG
ACAGTAATATAATGTATAATGTGAAAAGTATCATGACAAAATTTTGGGGAATAATATACT
TCAGACATTCAGAGAAGGAAGAGTTCATTTCTATTTGGTGGAAGGCTTCATGAGAAGGTT
GAAACTGGACCTGAGAGGTAGATTTAGAGGGCAAAGATTAGGGTGAAGGGATTCCAGCTA
GAGGTAGTAAAGTGCTACCATTAATTGAACTTACGCTTTATGCGAAGAACTTTACATGCA
CTGAACTACTTCACAACTATTTTAGGTAGGTACTTCCATCCCAATTTACTGACATGGAGA
GTGAGGCTCTAGAGCAGAGCTCAACAGAACTTTCCACAATGATGAAAATGCTCTATATCT
GCACTGCCTGCACTAGCCACATGTGGCTGTTGATGACTTGAAATGTATCTAATATAGTTA
AGGAACTGAATTTTTAATTTTAATTAACTTAAATAGCCACACCTGGGTAGTGGCTACTAC
ACTGGACAGCACTGCTCTAGAGGGGTTTAATAACTTATCCATGGTCTTACAGTTGTAGTT
CAAACCCAGGCTTGTTGGAGCCCAAAACATGAGCCCTTAACCTCATTGTTCTGTACCTCT
TAAAGGCCTGGATGAGACTTCATTTCTGGTCCTAATATCAGGCAGTACATGACTGTAAAA
CCATACAGGGTGGTATAAGTTAAGCAAAGATGGAAGACAGGGAGGAGCTGGCAAGAAGAG
ACAAGTACGGAAGGGAGCAGAACATGGATAGAAGAGATTGTCTGATGCTGGTGTCTGTAG
TTTGTTGTAGTTTTTTCCCCCAAGTTAGAACTGGGCTTTGAGTGTCCTGAACACTTACTG
GACTACTTTGGAAAGCCTCCAAGAAATTGTCACCATTGAATAAGTCCAGTAAATGTAGGT
GTTTGCATTTTTTAAAAGATAATCGGTAAATAAGAGTAAGTGTGTTACAAGCATTGTTAA
TGTTATGACATTATCTTTTTGTTGTTGCCGCAGCAACAGATACAGATGTGGACACTGATG
ACATAGGCATGTGATCAAAAATATAGAGCCCACAAAAGGGAGATTCTGTGCATGGTTTTG
TGTTCATGATAGTCAGTTGTATTTTCAGCATTGTTTTCTAAAATACTATTTACAGTTATT
ACAGCAATTTGTAGTTAACAAAATACTTGAAAAGGCTTTTTTTTTTCCAGCTGTACAAGA
AAGGTAGTGCCATCTTCATTTTATAGATGAAGTAGGCTCAAAGGTTTGCCTAGAGAGCTA
GGACTTGAGTTCAGCTCCTTTGACTTTTAGAGGATTTGTGTGATTTGAATTCAACCCTTC
TATTTATCATAGCTTCAAAGTGGAATATGGACCATATGATATGCAAACAGTTATTTCTAA
TATATCAAAAATAAGTAAAAATAAAGATAAAAAAGCAATGGCAGTTAGAAGAAAGTTTGT
ACGTAGTGACATTTTATATGTGTGTCTGTGTGTGGTTATTTTTTAGTCCTGAGGGCCAAG
ATAAGTTGTTTTTGTTGAGAGTGAATTTATGCTGCTGTGCCTGTCTAGACCTGAATCCTT
AGAAGGAGAGGCAGAGGAATTTCAAGTCAGAGTGGGTATGACACTTGAGCGTCTGACTGC
ACCAGGCCCTTGGCAAACTCCTGATCTAGTTGGGATGTCAAAACTAGAGTTTAAGGCAGG
ATGTAAGTACAACTATTGTGGTGCTCTGTGTTAGCTCCCCATTTCGCAAAGCCTTGTAAG
GTAGGTGGTAGTAGGTGTTCTCATTTCGTGGATGAGGAAATCAAGACTCACAGCTGAAAG
TCATTTGTTCAAGTCATAGACAGCATGTGGCTAAGCTAGGAATGGAATTTATCTGCGGTC
TGACTCCAGGGCCTGCCTTCTTTCTACTGTGCCATATTGCTTCTCTAAGTACCAATTCCA
TAGGTCCAAGTTTGTTCAAGAAAAGAAGTTAATGGGGTACAAGCTATTAGGAAAGAGGTA
GGACCTGAGCTGGTCACTTAAAATGGGTATGATTTTAGTAGACAGATGGCAGCAGTGGCG
CTCAGAGCAGGAGAATGGTATGAGCAAAGTCAGAGAAATTTGCATACCTTCTTTGGGTGA
TGCTGAGGAGAGCTCTCTGGCTGGTGAAGAACAGAGGGAGGAGGGATTTTGGGGCTGATA
CTGTCCATTTTGACTTCTTTGTGTCCTTTCTGCAGGGAGGTCCTGGCCAGTGAAGCCATC
CTTAATATTCCTGACAAGTCCGATTGGAGGCAGTGTCAGATCAGCAGAGAAGAGGAAGAG
ACCCTAGCCCGCCGCTTCCGGAAAGACTTTGAGCCCTTTGACTTCACTCTGGATGACTAA
CTAAAGGGAAAGACACTTTACGAACTTCACAGGTTCATCCACCTGTTTTTAAAGAAACTG
CAGTTTCCTATGAGGACTGTTTCCCTGCCTCTCTTTCATGTATTCCCGTGGAACCTGCCC
ACAGCAAAAGGTCTAGGACTGAATAATTTTTGGAAGAAGTCACATTCTAGGATGAAAGTC
CTATGTTAAAAGCATGTCTGTCATCCAGCTCCAAGTACAAGCTTGTGTTTATCAACATTT
TAAAAAACATGTAGACTATCAAATAAAATCCAAAGGCTTTTCTATGGTTGAGAAGTGTCT
TGTGTTCATGTTACCTGTGATCCTTGAAATGATGTAGTCCATGTAATAGGCGGGGCCAGG
GTTTTAGGCCCAGTGTTTCATCCCAGAATCACCCAGGGTGGCTTCTCCCTGAGCAACCTA
GTTTTGAGAAGGGACCCAAGGCCTTTGCCACTTTCTTTTATANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1012..1024, 3875..4089, 6485..6603, 13433..13517, 15106..15246, 16158..16272, 17141..17220, 27737..27946, 28744..28863, 29509..29606, 31955..32096
1001..1009, 1012..1024, 3875..4089, 6485..6603, 13433..13517, 15106..15246, 16158..16272, 17141..17220, 27737..27946, 28744..28863, 29509..29606, 31955..32096
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved