Loxodonta_africana Locus ENSLAFG00000008306
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000008306
Loxodonta_africana
ENSLAFG00000008306
GeneScaffold_4550
SNORA11
5717..5845
8901
GATTGGAGCTGCTGTGCTGGCAGCAGCTAGAGAGGGCGCGGCTGCGGGGTTACTGGTGC
TGAGGACCGACGCCATTGGAGCCCTAGCGAAGGTAGGAATCCAGCCCCAGAATGGACCTG
GAGAGGGCGAGTGGCACCCAACACCCTCCCCTACCCCTTAGGATCTGTGCAAAGCCCCAC
CCCTCAGAGCCAGAACCCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCAGACCCCTGTGCCATGAAATAAGCTTTCTTAGTCCGGAGGCCCCA
CCCCCACCCTACCCTCAGCCACTTCTAGTTAACCTCAGCCTAGCTGACCTCTTGTCCCTA
GCCTGGAGTACGTTGGATTTGAGACCTCCCGCGCTCCAATTCGAGCTTCACCTAGGTCCG
AGACCCCTACCCCATCCACTCCTAGCATTTCTGTATAAGCACAATCTAGACCGGAACCAG
CTGACTTCCCTCACCCAGATGTTGCCAGACAGGGTCCTCGGATTCAGTTTTTCAGAGCCT
TCTGCTGTCCCTGTTGCCTGAGCCCTCCCATCTGCTCCCCCTTCATCCTGGTCCCCTGCT
CAGACCCTGAAATCCAAGCCCTTTGTTTCTCCGTCTCTCAATGCATCCCCTTTGGGATTC
TTCCAACCCAAGCCCTCAGTCAGCCCCCTCTTCTAACCTACTCACTAGGATGGGGATCCT
GCCTATCCTAAACTCCCCTCATCTATCCCTTTCCCAGGACTCTATGCCTCACAGAATCCA
CCCCAGTAGATCCCTCCCATCCTTGTACTGCCTAGTAGCCTTGTGATTGCCACCCCCCAC
CTCCCGCCAAATCCTGCCTCCCAATGAATCCTGCCCCCTAGCCATGAAGCTGCCTCACCC
TCCCTCTCAGGCTGAGCTCTCTTATGCTTGGGTCCCACAGCACTCGCCCAGGGGAGCTAC
AGCATGGAATCAGAAGGCTACAATGTTGAAGACATGGATGAGGGTAGCCAGGGTAGTCGG
GGAGGAAGAGATGATTGAAGGAAACGACTATGAAGAATTTGGTGCTTTTGGTGGTTACGG
CACCCTTACCAGCTTTGACATCCATATCCTCAGAGCCTTTGGTAGCTTGGGTGCAGGCTT
TCGCATCTTGTCGGTGAGGCCCCTTTGGCCACCTGCTTGCCCTGGACCTTCTCCCCTGTG
AATCGGGGGAGGAGACAAGGAGGGCGGGTGAAGGGAGGTTTGAGTGGGGAAGGATTACCC
AGCTTTCCCAAAGCCCTCTCCTGCTTGAGGGGGTGGGGAGATTTGGAAGAGCCGGCTGTC
TGCTGGGAGGAGGCTGGCCAGCACAGGGGAAGCATGATGCACGTGTGCAGAGTTGCCTGC
TTTCCCCTACCCTTCTCTCTGGCCTTGCAGAATGAGCCCTGGGAACTGGAAAACCCTGTG
CTGGCCCAGACCCTGATGGAGGCATTGCAGCTGGATCCAGAAACCCTTGCCAGTGAGGCA
GCCGCCCGTGCTACGAACATAGCCCGCCCTGCGGCCTCCAACTGGGCCACTCCTGCCATT
GCCGCCACTGCCCATATCACTTCCAACAATAGGGCAGCCGCTAACCACCCAGTGGCTAGA
GACCAGGCCTCAGGAGACGATACCGAGCCCATGACATATGCCGAGGCTCAGGGAGTCACC
CCTAGGACAACTCCTGCTTTTCCACAGACCTCCAAGATGCCAGTCAACAGTGAGATGACT
GCCCCTGGGGCTCCAGCAACCTCCACGGAGCCCCAGACAGCCTCCCAGGCCCAGGAGGCT
GCTACTGAGGGCCCTAGTACTGCCAGTGCTTTCTCTCAGGCTCCACGTGCCAGTGAGCTG
GATACCACCCGGCCCAAGACTGTCTTTCTAGGTCAGAACGATGTCTTTGATTTCACCCAG
CCTGCAGGTGTCAGTGGCATGGCCTTCCCACGGCCTAAGAGACCCACCCCAGCCCAAGAG
GCTGCGACGGATGGCCTCAGTGCTGCCTCTCGTGTGCACCAGGCAGCATCTGCCAAGGAG
GTGGCAGCCACCCAGCCCAAGACAACCAAGTCTGGGAAGGCTCTGGCCAAGACTCGGTGG
GTGGAGCCTCAGAATGTTGTGGCAGTGACTGCTGCCGAGGCCAAGATGGCCACAAGCATC
CCTGAGCCTGAGGGTGCAGCTGCCACTGTTCAGCACAGTGCTGAGCCCCGGGCCAGGATG
GGAGGCAAGAGGACGAAGAAGGTGAGATCTCCCTGCCATTTCCACACGCCCTCACTCCCT
TCCTTCCCCTCCCCTCCCCTTTCCTCTCCCTTTCTCTCAGCCTGTCCATGTTTCGCCAAC
ACAAGTGGGCCGAGTATTGTTTTTACTCCACAAAGTTCTTGTCTTCAGGGAGCACACAGA
CTAGTGGAAGAAGAGGTTAGTTCGGGGCCTGGCACGTAGTAAGCACTCAACACGTGTCAT
TTACCAAGTACCTGCTGTGGGTAAGGTGTGTGCCAGACACTTTTGCACGGGGAGCCTGGT
AACCCTGGGTCTCTCCTCTAATGACACAGTCCAAGCACCTGGATGATGAATATGAGAGCA
GCGAGGAGGAGAGAGAGCCTCCTGCAGTCCCACCGACCTGGAGAGCATCGCAACCCCCAT
TGACGGCGAGGACTCCGATGGCCCCTCGGCCCCCGATGACCCTGAGGTCCCAGATACCCT
CAAGGCACGTACTGTGCTTGCCACCCCGCAATGTGGTCCTTCTGCAAGAGAGGGTAAGAA
GCCCGCCCTCCCCCGTCTCCCTCTTCTTCTCCCTCACCGGCCAGTTCTCTGCAGTCACTC
AGGCGTTGATCTCCCCGTGTGTTCCTCCTTCTCCAGGCAAATAAGTTGGTGAAGTACCTG
ATGATTAAGGACTACAAGAAGATCCCCATTAAGCGCTCAGGTAGGCAACCTGTGCCCTTC
CCTGAGCTCTGCCCTTCCCCCACCCTCACCTCTGGGCGTCCTTTTGTTCATATGCCGCCA
CCCCATCAGGCCATGGCTGGCTCCTTCATTTCTACAGCACAGGACCCTGGCTGTGCTACC
CTCAGCAGGGCTGGCCATGGAGCTGCAGCTCTGTGGCCCCTGCTCAGCCCAGGAGCTCTC
CCCAACTCTCCCCTCCTGCAGACATGCTGAAGGATGTCATCCGAGAATACGACGAACATT
TCCCAGAGATCATTGAAAGAGCAACATACACTCTGGAAAAGGTGGGTACAGGGGTGCGGG
GCTGCTCTGTGGAATAAGAGCAGTGGGGAAGCCTTGAACTCTGCAGCCCTTTTAGGCCCA
ACTTCAGTACTGCCTGCTCCAGAAGCCTTCCCTAACCTCTCCACCTTTGAGCTTCCATTA
CACTGGCAGTTTGGGGCATATGTCCTTCCCTCAGTTCCCCTCTCTCATCCTCTCTGAGTG
TCTCATTGTCTTGAGAAGTTAGTCTCATCTCCTTGGGCAGTATCAGAGCTGCCATGGAGC
CAGGTCCTCCATGTCCTCTCTTCTTCCACCCTCTCTCACAAGTTGGGGTTCTGTGCTCAG
GAAAAGTTCTAACATGGAATCAAGTGGCTGCCTGCAGGAAGCCCAGGCTGGATTTTTCAT
CTCACGCTTTGTTTTCTCCCCCATGTAGAAATTTGGGATCCACCTCAAGGAAATTGACAA
GGAAGAACACCTGTATATTCTTGTCTGCACACAGGACTCTTCAGCTCGCCTTCTTGGGAA
GTAAGAAAGGGAAGGGCTGTGGCCTTCCTTGGTGGCGCCCCTTTCCTGCCCAGCCCCCCA
CATGCTCTCAGAGGAACAGGAAAACAGGGCTTACGTTCCTAGCACAGCTCCTACACACAG
GTAGTGGTGCCCAGTGATGACTGAGTGAAACGTATAGTAGCTGTGGTCAGGGTTTTGCTC
CCTACCTCCTGAAGCTTCCCAGGAAATCCGGCCTGTCGTTGCTTGCCTCTCCCTGCTGAG
CAGTAGGGTTTGGCTGGGTGGTCCTCACTGGAGAGCTTCCTGTTGAGGGTAGATTCTGAG
GCCCGGTGGGCAGGAAAAGTTCGGCTTTGCCTCTGAATACACCTTTGCCAGCATTTGCTC
TGTGACTGCCCCTGCCCTCTGTAGAACCCTGGAAGCAAAGTATTAGTATACACATTGTAT
GGATGAAGTGATTAAGTGTCAGGCGGAGGAATGATTTGTCTGCCAGGATCAAGTGCTGGG
AAGAATTTCCCTCTAGCTGAGAAATCTGGGAGAGGCTAGTTGGGTGAGCCGGCTGTAGTC
TCTTGTGCAAATGGCTGCTGGAGAGGATTCCTCTTTCTACACCTTTAGGACCAAGGACAC
TCCCAGGTTGAGTCTCGTCTTGGTGATTCTGGGCGTCATCTTCATGAATGGCAACCGTGC
TAGCGAGGGTGAGTGGCTGGACCTGTGGCTGGGGGACCGCCCACAGTGTCATTTTCGTGT
GCTGAATTCCTGTGCTATGTCTTCCCTTGCAGCTGTCCTCTGGGAGGCACTACGCAAGAT
GGGACTGCACCCCGGGTATGATTGGCCTCTCTCAGCTCCTACCTCTCAGTGTTGTCCCTT
GGCAAAAGAGATCCCAGGATTTCAATAGCGTGGTGGTCTGGTGCAGGGGAGTGGGGTGTC
CTGGTCCAGTAGAGAGCAAAGGATCTCACCAAGGTGGATGACGAAACAGTCCTGAACTCT
CAGCCTCCTCTCTGCTCTCGGTCCCCTGTCTGTCCCCAGACAACGTCTAAGGTAGACGGT
CAGAATTAGGGGCGCCTTTGATCCTTTTTTTTTTTTTGATCCCCTACTTAGGGCGTCTCT
GACAAGTGGCTGTCTGGCCTCTGCTGCATGCCCAGGCCTCCACGGGGAAGCCCCCTGGGC
AGGGAAGCTCTCAATCTTGTTAGGGAGTGCTCCTGCCCAAATTTGGACACTGCTACTATT
TCTTTTTTTATTTCTTTTACTACCTCTAACCGTAGGTTCTTTTTCTTGCCGTCAGGGTGA
GGCACCCATTCCTTGGCGATCTGAGGAAGCTCCTTACAGATGACTTTGTGAAGCAGAAGT
AAGTGTTAACTTCGTGTCACACTCATGTGCTCCTTTGTGTGTTGGTCTGGCTCAGAAAGC
CCTTCCCCACCCCATATCTAGCACTAGAGGAACGGGTGCCTTGATATATTGAAAGTGGAT
GAGAGTATGTGAGTTGTGGATAGAAGAATTCCAGGGCAATGTCGGGGAAAGGGAACACAC
ATTGAGAACACGGCGCAGGCTGTGTTACAACCGCCTTCTCATTTAGCGCCTGCCCTACTG
GCTGTTATGAGAATTCCCCCATTTCACATCTAAGGAACCTGGGGAGAAGACTCTGGGCAT
GGCCCAGAGCTGGTAATGGGACCATTCAGGCCTGGAGCACAGTTCTCCTGACTTTCTGGC
CAGGGCCCACCCCATCCTTGGTTCTTGGGAAACGTGTGTACCCCCAAACAGGCACACATA
CCACACAGACACACACAGACACACAGACACACACACACTCCCATACGAGGACCTGCTCGT
GCGCACTCTGTCAGGAGCATAATACAGAGTGTGCATGGAGTACGCCACTCTCGGTTGTCT
GTGTCTTCCCTTTACAGTTGTCTTCTATGGCGGAACTTTGTAGGGCTTGGCCAGGTCTCA
GACGAGACCCTTGCAGTGAGGTGTGCTCAGAGCAGGGAGCCTGAAGAATGGCCCCTCTGT
GTACAAAACACCCAACAGGAATTCGGGTTCATTGTGACAAGGGGCCCACAACTTGCGGCC
TTCCGATGAACAAATGCCCTACACGTACCTCCCCTGCACCTCCAGTTGCTTCTGGGTAGG
ACCAAAGACATAAGGCTTTGAGGGCTTCAACACCAAAACCAAACCCGTTGCCGTCGAGTC
GATTCCAACTCATAGCAACCGTATAGGACAGAGTAGAACTGCCCCACGGGGTTTACAAGG
AGTGGCTGGTGGATTTGAACAGCCGCCCTTCCGGTTAGCAGCCGAGCTTTTAAGCACTGT
GCCACCAGGGTTCTGAAGGCCTCAATATCAGAGGCAAAAACCCTGGGAGTGAGTTTGGGT
GTGGAGAAATCCCCTTCCAGGAGCTGAGCTGTAGCGTTAGGCTTGAGGAGGTGCCACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCCATGCACAGGCATAGGCACATTCCATACCTTGCTTGTTTGTTGATTG
GTCAACAGCCTCCTTGTCACCTTCTGTTGCCAGTGAGGATACAGAGGCTCAGAAAGGTTT
CTAAGTAACTTATACAAGGTCACAGAAGTAGTCAGTGTGAGGGACGGGGTGAAATCCCGG
GCCTGGCACCTATTATAGAAGCCTGATGCCAGTAACCTTTATTTTTTATCTTCCAAAGCA
AAGTGCTTAATAGGCTGCATAGCAGGAAGCGGGTGCTCAATGAATGTGTGGTAGCTCTGT
GGTTATGGTTGCTCTTATTGCATCTCAGAATCAGAACCGAGACCCCAGGGAATGGAAGGC
TCATTTCTTGGAGGCTGTGGATGATGCTTTCAAAACTATGGATGTGGATATGGCTGAGGA
ACATGCCAGGGCACAGATGAGGGCCCAGATGAATATCGGGGATGAAGCTCTGATTGGACG
GTGGAGCTGGGATGACATACAGGTGGAGCTCCTGACCTGGGATGAGGATGGAGATTTTGG
CGATGCCTGGGCCAGGATACCGTTTGCTTTCTGGGCCAGGTACCATCAGTACCTTCTGAA
TAGTAACCGTGCCAACAGGAGAGCCACATGGAGAGCTGGTGTCAGCAGTGGCACCAATGG
TGGGGCCAGCACCAGCATCCTAGATGGCCCTAGCACTAGCTCTACCATCCGGACCAGAAA
TGCCGCCAGAGCCGGTGCCAACTTCTTCTCCTGGATTCAGTAAGATTTTCACTTGATAAA
TTAGACTCTACGGAGCCTTGGTGGTGCAGTAGTTAAGCACTTGGCTGCTAACCAAAAGAT
CGGTGGTTCAAACCCACCAGCCGCTCTGTGGGAGAAAGATGTGGCAGTCTGCTCCCGTGA
AGTTTACAGCCTTGGAAACGCAATGGGGTCAGTGCTACTCGGTCCTACGGGGTCGCTATG
AGTCAGAATCGACTCAATGGCAGTGGGCTTGGTTTGTTTTTTGGTTTCAAGTAGACTCTG
AGGAGGGTGTGCAGAGGAGCTGTGAGATGTCAGAGGGAAGCCTGGGGTAGGAGAATGATG
AAGAATAGAAAAACACTGTTTTTGTTGTATATATCCTTCACTGTTTAATGTATTTCAAAT
TATGTTTTCACTTTTGTTTCTTGTGTTTACAGACACCGCTGATGAACTGTAGCAATCTTA
CTCTCCAAACCAGAGTGCCTCCTCAGATTCCTTCTTAACCCAGCACTCGTGGCAGCTTCT
ACCTGTCGATTGAAGATGGCATGCAAGATGAAGCTTTCTTCGCTTTTTCTGCCTTTGTTG
CTTGCTTTTTCTTGTGCTTTCATGTTTTTGGTATCAGTGTTACATTAAAATTACAAAATT
AATTTGGACGTTTCCGCCTTTTCGTGTGCACATGTTGCTAGAACTGCCATGTGGTTGGGC
TCTTAGGGAGGAACCTTCTTTGGGCTGTCTGGTGTAGGTGGGCCCCGCCTCTGCCTAAAA
GGTGGGTAGGCATGGGTAGGATTCTGGGAGGTGTTGAGGTTCCAGCTGAGTGTGGATACC
ATGAGTTTACAGAGGCCCCAGTCCACATAGTTGTGTGATGTATTACAAGCATTGCTCAGC
AGCCCCAGGTAGACTCCAGCAGGGGAGCAGGGGAAGGGATGGAGTGGAGGACTGTGGGCT
GGTGCCAACTGTCCCTCCCAGCAAGGAAAGAGAGTCCATAGGCACTCACCAGGACCCACC
TCTTGCTCCCTTGTCTTTAGAGGTGCTGTCCTGGAACTGTTCCCTCATCATCCACAGGGT
TTCAAGACCTCATCACTGTGACCTGGCTTAAGGACAATAGGCAGGACTCACAATGACATT
TTCACCCCTCCAGCAAGGAGGAGGAGGAGGAGCCATTATTGCTAAGAGAAGAATTTAAGA
AAAACAAAGCTCCAGGCAGTGCTAGACAGCCCAATGCTTGTAACTGTGAACCAAGACTTC
TGTGGTCTTCTTCCATGGAAGCAGCATTCTCCCCCTCCCCCACACCAAGGCCAGGCATTG
GTCCTGGTGCCTTCATGGGCTGGGTGATACCTGGAGGAGGTGGGACAGGGCTACAACTCC
TTCAGGTGGAAGAGAGTGAGGGCAGAGATAGTATGGACTCCTGGGAAGGGCTCAGCAGTG
GGCAGGGACAGTGTCCAGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1001, 1003..1072, 1074..1212, 1470..2300, 2609..2812, 2916..2979, 3201..3280, 3688..3779, 4368..4447, 4532..4574, 5035..5097, 6397..6511, 7048..7478, 7892..7901
1001..1001, 1003..1072, 1074..1212, 1470..2300, 2609..2812, 2916..2979, 3201..3280, 3688..3779, 4368..4447, 4532..4574, 5035..5097, 6397..6511, 7048..7478, 7892..7898
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved