Loxodonta_africana Locus ENSLAFG00000009477
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000009477
Loxodonta_africana
ENSLAFG00000009477
GeneScaffold_7417
SNORA38
1472..1602
15554
AAAGTAGGGTCTGGTTAGGGAGCAGAGGCTGGGGCATTAGGGAGAAAAACGACTACATA
GGGATATTCTTAGGAAAATGAAGTTGGTACTGTTGGTCCTGTCTTTGGCCCCATGGTTAC
CTGGTGCTCTGGGGGTGGCTCAATGGTGATTTTTCTCAGATCTACGTAGGTGAAACCAGT
GCCCGCCAGTATTTATTTCATCTGGAGACCACATTTTTCCAAGAGTTGGGATGGATGGCT
AGTTTAGGAAAAAATAGAGTATTCCAAATACTTGGGGTTCTGTGGCCTGGGAGTATGTAA
ACCCCGAGTTGTACCATGGGGATTTTTCTGGCACCAGCTCCCATTCTGGTGGAGCAAGTT
CGTGAAATTCTTAAACTCCCAGCATACCTTTTCTGCAAACCTCCCCAGACAGGACTGGAG
GCTGCTGGGAACGGAGCCTGGAGCACAGGGCCCTGGGTTATGGTTACGGAGTTGGTGTCC
AATAAATAAATGATTTAAAGTTCAGTCCTTTGCATGATGGAGTTGTGTGCCTCTTTCTGG
TTTTCTCTGGGGGCTTAGACTTGCCCTGTTTTATTGTAGGTCTGTAAATGATTTTGGTGG
AGGGGAAAGAGATTATTACTTGGGATAGTGACGAGGCTGCTGCCCTTCGCAGACTGGTAC
AAAGGGGAGAGCGTTTACACTGGGAGGACACCAGATTTTTATTTGGGTTTCCTTGGCAAG
AGGTATCTGGGGGAAAGAGGGAACATGGCACTTGGACTGTGTGGAAGCTGGGTTAACGTG
GTTGCTTAAAGGGACTGGGGAGTGAACAAGCAGGAGAGAGAGAAGACACCAAAGGGCCAC
ATATATGGGTTGCTAATGAGGATAAAAGGGAGCTTCTAGGCTTCTGTTGGAATCTGTGAA
GGGGGCAGAAACTGAAGTACTTGATGTCTGACTCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACCTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTGCAAAGATGCTCCTAA
TAACTGGAGTCTAGGCATAAATGGGGAGCCCTGGTGGCACAGTGGTTAAGAGCTCAGGCT
GCTAACCAAAAGTTTGGCGATTTGAATCCACCAGTCACTCCTTAGAAACCCTATGGGGCA
GTTCTACTCTGCCCTGTAGGGTCACAGTGAGTCAATCGCCTGGACAGCAATGGGTATACA
GATATAGGGATAAGCAGAGCATACATTTTAGAGGCCTTTGAAGGGGAACAGGATTATACT
AGAGATACTGAAAGACCAGGTCAGCACTGGAGACTTCCCAACTTTACTTTGGATCCTGTA
GTGGGTTCTGGGCTCTGGGTGAATGCCAGTTATCCTCCTACAAAGGCGTGTCTGTGGTTC
CCTGTCCTTGTACACGTAAGAATTGGAGGCAAAGAAATGTGGACTTGGAGAAGGCTGGGG
CCAGCTCGCTACTTGCAGGCTCAAGCTCATCCATCCCACATCGAATGTAATGTATCTTTC
AGCCTTCTTAGTAAGCATCTTGGCAGGGGAAGGCATGGGCTTCTAAGTGAAGCCTGGAGT
GAGTTGTTAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCAAACTTCATCATGGCCATGACCCTCGTGAGGAGGCTGCAGCCTTC
GGGCCCACCCCAGTTCCCTCCGTACCGCGGAATGATGCCGCCCTTCGTGAGTTTGGATAT
CTTGTTTTGTCGTGGTTGAATTGGAAATTAGGGAGTTAGGAATCAGGACTTAGTCCTTGG
AGGAGGGGATGGTTGGGAAGTAGGAGCCTGAGGGATAGAATGAGGGTGGGGAGGATGTGA
TAGTAGGCTTAGGGAGCTGGCAGGCTACTTGACTGTTCCTCTGAGCAGCTACTTTTGGGC
CCTTTTGCAGATGTATCCCCCCTATCTCCCATTCCCTCCACCCTATGGACCCCAGGGGCC
TTACCGATATCCTACTCCTGATGGGCCCAGGTGAGCAATCCAAGTCTGGGTTTGGTTTGG
GGTAGGGGAGGCCTTTTGGGGAAGGAGATGGTTTTCTAGGAGACTCAGTCTTGTGTTTTG
GTATACAGCATACCACCTTTATTTTATTTTCTTACCTTTCTTTGTATACATAGCCGTTTC
CCTCGTGTGGCAGGCCCCCGGGGCTCAGGGCCACCAATGCGCCTGGTAGAGCCTGTGGGT
CGGCCTTCCATTCTTAAAGAAGATAATCTCAAAGAATTTGATCAGTTGGACCAGGAAAAT
GATGATGGTTGGGCAGGTAAGTAGGTAATAAAGGCCAAGATTTTGGGTGTTAAAAAGGTA
AAATCTGATGAACGATATGAAGGGGAAAGCATAGCATGAACGGCAGGGGAGATAGCTGGA
GGAAAGCCAAAGCCTGGCAAAGTTCTGAAAAGGAAGTGAGAATTGGGATGGGATGTGGTA
AGACTCAGAGATGTTGGTCTAGACTTCAGAGAGAGAGGAGCCTAAGAGGGGGTGGCATTG
GTAGTGCATCCTGTTATAGTTCGAGTGCTTGCTTTGTTCATCCCAGGAAGATAGCCGAGA
TAGAAAGAAAAATGCTTAGATTACTATTCTTCACTTTTCCACTCAGGGGCCCATGAGGAG
GTTGACTACACTGAGAAGCTCAAGTTCAGCGATGAGGAAGATGGGCGAGACTCCGATGAG
GAGGGAGCTGAGGGCCAGTGAGTTAGGGCCATATGGGGAGAGGAGGGTGCTCAGTTTCTT
TAGTGATGTATGTTTAGAGGAGCTGGGTTCCAGCTGACTTTAATTCCCATGGTGGTCTGC
TCACAGCAAGGACTCTCAATCAGCTGCTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGACTGCATTTGCCCTCAAAAGAGGGTCCTGAACCA
CCAGAAGAGGTTCCTCCTCCAGCTACACCCCCGGCCGCAAAGGTAGAACCCAAGGGCGAT
GGGGCTGGTCCAACCCGGCAGCCCCTCAGCCAGGGTTTAGGCTACCCCAAGTATCAGAAG
TCATTGCCTCCTCGCTTCCAGCGGCAGCAGCAGGTGAGGTCCAGTTACTGCCGTCGTAAG
GGCTGCCTTTCCCTGGCTTCAGCAGCATTCGCCCATTCCATAAGTTTTCTCCTGGGTTCT
AGTTGTATCTCAGCTGTATCAGTTGACATCTAGTCTGGGGTTTTGTTACATTTAAGTGTA
ATTTTTTTTTCTTTGCTTCCTTTTTTGTTTGTGGGGCTATGATGTTTCTCTCATCTCCTT
TTTTCTTTCCCAGGAGCAGCTCCTGAAGCAGCAACAGTGGCAGCAGCACCAACAGGGCTC
TGCCCCAGCTGCCCCAGTGCCCCCATCACCACCGCAGCCTGTGACCATGGGGGCTGTGCC
AGCTCCACAGGCCCCACCACCGCCCCCCAAGGCCCTGTACCCAGGTGCTCTGGGCCGGCC
ACCACCCATGCCCCCGATGAACTTTGATCCCCGCTGGATGATGATTCCTCCCTATGTGGA
TCCCCGGCTCCTCCAGGGCCGGCCCCCTCTGGACTTCTACCCTCCCGGTGTGCATCCCTC
TGGTAAGGGGCCACAGGAGGACGGGTAGAGGAATTCCTTGGCCCTGTGAGGTAGATGGTG
GGGTCTCACTGGGGAGGAGAAACTGACTCACAGGAAGGACTAGACTGGGGAGATCCTTCT
TGGGGAAGAGATCCTGTGAAGGAAAGGGTTATTGAAGTATTTCTTTGTTTTGTTTTCTCA
GGTTTAGTTCCCCGGGAGCGCTCAGACAGCGGGGGCTCAAGCTCGGAGCCATTTGAGCGT
CATGCACCCCCACTGCTCCGCGAACGGGGCACCCCACCAGTGGATCCAAAGTTGACTTGG
GTAGGGGACGTCTTTGCCACCACACCCGCCGACCCCCGCCCGCTATCCTCCCCCCTGCGC
CAGGCTGTAGATGAAGATGACAAGGGGATGAGGTGAGTCTGGGTAGTAAGACATGGTATG
CGCCTGGTGAGAGGACTGGGCCCAGGAGAAAGACTACTTTTGATGATTTGTTAGACGTTA
GACACAAACTAGAAAGGAGCGCCTATGTTATTAAGCTTTTCCTCTCTCCACCTAGTTAGC
CCACTTTCACTTTTTGAGAAACTTATTTCTGTATTTTTCTGTCTTTTTTTCAGAAGTGAG
ACCCCTCCAGTACCTCCCCCACCACCCTATCTGGCCAGCTACCCAGGCTTCCCTGAGAAT
GGAGCCCCTGGGCCAACAATCCCTCGCTTCCCACTGGAGGAACCAGCTCCGCCAGGGCCT
CGTCCACTCCCCTGGCCCCCAGGCAATGATGAGGCAACAAAGATACAAGCTCCACCACCC
AAGAAGGAACCCCCCAGGGAGGAGACTCCACAGTTGACAGGGCCAGAAGCAGGAAGAAAG
CCCGCCCGTGGAGTTGGAGGCGGCGGCCAGGGCCCTCCACCACCACGCAGAGAGAGCCGC
ACAGAAACCCGGTGGGGCCCACGTCCAGGCAGCAGTCGCCGGGGAATCCCTCTGGAGGAG
CCAGGGGGCCCTCCCCGCCGAGCGGGGCCTATAAAGAAACCCCTACCACCTACAAAAGTT
GAAGAGCTGCTTCCCAAGCCCCTTGAACAGGGGGATGAAACTCCCAAAGTCCCAAAGCCA
GACCCACTCAAGACAGCCAAAGGGAAGGTGGGGGGCCCCAAGGAGTCCCCACCCAGTGGA
AATCTTTCCCCAGCTCCAAGGCTTCGGAGGGACTACTCCTACGAAAGAGTGGGGCCGACC
TCTTGCCGGGGTCGGGGCCGGGGCGAGTACTTTGCCCGAGGGAGGGGTTTTCGGGAACCT
ATGGGGGATGGGGCGGGGAGCCCGAAGCCGGGAGTTCCGCAGTTACCGAGAGTTTCGTGG
AGATGATGGGCGAGGAGGTGGGACAGGAGGGCCAAACCACCCACCTGCTCCTCGAGGCCG
CACTGCCAGTGAGACACGAAGCGAGGGTTCAGAGTATGAAGAAATCCCCAAGCGGCGCCG
GCAGCGGGGCTCAGAAACAGGCAGTGAGACCCATGAGAGTGACCTGGCCCCCTCAGACAA
GGAGGCCCCCCCACCCAAGGAGGGTGTACTCACTCAGGCTCCTCTTGCTCCTCCACCACC
AGGAGCCCCCCCTTCACCAGCCCCAGCCCGTTTCTCTACTGCCCGGGGTGGGCGAGTCTT
CACTCCCAGAGGAGTGCCTTCACGCCGCGGCCGAGGGGGAGGGCGGCCCCCTCCTCCTGT
TTGCCCAGGCTGGAGCCCTCCAGCAAAGTCCCTGGCCCCCAAGAAGCCTCCAACAGGCCC
CTTGCAACCAAGTAAGGAACCTTTGAAAGAGAAGCTGATCCCAGGGCCTCTGTCCCCCAT
GGCCCGGGGAGGCAGCAGTGGATGCAGCAACGTAGGCATGGGTATGGAAGACGGTGAGCG
GCCCCGAAGGAGACGGCATGGAAGGGCACAGCAGCAGGACAAACCGCCTCGGTTCCGGAG
GCTGAAACAGGAACGGGAGAATGCTGCTAGAGGGGCTGAGGGCAAGCCCTCTTCCCTGGC
CCTGCCAGCCTCTGCCCCAGGGCCTGAGGAGGCTCTTGCAACAGTAGCAGTGCCCCCAGT
GCCGCGCCGGGCAGCTGCCAAGTCTCCTGATCTGTCAAACCAGAACTCAGATCAAGCTAA
CGAGGAATGGAGACTGCATCGGAGAGTAGCGACTTTGCTAGCGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTGTGCCTCGTGGAGATCTGAGCCAGAGAGCCAAGGATTTGAGCAAG
CGGAGCTTTTCAAGTCAGCGGCCAGGCATGGAACGACAGAACCGGCGCCCAGGCCCGGGG
GGCAAGACTGGCAGCGGTGGCAGTGGCAGTGGAGGAGGTGGCGGGGGCCCCGGGGGCAGG
ACTGGCCCAGGACGAGGTGACAAGAGGAGCTGGCCCTCTCCCAAGAACCGAAGGTGGGTG
GGAGGCAGACTGTTTCAGTGACTCTTAGGGTTAGAAAATCGTGGAAGGGGAGAATCCTGG
GGGAAATGTAGTTGGGCACTAGGATTTGAGATGGAATGACAGGTGAACTCGTGACAAGCT
CAGATTTTCATGTTTAGGTAAAGTAAATGAAGTGATAACATCAGGAACTTTCATACACTT
TGTTTTTGGCCTTCCAGTCTGTAGACCTGTACACGTAGAAGTTTAAAGAAGGGCTCAAAA
ACACTTTGGTTTTAACTGAGTGGGTCAGGTTGAAAGGGAAGGAAGTAGGAAGACTGAGAT
GTTCGATTTACAGAGGAAGCATAGCGATTAGTGAATACTGGAGCTGGGGTTCTTTTCTCT
CCAGCCGGCCTCCGGAGGAGCGGCCTCCAGGGCTCCCTCTGCCTCCGCCACCCCCCAGCA
GTTCTGCTGTCTTCCGCCTGGACCAAGTCATCCACAGCAACCCTGCTGGCATCCAACAGG
CTCTAGCCCAGCTCAGCAACCGTCAAGGCAGTGCAGCTGCACCAGGGGGCCACTCAAGGC
CCAAGCCTGGGCCTCCCCAAACCCCTCAGGGTCCCTCCCCTCGGCCCCCAACCCAGTATG
ACCCCCAGAGGGTCAGGAACAACGGGGTCAGTCCTGGTAAGCAGGAAGAGGGAAAGGTGG
GAATATTTCTGCCCTCAGAGAAAGCTAGGTGCTGAGCCAGGGGAGGGCTGGGAGGTGGCA
CAGGGTGAGAAAACGAGGGTAAAGGATAGAGCAAGGGAACCACTGACAGTTTTCCTTTTT
CCCCAGACCCCCACTTCGAGGAGCCAGGCCCAGTGGTGAGGGGGGTGGGTGGGACTCCCC
GGGATTCTGCCGGGGTTAATCCCTTCCCCCCCAAAAGGCGCGAACGGCCTCCCAGAAAAC
CGGAGCTGCTGCAGGAGGTGAGGGGTGGGGCTCGAGGTGCTTCACTGCTCTCCTGAAGGT
TCTCCCTGGTTACCATTTTATCTTTCTTTTATTCTTTTCGTTGTGCTTATATCCAAGGCC
TTGCTATCAGTCACTGTTTGTTCTTCCTGTATCTCTTTTTTCGTCATTGCTCTCACACCT
CGCTGTATATCCCACTTGCCAGCATTCGCTAATTTCCACCTAAGTCATGTTTTGGCTCTG
GCCTTTTTTAATCTTTAGGAATCCTTGCCATCTTCTCATAGCTCTGGATTCTTGGGCCCT
AAGCCTGAGGGCCCAGGGCCTCGGGGAGAGTCCAGAGATTCAGGCACTGAGGTCCTGACC
CCTCACATTTGGAATCGTTTACATACTGGTGAGTAAACTGAGCAAGAAGAAGTTGGAGGG
ATTAGAGCAAGAGATGGGCTTCAGAACTGTTTTACACTTCCTCTTTTCTGGTTGGTGCTC
CCCTCTCTAGCCACTAGCCGGAAGAGTTACCAGCCTGGTTCCATGGAGCCCTGGATGGAG
CCCCTGAGCCCCTTTGAGGATGTGGCTGGCACTGAGGTGAGTGAGGCTGGGAGGGAGCAT
CTGGCTCTCTGGAGGTGAGATTTTGTGGCGCACTGGCCATACTTCCCCACGTTTTGGTTG
AGCCTAGGCTCATATAGCTGTTTTCTTTAGTTTGTCTGTCTGTGGTATGGGGATCAGGAA
TGTATTGGGGTGCTTTCTACTCTGACTTAATATCTCCTCTTTTTCTTTCAGATGAGTCAG
TCTGACAGCGGGGTAGACCTGAGTGGGGACTCTCAGGTGTCATCAGGTCCCTGCAGCCAG
CGAAGTTCCCCTGATGGAGGACTCAAGGGGGCAGCAGAGGGGCCCCCCAAACGGCCTGGA
GGCCCCTCACCTCTGAATGCTGTTTCTAGTGAGGGTCCACCTGGCTCTGAACCCTCTGAA
CCGCCTAGGAGACGGCCACCTGCCCCCCACGATGCGGACAGAAAGGTAAAAGACCAAGAA
AAAATAAGGGGAGTGTTTCCAGGAATCAGACTTTGGCCCTTCTTTTTCCCTTTCCGTCTG
CTTGTGCATTCTGGGAAGCCCCTCATTTTGGCTTCCCTAGGAACCCTGGTGGTGTAGTGG
TTCACAGCTGAGCTGCTAACCAAGTGGTTAGCAGCTCGAATCCACCAGCTGTTCCTTGGA
AACTCTATGGGGCAGTTCTGCTCTGTCCTGTAGGGTCACTATGAGTCGGAATCAAATTGA
CGGCAATGGATTTTTTCTCCCCATCCGCATTTACTGTGTTCTCCGACCCAGGAGCTACCC
CAGGAGCAGCCCCTGCCCCCTGGCCCCATTGGCACAGAACGATCACAGCGTACAGACCGA
GGCCCAGAGCCTGGCTCCCTCCGGCAGTCCCACCGACCTGGCCCCCAAGTCCAGTTTGGC
GCTAGTGACAAGGTTTGCATAGACTGGATCTGTGGGCATCCTGGGTTGGGTGGAGAAAAG
GGAGGGGCTGGAGATGGGACACAGGAGACATGTCTGAATCTTGGAATAAGCTCCCCTGTT
TCATGACCACAGGATTCAGATTTGTGCCTAGTGGTAGGAGACAGCTTAAAAGCAGAGAAG
GAGCTAACGGCATCAGTCACTGAGGTGAGTGGGAGAGAGAGAGTTGGTGGAAAGGCTTTC
GATTTCTGAAGATTTCTGACTTGGGCATGGAGGATGTCCTGACGGCCTCTTGACAAGGCT
TTTCCTCCCAGGCCGTCCCCATATCCCGAGACTGGGAGCTGCTCCCCAGCGCTTCTGCCT
CTGCTGAACCACAATCCAAAAACGTGAGCTCTGGGCACTGTGGCCCTGAGCCCAGCTCTT
CAGGCCAGCGCCTGTACCCTGAGGTCTTTTATGGCAGCCCTGGGCCTCCCGGTTCTCAGG
TAGGCCCTGTTTTCCATTTGCCTGCTGTCTCTCATAGCTGAGCGTTTTCAAATTGTACAG
CTTTAAAACACCATTTTATTTTATTATTTTTTTTTTATGTTATTCCATTTTTCTCCTTGT
ATTTTACTTCAGTGGGTGGGGTAGGTAAGCTTTTCTTGACCAGAAAACCTGGAGCTCTTC
AGCCCTGCTCTTCTCTTGCAGGTCTCTGGGGGAGCCATAGATTCTCAGTTACATCCCAAC
AATGGGGGCTTCCGCCCTGGAACCCCCCCACTGCACCCTTACAGGTAAGAACCATATGCC
TGTGGATGTCAGAAGGAAGTGGGACTATGTTTCAGGGGAGAGAAAAGAGGACTATTTTGG
GGTATCAGAGGTTAGTGGGCCTAAAGCATTACTCAGACTAAAGGAGGAAATGGCTTCCTG
GGTCTTTGTGCCCTGACTGGTATCCCCCTCTTGCTTTCTTTTCAGGTCACAGCCCCTGTA
CCTGCCCCCTGGCCCAGCCCCTCCCTCGGCACTGCTCTCTGGGGTAGCTCTCAAGGGCCA
GTTTCTGGATTTCTCAGCACTGCAAGCAACAGAACTGGGGAAGTTGCCAGCTGGAGGAGT
TCTCTACCCTCCACCTTCCTTTCTCTACTCTCCAGCTTTCTGCCCTAGCCCTTTGCAAGA
CCCCCCCTTGCTTCAGGTAAGAGGTGGGCAGGTGTTAGGATTAGGCAGTGAGAGGCTGGG
TAAGAATGCTTCTGGAGGAGTTCACATGTCTCTCCCATTTCCCAACAGGTACGCCAGGAT
CTGCCATCACCCTCGGATTTTTATTCTACTCTGCAGCCTGGTGGCCAAAATGGCTTCCTC
CCCTCAGGGGCCCCTGCTCAGCAGGTACCTTTTGTTTTCCACCTCCCCTTGCCTGCCATT
TTCTCATTTCAACCTCTGGCTTTGTTTCTGTTGGTTTGACTATGTGCTTCTGAGTTTCTC
ATATTCTCTCTCTTGTATCCCAACACATGTACTCAAATTTGTTATTAACAGATGCTTCTG
CCCATGGTGGACTCACAGCTGCCCATGATGAACTTCAGCTCTCTGCCACCAGCGCCGCCT
CCTGCCCCACCCCCACTCTCTCTGTTACCGGTGGGCCCTGCTCTGCAGCCCCCCAGCCTG
GCTGTGCGGCCCCCACCTGCTCCTGCTACTCGGGTGCTGCCTTCACCTGCCAGGCCCTTC
CCGCCTAGCTTGGGGCGAGCAGAGGTAGGTACAGGAACTGAGGCATAGGAAACTCTTTAA
GGATAAGGTGTAGGGACCCATGGGTTGAAAGGCTGGAGGCTCATAAGGTTTTTTTCTTTA
AGCTGCACCCAGTGGAACTGAAGCCGTTCCAAGATTATCGAAAACTGAGCAGCAACCTCG
GGGGACCTGGGTCATCACGTACTCCCCCAGCTGGAAGGTAAGAGAAGGGAACGGGGATGC
TGACTCCATCCCCCAAGGACTTTCTTACCCTTGGAACCAAACCCTAGACTTGTCTTAAAC
ATTCTTCCTCCGTTAGGTCTTTCTCTGGCCTCAATTCCCGTCTCAAGGCCTCGCCTTCAA
CCTACAGCGGAGTCTTCCGCACACAGCGCATCGACCTCTACCAGCAGGTGAATCTGAATT
CAAGAATTATTGCCTGGTTTCCTGTCCCTGTCCTCCAAGTATGACTTACTCTTCCTCATG
TTCCTGTCCTCCAGTCCTCTCCCCCGGATGCCCTGCGCTGGATGCCTAAACCTTGGGAAC
GGACAGGACCGCCTTCTCGAGAAGGGCCCTCTCGACGGGCAGAGGAGCCTGGGTCCCGAG
GGGACAAGGAGCCTGGGTTGCCCCCACCCCGCTGATGGGAAGTTCCCCTTGCCCACCCCA
CCCCACCCCCCCCCACCCCCCCGCCCCAGGGCTTGTATATAGATTATAAATATATAAGGG
GGAAAGGGGTGGGTGAGGAGGGGTCGTGGGGCTGGGGCCTCGCTTCACCTCTTCCCCCTT
ACCTGGTCCCCTATCCCTGGGGCTGTTTGTTAAAAAAGAATAATAAAAGGATGAAAAAAA
TATTTTCAAAATGATTTTGGGGATGGGTTACTTGTTTGCATTGTTACAGCATGTTGCTAA
GTGCAATTTATAGACTGGTTTCAGTCAGAACTGTTTTGTCACTGATACAAACTGTTTCAA
AATTTAAACCACCGTCATTTTATTGCACCTTAAAATCTTATGGGTTGGGAATTTGAGCAG
CACTCTGCTTCATCTGCGAACACATGAAGCCTGGTGGTGACCGGTCTGCAGTTAACAGCT
GGGCTGGTCCCATAGGGCTTCACTTGCATGTTTGGAGGGCTTTGCTGGCAGGGATGCCTG
GGAGGTGGAGCTCTGCTGAACCATCAGCCAATGGCCCCAGCCTCATGGCCTCTCCAGCAG
GGTGTTCCTAGCGTTGATACTCCTCTTAACTGCCTCTGGGCCTGTGTTCCAAGAGGCCCT
AGTGCAAAGTGCAGAGCTTATGACCTGGCCTCAGGATGTCTCTTGTCACATTCTGTTGGT
CTAGCATTGCTAAAAGGAGAGGGAACCTCAACTCCACCTCTCAAAGGAAGTAGCAAGAAT
TTGCAACCATATACCACTTTGTCCACAGTGACAAACTGAATGTTAAGGAGACTTTTGGTG
GTCATTGCCTCAACATCCAAGCACGTGACCATTGGACTCCTTGAACTGGATATAGACCAT
TCAGCGTCGTTAGACTTGGTTCAGTTACATATGGTATGACTGTGTGCTAGTCATGCTAAG
ATTTAGTCTGCAGCTGCTCAAAGATTGAAAGGTTTACTGCCGTATAGTTTTGAGAGCCCT
GTCTAGCATACAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 2586..2763, 2864..2963, 3064..3136, 3237..3380, 4273..4360, 4362..4425, 4630..4709, 4853..4995, 5326..5416, 5526..5548, 5651..5844, 5945..6419, 6520..6523, 6626..6812, 7033..7321, 7501..7711, 7913..8570, 8573..8587, 8590..9426, 9429..9578, 9708..9892, 10264..10535, 10686..10816, 11058..11187, 11290..11375, 11571..11804, 12111..12251, 12372..12443, 12551..12718, 12921..13003, 13185..13395, 13488..13583, 13731..13943, 14042..14136, 14236..14326, 14414..14554
1001..1112, 2586..2763, 2864..2963, 3064..3136, 3237..3380, 4273..4360, 4362..4425, 4630..4709, 4853..4995, 5326..5416, 5526..5548, 5651..5844, 5945..6419, 6520..6523, 6626..6812, 7033..7321, 7501..7711, 7913..8570, 8573..8587, 8590..9426, 9429..9578, 9708..9892, 10264..10535, 10686..10816, 11058..11187, 11290..11375, 11571..11804, 12111..12251, 12372..12443, 12551..12718, 12921..13003, 13185..13395, 13488..13583, 13731..13943, 14042..14136, 14236..14326, 14414..14551
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved