Loxodonta_africana Locus GNL3
snOPY snoRNA Orthological Gene Database
Loxodonta_africana GNL3
Loxodonta_africana
GNL3
GeneScaffold_5151
SNORD19, SNORD69
2616..2689, 5928..6004
11024
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGTAGAAAGATGCATTT
ATTGGGTAATCAAGTCCTGTAACCTCCACCTTTCAATAATCTTTGTAAAGAGGTGGAGAA
ATAGAGCCTGGTGGTGGCTTTTTGTCAGTGCCCCCCCCCCCACTCCTCTTGCTGCCCCTT
TATACTTTGATATGCATGTTCTAACGATCCCTGGTGGTGCAGTGGTCAAACGCAAAAGAT
CCACAGCTCAAAGGCACCAGCACCTTTTCGGCAGAGAGATGTGGCCGTCTGCTTCTGTCA
ACAGCCTCGGAAGCCCTGTGGGCAGTTGCGTTCTGTCCTGTAGAGTCGCTTTCGACTTGA
CAAAATGGGTTTATATATGCATTTTGTATGATTCTAATTAAAGCTCCCTTTTTCTATGTC
ATTTTATAGGGGTCACTAAACTGTAGCTAGATGGGTTTCTCACATGAATTTTGTTTGAGT
GGGAAAGTATTTTTGTAAACTCCATATATTCATTATAATAGGTACGGGAGCACCATCGAA
AATTGAGGAAGGAAGCCAAAAAACGGGGTCGCAAGAAGCCTAGGAAAGATCCAGGAGTTC
CAAACAGTGCTCCCTTTAAGGAGGCTCTTCTTCGGGAAGCTGAGCTAAGAAAACAGCGGG
TAAGGTGTTTATTGAAGCTTTGAAGAAATAGTGTGGGTATATGTACTTTTTTCAAAGTAA
GGTAACAACACCAAGTCACTTTGCCTCACCCATTTCTCTTATGAATTGGACACAGCTTGA
AGAACTAAAACAGCAGCAGAAACTTGACAGACAGAAGGAACAGGAAAAGAAAAGAAAACT
TGAAACTCAGCCTGCTGTTGAGCCATCTAGTGGGGAACCTGTGAAGGAGGTATGACCAGG
TTTTGTGAGCGAGAGGTAGCGTTCTGATGGAGAAGCAAAAGCACGTACATGGGGTGGGGG
TGCTATGCCTCATGGCGGGGAGGGGGGGTGAGTTCAGATTCTGGCATACCTACCTATACT
ATCAAATGCAGGGCCTATTATCAGCCATGGGAAATGCAAACATAGGTTACAACTGCTGTA
CTTCTAATTTGATGTCTTTTCCCCCTTGTCTTTATTTTTTAGGAACTTGGGCAAGGCAAA
GCAAAGAACAAAGCCAAGTTGGGCAAACAGAGTCCAAAGAAATCATATTGTCAGGAACTT
AAAAAGGTATTTTAGTTTAGGTCTGTGTCTAAAAACAGTAATGAGTTTAAGAGACTAGTC
GCTCCTCTTTCCTAACCCTGGCATCAACCTTGTAAAAGTGGAAGTAGAGCTCCCTTGAGC
TGAAGAATCCTTCAGGCTGGCTTATCCCATTTAGGGCCTTTCCTGTTAGGTTTAGTTAAA
GGAAATATTCTTCCTTGGTTATAAATTTTTGCACAGGTGCATGGGGAGCAGTTCACCATA
AATATAGTTTATAAAAATAGTGTTTCGCGTTAATGTGTTGACACAGCAGTTTAAAGATTG
AAGAAAGTACACAAAAATAGTGTGAAAATAAGACTCTTGAAAGTGCTTTGCTGAAACCCA
AGTAAAGGAAGTCAACTGAAGTCAGAAGTGTCTTTTAGGTGTAGTAGCTCCTCAGCACTC
CCATCCCTAACCACAGCCCCCCGCCCCCCCATAGGTGGACAGACCCTGGTGACTATGCTC
CTCAACACTTCTAGGGCTTATCAGACGACATCATTCACTATGGGAAGATTGTACATTCAG
TTAGGAGTATTTTCCACTTTTGAAATTCATTTCGATGAGGACCCTGAGCAAGCCTATGTA
TTTTCTTGTGTGAGAAATGATGACATATAAACATTCTTCATACCCAAGTGAAGACATGAG
ATCCAACTCTGAGCTCACCATGCTGCAAAGTGGATAATGCCAACACGTTTCTGTTAAGGG
TGTTCCTGGAGCAGGAGAAGTGATGTGTTTCTGCCTTGACAGGTGATTGAGGCCTCAGAT
GTTGTGCTAGAGGTGTTGGATGCCAGAGACCCGCTTGGTTGCAGGTGTCCCCAGGTAGAA
GAGGCCATTGTCCAAGGTGGACAGAAAAGACTAGTACTTGTGTTAAATAAATCAGGTGAG
TGAAACGAATGCCCTTTGTCTTGCGTGTGCACTGGCGAGGTATGAGGAAAATATGTGAAC
AGTCTGATTGTCAGTGAAGACTGATAAGATCCAACTCTGACCTCAGAGCCAGTGCACGTG
GTAACTGGTTGCCAAAGCAGTTTACAACAACTGATTGGGCTGGTTTCTACTGTTCTTTTG
TGATTCAGTGGTTACCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCTCGACATTAGCTACTTTCCCGCTTCATCAAGAATGCACAT
ATCAGTTAAAACTAAAGTAATTGCTGCCTGATCAGTTCTTTGTTGTGACTGGGCATTGCA
GGAAGTTGGCTTCTCAAACCTCTTGGCTTATTCGAATTAGTGTCTAGTCCTGCCCTTTTG
TTACTTGAGCAAGAAATGAAGAAGTTAAGATTGGTCTTAGTGTGGAAGTGAAGAAACTCA
GATCCAACTCTGATCTTGCTCTAAACATGAAATATAAAATAAGGTGGTAGAAGTTGTATA
ATTATCAGCCCATAATACTTTTTGTGTCTCAATTCCCCATTTTTAGGTTTCCCAAACGTG
GGTAAAAGCAGCATCGTTAATAGCTTAAAACAGGAACGGACATGCAATGTTGGTTTATCC
ATGGGGCTTACAAGGTGGGTTGAGTTGTTTCATAATTGCAGTATTTTATTATAGGTCAGT
ATGTTGTTGTTAGGTGCTGTCGAGTTGGTTCCAACTCATAGTGGCCCTACATACAACAGA
ACGAAACACTGCCTGGTCTTGCGCCATCCTCACAGTTGTTAGGCTGGAGCCCATTGTTGT
AGTCACTGTGTCAGTTCATCTCATTGAGGGTCTTCCTCTTTTTTACTGACCCTTCACTCT
ACCAAGCATGATGTTCTCCAGGGACTGATCCCTCCTGATAACACGTCCAAAGTATGTGAG
GCAAAGTCTGACTATCCTCACTGCTACTGAGCGTTCTGGCTATACTTCTTCCAAGACAGA
TTTGTTTATTCTTCTGGCACTCCACGGTATATTCAATATTCTTCACCAACACCGTAACTC
AAAGGCACCAATTCTCCTTCTGTCTTCCTTATTCACTGTCCATCTTCTACATGCATATGA
GGTGATTGAAAAAACCATGGCTTGGGTCAGGTGTACCTTAGTCCTTAAAGTAACATCTTT
GCTTTTTAACACTTTAAAGAAATCTTTCGCAGCACATTTGCCCAGTGCAGTGCACTGTTT
CATTTCTTGACTGCTGCTTCTATGGGTGTTGATAGTGGATCCAAGTAAAATGAAATCTTT
TATAACTTCAATCTTTTCTCCATTTATCATGTTGCTTATTGATCCAGTTGTTAGGATTTT
TGTTTGCTTTATGTTGAGGTGCAAGCCATACTGAAGGCTGTGGTCTGAATATATACGACT
TTATTTTAGCTAGCTTGAAGACAAATTTATTTTTAAATTATCTTTTTAAATCTGCCAGCG
AAAGAAAGGGTTAGGCCCAAGCTAGGCTTGGGGAAGAACTAGTTGGAGTGGGACAGCTGC
CCACAATCTAGTTGGAAAGACAGATAAGCAAACAGATGCAGAGGGAGGAATGCTGTCTCA
GTGGAAGTGATGTTTGAATCTGGTCTTGTGAAGTGAAAAGAAGTTCGCCAGGTGGGAGAG
GGAAAAATATTTATGGCAGAGGGACAGCACGTGTTAAGATGATATATAAACAGTAAGATG
GATTGTTTCCCTTTAGAAAGGGAGGGTGCACTGTCTGGGGTTCAGACAGACATGAAGCAG
ATGATGAGAAACTGGATCTGACTGACTGTGCTGAGTTTGTTCAATCCAACCCTGAGCTTC
GTGTTCTGCCTTTGCCGTCTAAATTAAACCGGTGCCCCCTTTGAATACCATCTTTCTTCT
TCTAGGAGCATGCAGGTTGTCCCCCTGGACAAACAGATCACAATCATAGACAGTCCCAGC
ATCATCGTGTCTCCACTTAACTCCGCCACTGCACTTGCTATGAGAAGTCCAGCAAGTATT
GAAGTAGTAAAACCAGTGGAGGCTGCCCATGCCATCCTGTCCCAGGCCGACGCTCGACAG
GTAAAGGAACCCTTTTCCTCAGGCACCTCGTCGCCATTTTCTCTTTGATCATAAGCATTT
TTAAAAAGACTTCTTGACCAAAAGGGGGATGGCAGGATGCTTCTTAAATTCCAGAATATA
GTTTTGGGATTTGGTGCCTGACTCTTAAAAGTTTGAGATGTTTGGTCCTTCTTGAATTTC
ACCACAATCAGCATATATTTTTTTGTGCAACCATTACCACAATTTATTTCAGTTTTTTTT
TCACCACTCCAGAAAGAATTCCTCTGCCTCTCAGTCCTTGGCAACCATGGATAAATCCTG
TTTCTATGGATTTATCTTAAGTAGATCATATGAATGGACTCATATACGTAGTCCCTGTGA
CTGACTGCTTTCACTGAACAATGTTTTCAAAGGTTCGTCCAAGTTGTAGTATGTATCGGT
ACACGTCATTGTTTTATGGCCAAATAGTCTATTGTATATATGGTACTGCATCCGCTTATC
CCTCAGTTGATGCGACTTTTGGGTTGTCTCCACTTTCTTAGGTATTATGAAAAACGGCTG
CTGTGAACATTGATACACAAGTTTTTGTGTGAACGTATTTGATTTCTCATAGATACATAT
ACCTAGGATCGTAATTGCCAGGTCACGTGTTAATTTTATGTTTAACATTTTGAGAAACTG
CCAGGCTTTTCCAGAGGCTGTACCATTGTACATTTCCACCAGCAACCTGTCGGGGTTCCA
ACTACCTACCTACATCTTTGCCAACACTAGTTAACTTTTATTATAGCCATATGTGAAGTG
GTGTCTCACTGTGCTTTTGATTTTCATTTCCCTAATGGCTAATGAGGAGTCCTGGTGGCA
CAGTAGTTAAAGCACTCAGTTGCTAACTGAATGGTCAGAGGTTTGAACCTATCAGCCTGG
TTTGTGGAAGAAAGATGTGGCAGTCTGCTTCCATAAAGATTTACAGTTTTGGAAACCCTA
TGGGGCAGGTCTACCCTGTTCCGTAGGGTCACTATGAGTGATTCAACTCAACTGCAGTGG
GTTTGTTTTTTTTGTAATGACTAGTGATGTCATGACACCTAATTGTGTTCACGAGGAACC
TTTACATGGATCGAGGCAGTTGTTCACACAGAACAAGGGGATACTGATTGGTTTAAAGTC
AGGAAAGGTGTGTGTCAGGGTTGTATCCATTCACCATACCTATTCAATCTGTATGCTGAG
CAAATAACCACGAGAAGCTGGACTACGTGAAGAACGGGGCATCAGGATCGGAGGAAAACT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGTTGTACACAGGGTCTCTATGAGTCGACCACTTG
ACGGCACCTAACAAGTGATGTTGAGCATCTGTGCTTATTGGCCATTTATGTGCCTTTGGA
GAAATGTCTATCCAAGTCATTTGACAATTTTGGTGGAGTTGTAAGAGTTCTTTATGTAAG
TCTATTATCAGACGTGATTTTCAGATATTCTGTGGGTTATCTTTTCACATTGATGGTGTC
CTCTTATGCACAAAAGATTTTCGTTTTGATAAAGTTCAATTTAGCTTTTTCCTTTTGTCA
CCTATGCTTTTGGTGTCATTGTCTAAGGAATCATTGATTAATCCAAGGCCATGAAGATTT
ACGCCTGCATTTTTTTCTAAGTGTGTATAAGTTTTACCTCTTAACCGTTAGGTCTGTGAT
ACATTTTGTGTATGGTATGAGGACGGGGCTCCAGCTTCATTCTTTTGCATGTGGAGATCA
GTTGTCTGAGAAGCATTTCTCGAAGGCTGTTCTTTCCCCTTGTCAACAATCAGTTGATAA
TAAACCTAAAGGTTTATTTCTGGACTCTCAAATCTATTCCATCGATCTATATGTCATTGT
GCCAGCACCTCTCTGTCTTGATTATTGTAGTCTGTTTCTCTTTTAAGTAGAAAGTTCTCA
GTCTTTTGTTTACATGTGCGCTACAGCAGACGACTGACAGTTCCTGGTTTTCTTTTTTCA
AGGTAGTATTGAAATTTACTGTCCCAGAATACAAGGATCCTCTGGAATTTTTTACTTTGC
TTGCTCAAAGAAGAGGATTGCACCAAAAAGGTGGAAGCCCAAATGTGGAAGGTGCTGCCA
AACTGCTATGGTCTGAGTGGACAGGGTAAGGCTTCTCTCTTTTGGCGTTTTGATGCTCAC
AAAGAATAAAGGAAGTGCTTTTTGACGAATCTTGTCTTGAATACTAGTGCCACCTTAGGT
TACTATTCCCAGCCCCCGACATCCTGGACTTGTTGTCCACATCTTAATGAGCGCATAGTG
GCAGAAATGAAATTGGGCTTTAATATGGAAGAACTGAAAAAGAACAATGTACACAGCATA
CAAGGTGAGTGAGACTTATTTCACTGCTGTCTCCATTGGCTGACAGCAATGAAGGTCTCA
TCTGTTTACCTGGCTTTGTCCCTTTCCTAGCCATCAGGGGCTCTCGTTCAGCCAGTAGCA
TCCTTTTCCGATCTTCGGGTCTGACAAATGGAATCATAGAGGAAGAGGACATACCTGAGG
AATTGCCAAAACAGAAGGAGAGGAAGCAGGAGGAGGACATTGACAGTGACCAGGAAAGTG
TTGGTAGTGAAGAAGCTGGTGTAAGTGTGTTCTCCATGAGTTGTTTAAAGCTGAAGTGTA
TTTTCCAAAATTATAATGTACAACAAATGGGAAGGGCCTAAACGTGGCAATTAAATACTT
TGCAGTAGACGGTAAGCCTATACAGTGTGGGAATGCAATCCTTAGTCTTAATTTTACACA
TTCCATTACATGTACTGTCAAAGACTGAACTTTTCCCAGGTACATAATTACTTGGTTTAA
TGAGCAGACAAGGGCTATTAACCCAGTGACATTTCTCTTTGTCTTAAAGGAAAAGAACTC
AGACATGTCTCCTGCAGAAGACACATGGGAGGCATTTCCTGAGGAGTCTCAAGCAGGTTA
GTCTGGGGTAGATGAGTTCTAACCAAACAGCATCACAGAGTCACTTTTACTTTCAAAACA
AAAACGGTTAATTTTTCTCCAATGCAGGCAAACAGTTCTGCAGTCAAGAAGCAAGATCTT
TTGCTATGGATAAAACAATCAAAGAGGAGGAAGATGCCTATGACTTCAGTACAGACTACG
TATAGCAAAAAGCCTGTCCTATTGGAGGGGCTTCTGTTTTTTGAGCAGACTGCTCAACTC
TTCACCGTGTGTGTGTAACATACCGGTTTGTTAATTATGTCCTAAGCTGTGTAAATTTTG
TGAATATGTAGCATATGATATATTCATTAAAAAGAATGAGGCAATTTAGAAAGTGTCTAA
ATTCTCTAAGACAACAACTCATTTCTTACAATACAGTTTAGTAAGTGGGTAGAAGTACAG
TTACCAAACCAAGAAACGTCTTGAAAAAAGTAGGTTTCACTTTATTTACAAATCAGGCCA
CAACTTACAAAATTAAACCTAAGGAACAGTTTTAAACTAGCTGTACCAGATGAACCTTTG
TTCATTCAGCATCATAGTAAGAAAACACTTGGTAAGGCAGATGGAGACAGACTATATATA
AATACGCCAGACTTATGTAAGCTAGTTTGTCTTTATCCAGTTGAGATGTCCCTTTTTCTC
CATGGGTTACTACAGATGGGCATTGAAGCCTAGCAGCTGTGTTACTTCTGACACATACCG
TCTTCCAGGATATCCTGAGAAATGCTTACAGTTTAAAATTCTATTTTAATTCATATTTGA
GATCTCCACATGTCTTCGGATTAAGCTGAATTTGCCTGTTGGGTCGTGGAATATACCATT
TTCCCAAACATCAATATATGAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 1255..1368, 1602..1685, 2442..2574, 3418..3530, 3631..3757, 4726..4813, 6065..6239, 8882..9024, 9107..9243, 9330..9499, 9769..9835, 9927..10024
1001..1138, 1255..1368, 1602..1685, 2442..2574, 3418..3530, 3631..3757, 4726..4813, 6065..6239, 8882..9024, 9107..9243, 9330..9499, 9769..9835, 9927..10021
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved