Loxodonta_africana Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana GNB2L1
Loxodonta_africana
GNB2L1
GeneScaffold_4057
SNORD96
1508..1583
14449
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGTTTTATCTTCTCTTATCCCAGCAGAGTACTTCTTTCTACGCGT
TAAGTTTACCTCTTTGCAAAGGCTTCCCCGGGATTCTCCGGGAAAAATTTGTATACACTG
CCTCGCGACATTATGCGACTACCCAGTAATCAGCAAGGTTTTGGCAGAGTTCAGACTGGC
AGGATGGCTAGTATAGAGGAGGCAAGAGTTTCTCAATGGGGTGTACTTTTTGTTTTAACT
CTCCGTAGATAAGACTATCATCATGCAGAAGCTGACTAGGGATGAGACCAACTATGGCAT
CCCCCAGCGTGCTCTGCGTGCCCACTCTCACTTTGGTAGTGACGTGGTTATCTCCTCTGA
TGTCCAGTTTGCCCTCTCTGGCTCCTGGGATGGGACACTGCGCCTCTGGGATCTCACAAC
GCAAGTACCTGCTCGCTTAGCTTTGGGGCCTTGGGGGGAAAGCTGGGCAGAAATGAGGAA
AATGGCTGAGTCCTCCCTCCTTGGTTGATTCAGACTCAGAGAGACCCTAGAAGACAGTAG
AACTGCCCCATAGGGTTTCCAAGGCTATAAATCTTTACAGAAGCAGACAGCCACATCTTT
CTCCTGTGGAGTGGCTGGTGGGTTCAAACCACCAACCTTTGGTTAGCAGCCAAGCATTAT
AACAACAGTGCCATGTGGGCAATTTGAATTGAGTGAAGCAGTTAGGAGTACACACAGTGG
TTTGAAAATGTTTGGCCTTGGTAGCTCTGTCCTGGGTGTTGGTCAGCTGGTGACAATTAT
AATGGAGCATCCTGGTGATGACAGATGACATTGTCAGCTGATCCCCATGTGGGAGTGAGG
ACATGTCCTGCAATTCTGAGGGATTCTCTGGCATATACTCAGACAAAAGCTTGCTGTAGT
CAGAGCCATAGCTTGGGTTATCTGAGTAAAGAAAATCCCCTGGGGACAGGGACAAGGCCC
GGAAAATGATGTGACTGTGGTAGGAGAAAGTTTGCAAGGTGTCTGTAGAGAGTGACCAGG
TCCTCCTTCTTAGGGGCACCACCACACGACGATTTGTGGGCCATACTAAGGATGTGCTGA
GTGTGGGCCTTCTCTTCTGACAACCGGCAAATTGTCTCTGGCTCCCGAGATAAAACCATC
AAGCTGTGGAATACTCTGGGTGTCTGCAAGTACACTGTACAGGTAAAGTGAAGGCATGGG
GGAAAGAGTGCATCTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
TAACGTTAATCACGTGTGGTGGTTTCAAGTATTGTCTGGCATCTAAAAGTTTCGGGACGA
GAATATAAGACTGCTAGCATCCGTCTCACATAGCTGAGAGGAGGAATAGTGGTCTAGAGT
TTCATGGGCCAGAATGTTTCCCCTTATTTCTCTGTCTCCTGTAGGATGAGAGCCACTCGG
AGTGGGTGTCTTGCGTCCGCTTCTCCCCCAACAGCAGCAACCCCATCATCGTTTCCTGTG
GCTGGGATAAGTTGGTCAAGGTGAGCTTGGAACCAGGGCCACAAGGCCTTTACCAGCCAG
AAACTGCTCCCATTGCATCTAGATGGTCATAGGCTCCAACTCGGAAACCTTTGCAGATTC
TCTCCTGAGACATTTCTGTCCAGCATGCCTTTCATCCTAACCAACCACCTGGAGTTAGGT
CAGATCTCACAAGCTAAATGTTAGTGTTCTCTAGATGCCAGGTCTTCCCGAGACTTCGTG
CTGGTCACAAGCTTGGGAGTCCCCTGTGACACCCTCACTTCTGACCTGATAGCTACAAAT
CTGGGATCTTCCCACTACCTTGGGTTTGATAATTCACTATAATGACTCACAGAAAGTGTT
ACACTTACTGGGTTACAGCTTCATTAGGGCAGCATCTGGATACTGGATAGCGTTGCCAAC
ATGGAGCTTCCGGCCCCAAAAGGGACACTACCCACCCGTGTCCATCACTGTCTTTTGCCA
ACCAGGAAGCCCTTGGAGCTTCCCTGACTAGAGTCTTTTGGGGACCTCGTTACATAGGCA
TGATTGAATTTTGCTTCCCTTTCCCTGAGGTTCCCCTTGGGTCTTTCTGGCCTGGCCACC
CTCTACTTGAATCACCTCATTATCATGATGTCAGATCTAGGGTTCTCTTAATAAAAACAC
TCAGTTACTAGGGATACTCTGTTTTAGAGGTTATCGCAGGAACCAAGCACAAAGACTAGA
TTCTTTGGGTAAAGTTAAATTTTTTACCCCACACTCTGACTTGACTTTTTTCCTCTTGCT
GTTATTTTTCTCAGTATCAGCTGTTCGTTTTTGTTATTTGGTCTGCAGTGTTCTCAAGTA
GCAAATGAGCCCCAAGTCCCTTGTAGGACTGCACCCAGAGTATTTGGTACCCATTTTAAT
CCCAACTGTCCTTAAATGGCCAAGGCAAATTCTTTAATTTTTTTTTTTTTTTTGTGTGTG
TGTGATAAATGGCTGCCCTACCCAGGAGTACTTTTAAACAGGTGTCATGCCTTTTTTGTT
GGGGCCCTGAATCCTACACCTTGGCTCATCTGGAGCCAAGTTCCTCACCTGTGTGGACCC
TACCTCTCTATCAACTTAGGTTTGGGACCTGGCTAACTGCAGCTGAAAACCACCACATTG
GCCACACAGCTACCTGACACTGTGACTGTCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAGTATAGTAGAAAAGAATACTTGATGAGATAGTAAGATAAATACAGAAATAGAGT
TTCTGAAGATCATTTTTTAAAAATAATACAGATAAGGTATTCTGTTGAAAGGATTGTTTT
CTGTAAAGCCGATTTGTTGAAGCAGTTGATGAGGTTAGGCTTTTGTAATTTCAGAGTTGA
TTATAGTGAATTGTAAGTTGTCAGGATTTCTTCATACATTTGGGGGGTGTCCTGTATTAA
TTGAAAAGTATACTGAGATAAATATTAGTATTTGCGTCATGAGCTTACAAGAAATTGGGG
GAAAGGTTAAAACTTGATTAGGATACAACCTTGGGACGGGTGGGATTAACATGTGGAAGA
GGTCTCGTTGCCCTAACTCACTTCCCTGTCTGTCCAGGATGGCCAGGCCATGCTGTGGGA
CCTCAACGAAGGCAAGCACCTCTATACCCTAGATGGTGGGGACATCATTAATGCTCTGTG
CTTCAGCCCCAACCGTTACTGGCTCTGTGCTGCCACAGGCCCCAGCATCAAGATATGGGT
GAGTATGGGTTGAGGGTCAGGCTAAATATCTGGCTGCATGCTGGGATCCCTAGTCAGTGT
TGTGATTTCCCAATATACCATCAGACTCCCTGCTGAGATTAAAGCTTTCTGAACTGCCAG
CCATCAAGTCATCAAGAGACCGAGGAAGGGTGGGTTAAAACTTCCTGGGATTAGCTAGAG
GAATACCCAATTATAGCGCTTACTCAACTGCAGAGCAAATGACATTTGGAGCTGGAAAAG
TCTTATAAGAGGACTGCTCTGTACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGAAGCAGGAAGTTATCAGCACCAGTAGCAAGGCCGAGCCACCCCAGTGCACTTC
TCTGGCCTGGTCTGCTGATGGCCAGGTAAGTGGGTCCGTCTTCTCAGGTTGACTCACCTT
CCACCTTTTCTGCTCTTGGTGTGATTAGTCTGGTGTGATTTAGTCTATCAGTCACAAGAC
CACCACCTTTAACATATAGTATGATGAAAGGTTTGCTGTGCTTATTTAGCAAAACTTAAC
TAGGCCTACCAGTGAACACACGGTACATGTTCCTGCATGAGGAAAGATTGATCTGGAGGA
TATTGGTTAGCTGCCTTTCAGTAAATACCTTGATTAACTTGACCAGTTAACAAATGTATA
AGTCCTTTAAATAAAAAAAAGCCCTTAGACCCAGTTTTATTGTAGGAATGTATAGTCACC
ACCTGCAGTCTGGTTTAGAACAACAGGGATCTTAAAAAGAAGAGTCATCTTTGCTGACTA
GTGAACTGTAGAGTTCCATGGCTCCTACCTGCCTTAATCAGATAAAATTTCTCTTTTCTT
GCAGACTCTCTTTGCTGGCTACACAGATAACCTGGTGCGAGTGTGGCAGGTGACCATCGG
CACTCGGTAGAAATTTATATGGCAGAGCTTTAGAAATAAACTGGCTTTCTGACTTTTTGA
AAGTGTCTTTCTCTGATAAGCACAACAGCCACTTCTGTCACTACTGCATATGGATTTTTT
TAAAAATCTCTTCAGTTAACGTGTTCACAAACTGAAAGCAGATGATGAAACAGGTAAACA
AGGCTTTGATACAACAGTTTATGTAGGCTTCCTGTAGTGTTGCTGGAATGCAATATGGTG
TTCCTGCAAAGTTATGTAGGGATAAGGTTTCTTGAACTTGTACCATCGTAGTGGCCCATA
TTTTGGTACAGATTCTTAGGGCCTAAAACCTACAGAGAATGTTCCTGAGGGAAGGGGGCT
ACAGTCCATTTAAGAACGGCAGGCTTAAGTCACCTAACACAAAAGAACTGAAAAATATCA
CTCTTTCAAAAGTTTATGAATATAAGCTAGGAAACATTTTGAAACTTGAAGTTAATCTCT
GTTACTTGGGTCATGGTGTTAAAATGATTTTTTTAAATCTTCAAGTAAACTCATCGGAAG
AGTTGCCACCTTCGTTCCTCTTTAATTAGAGATGAGAGATTGGCTGGTGTGGTCTTAAGC
TACTCCTATATATAATCATAAAACTGGCTTTACTGGTTTAGCCCTGCTGCTTCTGCTTTA
TTACATATAAGAATTAGACCTCGTGCAAATTCTCATTGAGGAAGGTCTGGTGGGACCTGA
GATTCCAGCCATGCTGCTGGTCTTCAGACTACACCATTATTATAGGGAATGCTGGAATTT
AGTAGTTGTAACAGGCATGGAATAGTTCAAACCCAGCTTACAGCCTAAAGCCATTGCCAT
TTGCTCTGTACAATTTTCTTAAGCAATGACTTAAAGATAAATGCAGTCTACTGAAGGTGT
AACTTTAACTTCATGGGACTCAAATAGTTCACAATCGGGCTCTGAAAAATGTTTCTAGGC
TCTGGGCTTGAGAGCCAGCAAGAGAAACTAAGTAGGGCAGGAGTTACATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 1753..1803, 1805..1901, 2204..2299, 4069..4179, 6157..6297, 12814..12924, 13384..13449
1001..1143, 1753..1803, 1805..1901, 2204..2299, 4069..4179, 6157..6297, 12814..12924, 13384..13446
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved