Loxodonta_africana Locus ENSLAFG00000016213
snOPY snoRNA Orthological Gene Database
Loxodonta_africana ENSLAFG00000016213
Loxodonta_africana
ENSLAFG00000016213
GeneScaffold_1490
SNORD32, SNORD34
3051..3132, 4061..4131
5228
AGGGAAGGGGTTGCCGGCAAAGAGAACAGCACGTACAAAGCCTGGAGGAAAAAAGGAGG
GCATAGGACAATGTGGCTGGAACGGAGTGACCAGGGGGTGGTGAAGGGGGGAGGAGTGGA
CAGTGGCAGAAGAGGCAGGTCAGCAGGGGCCAAATAACAAGCGCTGCAGACTTGGAATTT
GTCCGGGGGTACTAGGGAAGCTGGGAGAGCTGACTGCAGAACCAGGACCCTGGGGGGCAC
CGCCAGGAGGGGGAGCAATACTTAGGTACTGGGGCAGCCAAAGGGAGCTGGGATTATGGC
AAGTCAGATTTTGGAAGGTGGGGTGGAGGCGAGGCCATCTCAGGAAACAGACTCAGCCCA
AGTCCAGTCCAGAAAGTGAGAAGCTCTTCAGAGAACACTCAGACGCTTGCTGCACTGCAG
CCCAGGCACCTGAAATTCATTGCGTCCTACACTCTAGGAATTCAAAGGGGAGATCACCTC
CACCTGTCCTACAGATGGAAACACTAAGGGGCAAGACGGGTTTGTCCAGGTCTCAATGAG
GCCGATCAGGCACCGGAATCCTGACCTGGAAACTAGACTGAGCGAAGAAGGGCGATCCTG
ATCGCCACCTGCAGGCCACCATGTACCCCGCAGCCCTCAGTCGCCAGAATGGGTAATTGT
GCTTCCCCTCCCAAACAAGGCAAGCAGCTCATGTGGAGGGGTGGGGAGGTTAGCAGCCCC
TCGAGAACATGGCCGCCCCAGCAGAGCTGCCTCCACACCCCACGTAACCTCTCGCCCCGC
ACGCCCATGGCCGCTGAGGTCCGATCGGAACACTAACCGGATCGGACAAGCAGGAGACTT
CCGGCCCTCAGTGGGCGTCGCGGGCCACTCCGCGCACGCATGTATCACTTTGGCCAATTA
AAAGGCCGCGTAGCCCGTGTGGCGTCACTTCCGCCTCCCGCTTTTCGGGGGATAAGAAAC
CCTGTGGTGAGACTTCCTTCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTGG
GGGCTCCGCGCGAGTCGGGGCAGTGTGGGTTCTGGTGGGTTCCAGGCCGGGACGGGGCCG
AAGTCTCTTTCCCTTAGCAGGTGGCTGTGGAATCTAAGATTGATAACTGAACAAAAGGGG
AGAATTTGGGGGTAAAGGGAGTTAATCGGGGAAAAAGGAGAGATCCCTTTAGGGGAAATC
GGAGCTGCGCTTAGGCCTGGAACAGACTGACTAAAATGCGGTCTTTGGTTCCTCCTCGAG
GAGCGATGGTGGGAGTTTCCCAGGAGAGGGAGAGAGAGTTTATAACTAGGTCTCCCTTCT
CTCCATCTCGGGAGGTTGGGATCCTGGCGTCTTGGCCTTGAGTGTCTTAAGTGTCCCCAG
CGATGAGGAAGCACCGGGCTGCCTCGAGGGATGAGAACCGAGGGATGGCTCAGATGCAGG
CCGTCTGCACTGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCC
AGAAGCCAAAACGGGAGAGTGCCTAACCCCTTTCGCGTTGCGCCAGGATTGCTTCACGTG
GAATGCTATCATGGGGCCCCTGCGATTCCGGAGTATTTGGGATATGAAGTCTGTCTAGGA
AAAGGTACCTGCTAGACCTTCAGGATTGCATTGCTTTTTTTCTTTGTTATGAGGTTCGTG
GTTGAGGGCCCCCCAGCTGCAGAGCATCCTTGGGTTTTAGCTCTTTTAATCCAAAGCATT
CTGGGAATCACAGCTGAAGCTTAGCTCTTGGTTTTCTGGTTCCTAGTGTAGTCTTTTGAT
ATATGAAGGAGAGGGTGGTTCTGGAAAACGGTTCCTTGCTAGTTTTTTTCTAACTAATTA
ATTTTGTTGGGATCGTACAACCAAGGTTTGGAGTCTAGGCAGACCTGGGCTCATCACCCT
AGCTTTGGGACCTAGGCACATGGTTAAGATATCTCAGCGTGTGTCCTGGCACTTTATTCT
CGGTGCCTGGCGCAGTTTGCAGTCGTATTCTGTGTAATTCAGTTGCTCATCGCAGTGAGT
CCTGAGGGGAGATCTGTCATTCTCATCTTCCCGGTGAGAAAATTTGAAGCATGGAGTGTT
GGGGATTGTTGGCTGAAGTCCTATCAGGAAGATAGGGTTTAGATTGTATGCTCTGCTGTA
CTGCTTTTTTGACGTCACAAAGTATATCGGAAAAAAAAAATCGTCATTGTCTATTCTGAC
TCATAGCAGCCGTTCAGGACAGGGTAGGTACTGCTCATAGGGTTTCCGAGACTGTAATCT
TTATGGAAGTAGATTGTCCGTCTTTTCTCGCACAGAGCCACTGGTGGGTTCAAACTGCCG
GCCTTTCATTTAGCAACCAAGTGCTTAAACCACTGCGCCACCAGGGCTCTATAAGTAGGT
GATCTCGGTATATTACATAATGAGAGGTGATGTCTTAACTCAGTAGGGATACTAGGTTCA
GTGCTTCAGTTTAAGCAGAGATGCAGGCATCAGCCCTTTCTGAACCTTAGTTTTTTTTTT
TTTTTTGCTATAAAGTACACTGAGAAATCTCGTCTTTGAAATCAGGAAGGGTTAAGTTCT
GTCAGGATCCGTGAAGTTGTACTACAGGTTCTACTATTAGTGAATATTTTTGATACAAAC
CCCAGTTCTTACGTTTAGTGGCTGATCCACTTGCTGATGGAAATCCTGAGTCCACCTTTT
ACCGTTTTTCTTATTTGTAAAGTGGGGCTTGGATGGATGCTACTTGTCACCTGGTAGTTG
GATACAGGGGATGAGGTGAAAAAGCAAGAGAAAGGAAGGGTTGCTTGTGGTGTAGAGACA
AAAGAAGACAGTGGGTGCCTCTCTGAACCCTCTAACCTTATTTGTCTTCCCAGGTCCTGG
TACTCGATGGCCGAGGCCATCTTCTGGGCCGCCTGGCGGCCATCGTGGCCAAGCAGGTGC
TGTTGGGTAAGTGCCCCCTGCCGGCACATCCCTGCCATTCACTCAGACTGCAGGTCAGTG
ATGAGCAACAAACACCATCTTTCGTTTGAGTCTCACGACCATGAGATCAACCCCATGCAC
CGCTCTGAGACCTGCCGGCCCTCCCTCCCCAGGGCACGGGGCTCCTGGCTCTGGGATAAT
GCCCTTCTGGGCTAGCTTTAACTGCAGCATACATCCAGCTTCACTGGTGACTGCTGTGTG
ACTTGGGGCAAGAGGCTGTCCTCCTGAGAGCCTTGGCTTCCTTCAGGGTTGTGGTCAGTG
CGACACAGCGAGCCCCCGGCAGTGCCTGGACAGGTGGGGTGGTGGGTCAGATCCTCTTCT
AACCTTTTCTTTTCCCGGATTGCTTCCCACTAGGCCGGAAGGTAGTGGTCGTGCGCTGCG
AGGGCATCAACATTTCTGGCAACTTCTACAGAAACAAGTGTAAGTTAAGTGCATCAGAGG
AAGCCTGCCAAGTCAGCCTGTGAGATGCTTAGTGGTGGAAGGTGCTGATGCCTGGACGGC
ACAAGTCTGGGTGCTTGTGGGGGGGGGGTGGGGGGTTTGGGTCAGGGGCACTAGGTCTGG
TTAGCCTGCCCTAACATGGTCACTCCTCTTCACAGTGAAGTACCTGGCCTTCCTCCGCAA
GCGCATGAACACCAACCCATCCCGCGGCCCCTACCACTTCCGGGCCCCTAGTCGCATCTT
TTGGCGGACTGTGCGAGGTGAGAGGACCACGGGCAGCCTGTGCAGGGGGCAGGGTTTGGG
CGTGTGGCCAATGATGAAGACTTCTCCCGCTTGTGTTCGAGTTTCCCGACCATGAGAAGA
CTTTACATGCACTACCATCTGAGGCCACCCATCTGGCCACCTGGGGATGGGTGAAGGGGA
GCGGGACATCCTCCTGAACACTGTCTCCCTGCCCATAGGTATGCTGCCCCATAAGACCAA
GCGTGGCCAGGCTGCCCTGGATCGCCTTAAGGTGTTTGATGGAATCCCGCCCCCCTATGA
CAAGGTGAGCTAGAGCAGGCCCTACGCAGCACCCACATACCCAGCGTCTGTGATGTTCCT
TGACTACCTACATTGTTTGATCCTCATGAGAACAGCACTGGCTGAGACGCCGAACCCCTG
GGCCCTTTCACCATGTCTGTCAGTCACCCCAGCCCTCTAAGCCCTCCCTTTCTTCACAGA
AAAAACGGATGGTGGTTCCTGCTGCCCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2933..3005, 3393..3458, 3635..3736, 3938..4023, 4199..4228
1001..1015, 2933..3005, 3393..3458, 3635..3736, 3938..4023, 4199..4228
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved